ID: 1077053154

View in Genome Browser
Species Human (GRCh38)
Location 11:576704-576726
Sequence CGCGCTGGCCGCGGGCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077053145_1077053154 3 Left 1077053145 11:576678-576700 CCTGCACCGCGGGGCGAGGCCTG 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1077053154 11:576704-576726 CGCGCTGGCCGCGGGCCGGGAGG 0: 1
1: 0
2: 5
3: 53
4: 349
1077053146_1077053154 -3 Left 1077053146 11:576684-576706 CCGCGGGGCGAGGCCTGCGCCGC 0: 1
1: 1
2: 2
3: 26
4: 186
Right 1077053154 11:576704-576726 CGCGCTGGCCGCGGGCCGGGAGG 0: 1
1: 0
2: 5
3: 53
4: 349
1077053140_1077053154 22 Left 1077053140 11:576659-576681 CCACGCGCTTTGTCTGCGGCCTG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1077053154 11:576704-576726 CGCGCTGGCCGCGGGCCGGGAGG 0: 1
1: 0
2: 5
3: 53
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077053154 Original CRISPR CGCGCTGGCCGCGGGCCGGG AGG Intronic