ID: 1077053444

View in Genome Browser
Species Human (GRCh38)
Location 11:578120-578142
Sequence CAACCAGGAGGTCCTAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077053444 Original CRISPR CAACCAGGAGGTCCTAAGCT AGG Intronic
900119635 1:1042986-1043008 CAATCAGGAAGCCCCAAGCTTGG + Intronic
910859628 1:91731227-91731249 CAACCAGGGGGTCCCAAGACTGG + Intronic
912467381 1:109883356-109883378 CACCCAGGAGAGCCAAAGCTGGG + Intergenic
913335301 1:117704080-117704102 CCACCAGAAGGTCTAAAGCTAGG - Intergenic
1064136244 10:12753356-12753378 CAACCAGAAGGTCACTAGCTGGG + Intronic
1065526372 10:26625385-26625407 CAACCAAGATGTCCTTCGCTAGG - Intergenic
1067934793 10:50600657-50600679 CAGCCAGGAGGACTGAAGCTGGG - Intronic
1076116589 10:127905898-127905920 CAGCCAGGAGGAGCTGAGCTTGG + Intergenic
1077053444 11:578120-578142 CAACCAGGAGGTCCTAAGCTAGG + Intronic
1077228689 11:1449257-1449279 CAACCAGGAGGGCCTGGGCAGGG - Intronic
1077521537 11:3038369-3038391 GAACCAGGAGCTCCTGAGCCGGG - Intronic
1078884854 11:15490044-15490066 CACCCAGGAGGTCCTAACCTGGG - Intergenic
1080347021 11:31336326-31336348 CATCCAAAAGGTCCTAAGGTGGG + Intronic
1083020388 11:59500970-59500992 CAACCAGTAAGTACTCAGCTGGG + Intergenic
1083681358 11:64353294-64353316 GACCCAGGTGGTCCTGAGCTGGG + Intronic
1085417265 11:76327771-76327793 CCACCAGGAGCTCCTGAGCCAGG - Intergenic
1087084459 11:94202484-94202506 GCACCAGGAGGTCCAGAGCTTGG - Intergenic
1090794913 11:130126614-130126636 CATCCTGCAGGTCCTGAGCTGGG + Intronic
1099215310 12:79846013-79846035 CAAACAAGAGTTCTTAAGCTGGG + Intronic
1101517604 12:105451351-105451373 CCACCGGGAGGTCCTGAACTTGG - Intergenic
1101601417 12:106213328-106213350 AAAACAGGGGGTCCTAAGCTAGG + Intergenic
1103624374 12:122206959-122206981 CCACCAGGAGGTCCTGGGCTGGG - Exonic
1103915310 12:124372868-124372890 CCACCAGGAGGTCCTGGGGTTGG - Intronic
1111738111 13:92167944-92167966 CAACGAGGAGGTCCAAACCTTGG + Intronic
1115907521 14:38216851-38216873 AAAACATGAGGTCCTGAGCTGGG - Intergenic
1118004575 14:61553930-61553952 CAACCAGGATGACCAAACCTGGG - Intronic
1119114831 14:72009649-72009671 CAACCCAGAGCTCCTGAGCTAGG + Intronic
1119548732 14:75492840-75492862 CAGCCAGGAGGTGCCAGGCTGGG - Intergenic
1122268547 14:100557981-100558003 CAACCAGGCAGCCCTCAGCTGGG + Intronic
1128788546 15:70415815-70415837 GAGCCAGGAGGGCCTGAGCTGGG - Intergenic
1130044321 15:80431844-80431866 CCACCAGGAGGTCCTGAGAGAGG - Intronic
1130554565 15:84913754-84913776 CATCCAGGAGGCCATAAACTGGG + Intronic
1132384413 15:101390064-101390086 TAGCCAGTAGGTCATAAGCTGGG + Intronic
1132855143 16:2041392-2041414 CAGCCAGGAGGTGCAGAGCTGGG + Intronic
1133666026 16:7968697-7968719 CAACCAGCACGTCCTCAGCTTGG - Intergenic
1135468844 16:22711617-22711639 CAGCCAGGAAGTCCTGAGTTTGG + Intergenic
1137711026 16:50566972-50566994 AAAACAGGAGTTCCTAACCTGGG - Intronic
1141659610 16:85435002-85435024 CACTCAGGAGGGCCTACGCTTGG + Intergenic
1142752172 17:1995472-1995494 CAGCCAGGAGGGCCTAAGCTTGG + Intronic
1143287091 17:5798316-5798338 CAACAAGGACGTCCTGAGGTGGG + Intronic
1143737111 17:8919459-8919481 CAACCTGAAGTTCCTAAACTGGG + Intronic
1145005078 17:19333042-19333064 CAACCCTGAGGTCCTGAGATGGG + Intronic
1147912560 17:43864691-43864713 GAACCAGGAGGTGGTCAGCTTGG + Intergenic
1148808157 17:50274494-50274516 AAGCCAGGATGTCCCAAGCTTGG + Exonic
1154017320 18:10630581-10630603 CATTCAGGAGCTCCAAAGCTGGG + Intergenic
1157734600 18:50035651-50035673 CAACTAGGAGTCCCTTAGCTTGG - Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1166123612 19:40700502-40700524 CAAGGAGGAGGTCTCAAGCTGGG - Intronic
1166399259 19:42465980-42466002 CCACATGGAGGTCCTCAGCTGGG - Intergenic
1166572074 19:43803393-43803415 AAACCAGGAGGTGCTAGCCTGGG - Intronic
925479395 2:4253187-4253209 TAACCAGGAAGTCTTCAGCTGGG + Intergenic
925635751 2:5940415-5940437 CAACCTGGAGCTCCAAAGCTGGG - Intergenic
929574774 2:43044477-43044499 CAGACAGGAGGCCCCAAGCTCGG - Intergenic
935373329 2:102370156-102370178 CATCCAGGAGCTCCAAGGCTAGG - Intronic
937159446 2:119746367-119746389 CAATGAGGAGGGCCCAAGCTTGG + Intergenic
938632202 2:133178873-133178895 AAACCAGCAGGGCCTAAGCATGG + Intronic
941283201 2:163578415-163578437 CATGCAAGAGGTCCTCAGCTAGG + Intergenic
945287940 2:208100863-208100885 CAACCTGGAGGTGCATAGCTTGG + Intergenic
946640109 2:221774918-221774940 CAACCTGCAGATCTTAAGCTGGG - Intergenic
947247416 2:228065035-228065057 CAGCCAGGAAATCCTGAGCTTGG - Intronic
948160011 2:235815610-235815632 TGACCAGGAAGGCCTAAGCTAGG - Intronic
1171178053 20:23069508-23069530 CAACCAAGATGTCCTTTGCTAGG + Intergenic
1172792105 20:37512835-37512857 CAACCAGCAGGTACTATGCCAGG + Intronic
1177281890 21:18991589-18991611 GAACCAGGAGGTCAAAAGCTGGG - Intergenic
1178130318 21:29564684-29564706 CATGCAGGAGGACCAAAGCTAGG - Intronic
1182367341 22:29788101-29788123 CAACCATGAGGTGCTGAGTTTGG + Intergenic
1183036327 22:35143575-35143597 CAAACAGGAGGTCCAAACGTGGG + Intergenic
951507978 3:23470145-23470167 CCACCAGGAGGTCCTAAAATTGG + Intronic
954368222 3:50157100-50157122 CATCCAGGCAGTCCTCAGCTCGG + Intronic
956955883 3:74339221-74339243 CAAAGAGGAGGTTCTAAGCAAGG - Intronic
957861060 3:85950638-85950660 CAACCACAAGCTTCTAAGCTTGG + Intronic
959685279 3:109139327-109139349 CAACCAGGAGTTAAGAAGCTGGG + Intergenic
967067043 3:185927548-185927570 AAATCAGGAGCTCCTAACCTAGG + Intronic
969353461 4:6611476-6611498 CAACTAGGAGGTACAGAGCTGGG + Intronic
969573709 4:8024583-8024605 CCACCAAGAGGTCCTAGGCTGGG + Intronic
978014658 4:103727706-103727728 CATCAAGGAGTTCCTAAGCCAGG - Intergenic
980199376 4:129635924-129635946 CAACCAGGGGGTGGGAAGCTAGG - Intergenic
982003931 4:151046966-151046988 AAACCAGGGGGTCATAACCTGGG + Intergenic
985848101 5:2368801-2368823 CAACCAGGAGATCACAAGCAGGG - Intergenic
993844411 5:92922691-92922713 CCACCAGCAGCTCCTAGGCTAGG + Intergenic
995544735 5:113218453-113218475 CAACCAGGAGGGCAGAAGGTGGG + Intronic
998467309 5:142356680-142356702 CTACCCGGAGGTCCGAAGCCCGG + Intergenic
998700883 5:144698401-144698423 CAACCTGCAGGTCCTGAGTTAGG + Intergenic
1006109346 6:31735323-31735345 CAGCCAGGAGGTCCCAAGACTGG + Intronic
1007039054 6:38704506-38704528 CAATCAGGTGGTCCTAATCCAGG - Intergenic
1011518650 6:88180376-88180398 CAACCAGTAGGACCTGAGTTGGG - Intergenic
1016432941 6:144007398-144007420 GAAGAAGGAGGACCTAAGCTGGG + Intronic
1022888716 7:34674107-34674129 CAACAAGGAGGCCTGAAGCTAGG - Intronic
1023113090 7:36833977-36833999 CAACCTGGAGTTCTCAAGCTTGG - Intergenic
1023991174 7:45129804-45129826 CAACCATGTGTCCCTAAGCTTGG - Intergenic
1024517019 7:50267760-50267782 CAACCAGGTAGGCCTCAGCTAGG - Intergenic
1028816405 7:95151222-95151244 CCACCAGGATGTCCTACACTGGG + Intronic
1038016506 8:23520345-23520367 CAACATGGAGTTACTAAGCTGGG - Intergenic
1039713607 8:40084955-40084977 CAACCACCAGTTCCAAAGCTGGG + Intergenic
1042243918 8:66692057-66692079 CAACCAAGATGTCCTACCCTAGG + Intronic
1049586799 8:143436109-143436131 CCACCAGGCTGTCCTCAGCTGGG + Intergenic
1051331672 9:16030619-16030641 TCACCAGGAGGTCCCATGCTTGG + Intronic
1051481755 9:17569286-17569308 CATCCAGGAGGTCTGAAGTTGGG + Intergenic
1052023567 9:23551181-23551203 TAACCAGGAGGTGCTAAGGGGGG - Intergenic
1059283890 9:113156599-113156621 CAGCCAGGATCTCCTTAGCTGGG + Intronic
1187519340 X:20000106-20000128 CAACCAGGAAGTACAGAGCTGGG - Intergenic
1187887877 X:23906438-23906460 TAACCAGGGGTTCCTAACCTGGG - Intronic
1187911261 X:24113283-24113305 CAACCAAGATGTCCTAAAATAGG - Intergenic
1191922169 X:66268607-66268629 CAACTAGGAGGTTCTTAGCTTGG + Exonic
1194241633 X:91456784-91456806 TAACCAGGAGGTCTTGAGTTTGG + Intergenic
1199579102 X:149343833-149343855 CAACCAGGAGCTCCGAAGTTAGG - Intergenic
1199658360 X:150021481-150021503 CAACCAGCAGGTACTGAGATAGG + Intergenic