ID: 1077054009

View in Genome Browser
Species Human (GRCh38)
Location 11:581392-581414
Sequence TGACACGGGGATGTGGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077054009 Original CRISPR TGACACGGGGATGTGGCCTG TGG Intronic
901483329 1:9540508-9540530 TGACAAGGGGAGGTGGCGAGGGG - Intronic
903377634 1:22876623-22876645 TGACAGGGGGATGGGGTCAGTGG - Intronic
904395796 1:30221006-30221028 TGACACAGGGGTGTGGCCGGGGG + Intergenic
905650345 1:39652373-39652395 CCACATGGGAATGTGGCCTGAGG - Intergenic
905946076 1:41902382-41902404 TGAGGCTGGGATGTGGCCTGAGG - Intronic
906120844 1:43389620-43389642 TGATAAGGGAATGTGGGCTGGGG - Intronic
909534837 1:76725014-76725036 TGCCATGGGGATGTTTCCTGGGG - Intergenic
912493872 1:110078779-110078801 TGACTCTGGGAAGTGGCCTGGGG + Intergenic
914854073 1:151337478-151337500 TGACACTGGGATTTGTCCTCAGG - Intergenic
915933889 1:160078657-160078679 GGAGACGGGGATGTTGACTGGGG + Intergenic
921794480 1:219326548-219326570 TGACTCGGGGTAGTGGCCTAAGG + Intergenic
922038293 1:221871248-221871270 TGCCACGTGGAGGTGGCCAGGGG - Intergenic
1067030392 10:42875658-42875680 TGACTCTGGGAGGTGGACTGAGG + Intergenic
1070382801 10:75896503-75896525 TCACAGGGGCCTGTGGCCTGTGG + Intronic
1070559491 10:77555139-77555161 TGACATAGGGAGGTGGGCTGGGG + Intronic
1072566054 10:96617628-96617650 TGACATGGGGATGTGGCTGGGGG + Intronic
1072903641 10:99430990-99431012 GGATACGGGGAGGTGGCCGGAGG + Intergenic
1074518967 10:114199420-114199442 TGAGACGGGTGTGTGGCATGGGG - Intronic
1076763380 10:132616728-132616750 TGACATGGCGATGTGTCATGTGG + Intronic
1076774523 10:132687407-132687429 TCACCAGGGCATGTGGCCTGGGG + Intronic
1076774533 10:132687447-132687469 TGACATGGGGCTGTGTCCTCAGG - Intronic
1077053994 11:581299-581321 GGACACTGGGGTGTGGCCTGTGG + Intronic
1077054009 11:581392-581414 TGACACGGGGATGTGGCCTGTGG + Intronic
1077423588 11:2464118-2464140 TGGCACAGGGATGTGGACTACGG + Intronic
1078450357 11:11436355-11436377 TGGCAAGGGGATGTGTCCTGTGG - Intronic
1081450485 11:43166926-43166948 GGACACCGGGATGTGGACTGGGG + Intergenic
1081703860 11:45168908-45168930 GGAGAAGGGGGTGTGGCCTGTGG - Intronic
1083189548 11:61040089-61040111 TGTCCCAGGGGTGTGGCCTGAGG - Intergenic
1083678765 11:64341898-64341920 AGACATGGGGTTGTGGTCTGGGG - Intronic
1089809083 11:121116641-121116663 TGAGACTGGGATTTGGCCTGGGG + Intronic
1091284650 11:134401947-134401969 TGACAAAAGGGTGTGGCCTGGGG + Intronic
1094520285 12:31180075-31180097 TGTCACGTGTCTGTGGCCTGTGG - Intergenic
1101307895 12:103548082-103548104 TGACACTGGGCTCTGGCCTGGGG + Intergenic
1104436043 12:128757338-128757360 TGAGAGGGGGCTGTGGCCTGTGG - Intergenic
1108849538 13:54710548-54710570 TGACACTGGTCTGTAGCCTGGGG + Intergenic
1112635960 13:101218491-101218513 TGACACGGGGATATGGCCATGGG - Intronic
1113196474 13:107813697-107813719 TGACATCGGGATGGGGCTTGTGG + Intronic
1113678293 13:112223239-112223261 TGGCACGGGGAAGTGGCATGGGG - Intergenic
1115308947 14:31960218-31960240 TGACTCTGGGATGTGGTATGTGG - Intergenic
1117247751 14:53902552-53902574 TGACCCTGGGGTGTGTCCTGAGG - Intergenic
1122268650 14:100558448-100558470 TGTCCCGGGGATCTGGCCTCCGG + Intronic
1122811386 14:104291104-104291126 AGACAGGGGCAGGTGGCCTGGGG + Intergenic
1131228885 15:90646361-90646383 GGACACAGGGCTGTGGCATGAGG - Intergenic
1131962428 15:97803855-97803877 TGGCTTGGGAATGTGGCCTGAGG - Intergenic
1132401112 15:101506195-101506217 TGACACGTGTAAGTGACCTGTGG + Intronic
1135608939 16:23848009-23848031 TGACAAGGGGATGAGGGCAGGGG + Intronic
1138350169 16:56342146-56342168 TGACCCGGGCTTGTGGCCTGTGG + Intronic
1138565071 16:57827285-57827307 AGACACTGAGATGTGGCCTGTGG - Intronic
1140308118 16:73822715-73822737 TGACACAATGATGTGGCATGAGG + Intergenic
1140409312 16:74732307-74732329 TAGCACAGGGATGTGGCCAGGGG + Intronic
1140774698 16:78239212-78239234 TGACACTGTAATGTGGACTGTGG + Intronic
1142219523 16:88846904-88846926 TGAGATGGGGGTGTGGCCAGGGG + Intronic
1142222715 16:88863548-88863570 TGACTCGTGGCTGTGGCCTTGGG + Exonic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142641362 17:1287883-1287905 TGAAACGGGGAGGTCACCTGAGG - Intronic
1143273845 17:5695485-5695507 TGACTGGGGGAGTTGGCCTGTGG + Intergenic
1144068215 17:11642752-11642774 AGACCCGGGGTTGGGGCCTGTGG + Intronic
1146309018 17:31752794-31752816 TGACACAGGGATTTGCTCTGTGG - Intergenic
1157727221 18:49974179-49974201 TGACACAATGATGGGGCCTGAGG - Intronic
1160443715 18:78911946-78911968 TGGCCTGGGGCTGTGGCCTGAGG - Intergenic
1160873730 19:1287928-1287950 TGCCACAGGGCTGTGGGCTGCGG + Intronic
1161076073 19:2286383-2286405 TGACACTGGGCTGTGGCGAGTGG + Intronic
1164904897 19:31959380-31959402 TAACACGTGGAGGTGGCCGGGGG - Intergenic
1165231934 19:34392851-34392873 TGGCACAGGTATGAGGCCTGGGG + Intronic
1165564839 19:36715759-36715781 TGACACGGGCAGATTGCCTGAGG - Intronic
925708619 2:6715561-6715583 TGATGTGGGGATGTGGCTTGAGG + Intergenic
926315341 2:11705544-11705566 GGACACTTGGCTGTGGCCTGGGG + Intronic
926429967 2:12775691-12775713 TGACAATGGGAGCTGGCCTGGGG + Intergenic
927196521 2:20551450-20551472 TGCCATGGGGCTGTGGCCAGCGG - Intergenic
927853933 2:26516357-26516379 AGACACGGGGAAGAGACCTGGGG - Intronic
933277076 2:80295255-80295277 AGACACAGGGATGTGGTGTGAGG - Intronic
935579482 2:104744317-104744339 TGACACGGGGCTGAGTCCTGGGG - Intergenic
935857644 2:107292482-107292504 TGAGAAGGGGGTGTGGCCTTGGG + Intergenic
939301621 2:140349148-140349170 TGATACCGGTCTGTGGCCTGGGG + Intronic
1169189326 20:3647899-3647921 TGACACGGGGGTGGGGGCAGGGG - Exonic
1172657553 20:36546336-36546358 TGTCACGGGGCTGTGTCCTCTGG - Intronic
1173295146 20:41749192-41749214 TGCCACGGGGACCAGGCCTGGGG + Intergenic
1174161182 20:48551590-48551612 TGAGTCTGAGATGTGGCCTGGGG - Intergenic
1174524763 20:51162085-51162107 TGACACGTGGCTGTTTCCTGAGG + Intergenic
1175337535 20:58206006-58206028 AGACGCGGGGATGTGGGGTGCGG - Intergenic
1177880066 21:26682924-26682946 TGACAAATGGATGTGGCATGTGG - Intergenic
1180066382 21:45414613-45414635 TGCTCCGGGCATGTGGCCTGAGG + Intronic
1180220035 21:46352723-46352745 TGACACCTGGATGTGGGCTATGG - Intronic
1181046163 22:20215314-20215336 CTACACGGGGCTGGGGCCTGAGG + Intergenic
1181732217 22:24855508-24855530 AGACAGAGGGATGAGGCCTGGGG - Intronic
1181937661 22:26450245-26450267 ACACACAGGGAAGTGGCCTGTGG + Intronic
1183619136 22:38962422-38962444 GGGCACAGGGAGGTGGCCTGGGG - Intronic
1183624336 22:38992358-38992380 GGGCACAGGGAGGTGGCCTGGGG - Intronic
1184433197 22:44453720-44453742 TGACACCTGGATGAGGCCCGAGG - Intergenic
1184687453 22:46103071-46103093 TGACACGGTGATGGGGACAGTGG + Intronic
952809350 3:37387422-37387444 TGAAACGGGGCTTTTGCCTGTGG + Intronic
954413809 3:50383186-50383208 TGGCTCGGGCAGGTGGCCTGCGG + Intronic
955059539 3:55483635-55483657 TGCCACGGGGAGGAGGACTGGGG + Intronic
955905580 3:63804206-63804228 TGATACTGGTTTGTGGCCTGGGG + Intergenic
963328341 3:143886870-143886892 TGACAGGGAGATGTCACCTGTGG - Intergenic
968442828 4:633222-633244 TGAAACAGGGATGGGCCCTGAGG - Intronic
968506156 4:972376-972398 TCACACGGGGATGTCGTCTGTGG - Intronic
968600869 4:1508680-1508702 TGGCACGGGTATCTGGCCAGTGG + Intergenic
969274735 4:6127666-6127688 TGAAGGGGGGATGTGGCCTGTGG - Intronic
970952024 4:21767383-21767405 TGACTCAGGGATGTGGGGTGGGG + Intronic
974916348 4:68182831-68182853 TGACAGAGGGATGTGGCCGGTGG - Intergenic
975783438 4:77863157-77863179 TGATACTGGGGTGTGGGCTGCGG + Intronic
982811565 4:159831989-159832011 CAACACAGAGATGTGGCCTGTGG + Intergenic
984709616 4:182874179-182874201 TGACACAGTGATGTGGCCATGGG + Intergenic
984933812 4:184872166-184872188 TGAAAAGGGGAGGTGGCCTCTGG - Intergenic
985720144 5:1484675-1484697 TGACACGGGCCTCTGGCCTCAGG - Intronic
986384316 5:7216776-7216798 TAACACGGGTCTGTGGACTGGGG - Intergenic
986782840 5:11083165-11083187 GGACAAGCGGATGTGGCCAGTGG + Intronic
988774627 5:34466824-34466846 GGGCACTGGGATGTGGACTGGGG + Intergenic
993374893 5:87139304-87139326 TGACAGGTAGATTTGGCCTGTGG - Intergenic
995248656 5:109964209-109964231 TGTCACAAGGAGGTGGCCTGAGG - Intergenic
1001594385 5:172888491-172888513 TGACAAGGGGATGTGATCTAAGG + Intronic
1001702798 5:173719814-173719836 TGGCAGGGGGGTGAGGCCTGAGG - Intergenic
1002428739 5:179191131-179191153 GGACACTGGGCTCTGGCCTGAGG - Intronic
1006373022 6:33657003-33657025 TGAGCTGGGGATCTGGCCTGGGG + Intronic
1019342099 7:513146-513168 TGACAGAGGGAGGCGGCCTGCGG + Intronic
1019379593 7:713894-713916 TGAGACGGGGCTGGGGCCAGTGG - Intronic
1019482108 7:1271747-1271769 GGACATGGGGATGTGGCTGGAGG + Intergenic
1020904906 7:14052803-14052825 GGACACTGGGATGGAGCCTGGGG - Intergenic
1021062092 7:16125803-16125825 TGACAAAGGCATGTGTCCTGAGG - Intronic
1026551629 7:71373757-71373779 TGAACCGGGGGTGTGGCGTGGGG - Intronic
1026586453 7:71659926-71659948 TAACACGAGGATGTGGCCAGTGG - Intronic
1026689250 7:72537958-72537980 TGACACGGGCAGATCGCCTGAGG - Intergenic
1029954160 7:104620088-104620110 TGATACGGGTCTGTGACCTGGGG + Intronic
1031485819 7:122322459-122322481 TGACACTTGGATGTTCCCTGTGG + Intronic
1032500632 7:132397022-132397044 TGGCACAGGGATGGGGGCTGGGG + Intronic
1032517761 7:132519517-132519539 TGTCTCGTGCATGTGGCCTGAGG + Intronic
1033789647 7:144776027-144776049 TGTCGCAGGGATGGGGCCTGTGG - Intronic
1035072747 7:156157132-156157154 TGGCACCGAGATGTGGCCAGGGG - Intergenic
1036488003 8:9197076-9197098 TGACACGGGTATATCACCTGAGG + Intergenic
1036816234 8:11905006-11905028 GGACAAGGGGATGTGGCCCCTGG + Intergenic
1037157073 8:15715327-15715349 TGTTACGTGGATGTGGTCTGTGG + Intronic
1037686409 8:21143282-21143304 TGACACGTGCATGTGTTCTGGGG - Intergenic
1038271654 8:26080683-26080705 TGCCACGCTGGTGTGGCCTGAGG - Intergenic
1038627552 8:29208847-29208869 TGAGACGAGGCTGTGGCCTGGGG - Intronic
1040678293 8:49778658-49778680 TAACACGGGGATGTTTGCTGAGG + Intergenic
1046414854 8:113899429-113899451 AGACACAGAGATGTTGCCTGAGG + Intergenic
1048698007 8:137050178-137050200 TGAGATGGGGATGTGGACTTGGG - Intergenic
1053114814 9:35490857-35490879 GGACACGGGGAACTGTCCTGGGG + Intronic
1054996377 9:71395496-71395518 TGACACGTGGAGCTGCCCTGTGG + Intronic
1059739668 9:117137336-117137358 TGGCCCGGGGATGAGGCCTAAGG + Intronic
1060656604 9:125376498-125376520 TGACACTGGGAAGTGGCCCTGGG - Intergenic
1062110425 9:134779182-134779204 TCCCACGGGCAGGTGGCCTGAGG + Intronic
1062180569 9:135189125-135189147 TGACACGGGGGTGTGGGGTGTGG - Intergenic
1185465548 X:352393-352415 AGCCACGGGGAGGAGGCCTGGGG - Intronic
1198680686 X:139178527-139178549 TGACATGGTGATGTGGAGTGTGG - Intronic