ID: 1077051814

View in Genome Browser
Species Human (GRCh38)
Location 11:569934-569956
Sequence CTCCTAGGGCAGTCAGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077051809_1077051814 2 Left 1077051809 11:569909-569931 CCACGTCTTCATGGCAGGGCAGA No data
Right 1077051814 11:569934-569956 CTCCTAGGGCAGTCAGACTAGGG No data
1077051804_1077051814 13 Left 1077051804 11:569898-569920 CCTGAGAAGGCCCACGTCTTCAT No data
Right 1077051814 11:569934-569956 CTCCTAGGGCAGTCAGACTAGGG No data
1077051808_1077051814 3 Left 1077051808 11:569908-569930 CCCACGTCTTCATGGCAGGGCAG No data
Right 1077051814 11:569934-569956 CTCCTAGGGCAGTCAGACTAGGG No data
1077051803_1077051814 14 Left 1077051803 11:569897-569919 CCCTGAGAAGGCCCACGTCTTCA No data
Right 1077051814 11:569934-569956 CTCCTAGGGCAGTCAGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077051814 Original CRISPR CTCCTAGGGCAGTCAGACTA GGG Intergenic
No off target data available for this crispr