ID: 1077056537

View in Genome Browser
Species Human (GRCh38)
Location 11:596742-596764
Sequence CTGCTGTCACATTGGGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1095
Summary {0: 1, 1: 0, 2: 28, 3: 189, 4: 877}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077056531_1077056537 -2 Left 1077056531 11:596721-596743 CCTTAAAGGTTCCATGTCTATCT 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG 0: 1
1: 0
2: 28
3: 189
4: 877
1077056530_1077056537 5 Left 1077056530 11:596714-596736 CCTATAACCTTAAAGGTTCCATG 0: 1
1: 0
2: 1
3: 7
4: 85
Right 1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG 0: 1
1: 0
2: 28
3: 189
4: 877
1077056526_1077056537 26 Left 1077056526 11:596693-596715 CCCTCATCTAAGGACACCAATCC 0: 1
1: 0
2: 5
3: 53
4: 344
Right 1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG 0: 1
1: 0
2: 28
3: 189
4: 877
1077056527_1077056537 25 Left 1077056527 11:596694-596716 CCTCATCTAAGGACACCAATCCT 0: 1
1: 0
2: 4
3: 66
4: 306
Right 1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG 0: 1
1: 0
2: 28
3: 189
4: 877
1077056529_1077056537 10 Left 1077056529 11:596709-596731 CCAATCCTATAACCTTAAAGGTT 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG 0: 1
1: 0
2: 28
3: 189
4: 877
1077056525_1077056537 30 Left 1077056525 11:596689-596711 CCTTCCCTCATCTAAGGACACCA 0: 1
1: 1
2: 2
3: 23
4: 262
Right 1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG 0: 1
1: 0
2: 28
3: 189
4: 877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077056537 Original CRISPR CTGCTGTCACATTGGGGGTT AGG Intronic
900330649 1:2132938-2132960 ATACAGCCACATTGGGGGTTAGG + Intronic
900674910 1:3879420-3879442 ATGCAGTCACACTGGGGATTAGG - Intronic
900822383 1:4899545-4899567 ATACAGTCACATTTGGGGTTTGG + Intergenic
901233769 1:7656496-7656518 ATACAGTCACATTGGTGGTTAGG + Intronic
901856659 1:12048788-12048810 GCCCTGTCTCATTGGGGGTTAGG - Intergenic
902079271 1:13810089-13810111 ATACAATCACATTGGGGGTTAGG + Intronic
902087467 1:13874458-13874480 ACACAGTCACATTGGGGGTTAGG + Intergenic
902234638 1:15049482-15049504 CTGCTGTGACACTGGGGGGCTGG - Intronic
902355993 1:15900879-15900901 TTGTTGTCACAGTGGGGGTGGGG - Intronic
902637893 1:17747013-17747035 ATGTAGTCACATTGGGGATTAGG + Intergenic
902701096 1:18172698-18172720 ATGCAGTCACATTGGGGGTTAGG + Intronic
902703301 1:18187737-18187759 ATACTGTCACATTAGGGATTAGG + Intronic
903041031 1:20530799-20530821 CTGCTTTCACAGTGGGAGTTGGG + Intergenic
903971333 1:27120854-27120876 CATCTGTCAAATTGGGGGTCAGG - Intronic
903985283 1:27223006-27223028 ATACTATCACTTTGGGGGTTAGG + Intergenic
904352304 1:29916477-29916499 ATACAGTCACACTGGGGGTTAGG + Intergenic
904820296 1:33238650-33238672 ATCCAGTCACATTGGGGGTTAGG - Intergenic
904885182 1:33732352-33732374 ATGCAGTCACATTGGTGGCTAGG - Intronic
904954302 1:34270110-34270132 ATACTGTCACATTGGGGGTTAGG + Intergenic
905336877 1:37250793-37250815 GTACTGTCACATTGGGGGTTAGG - Intergenic
905828517 1:41045847-41045869 CTGCTTTCCCATTGTGGGTCTGG + Intronic
905841759 1:41186616-41186638 ATGTAGTCACATTGGGGGTTAGG - Intronic
906222080 1:44088671-44088693 ATGCAGTCACATTGGGGGTTAGG + Intergenic
906677669 1:47704946-47704968 ATACCATCACATTGGGGGTTAGG + Intergenic
906717046 1:47978079-47978101 ATACCGTCACATTGGGGATTAGG - Intronic
906819893 1:48918487-48918509 ATGCCATCACATTGGAGGTTAGG - Intronic
906988136 1:50708908-50708930 CTGCAGTCACATTGAGCTTTTGG - Intronic
907547331 1:55273514-55273536 TTGCTGGCACACTGGGGGTAGGG + Intergenic
907632890 1:56101723-56101745 ATTCTGAGACATTGGGGGTTAGG + Intergenic
907646696 1:56251725-56251747 ATACCATCACATTGGGGGTTAGG - Intergenic
907728943 1:57047359-57047381 ATACTTTCACACTGGGGGTTAGG - Intronic
907791787 1:57673281-57673303 CTACCATCACATTGGGGATTAGG + Intronic
908158957 1:61387070-61387092 TTACCATCACATTGGGGGTTAGG + Intronic
908255778 1:62302528-62302550 ATACCATCACATTGGGGGTTAGG - Intronic
908283932 1:62572753-62572775 ATGCCATCACATTGAGGGTTAGG + Intronic
908289325 1:62646422-62646444 TTACAGTCACATTGGGGGTTAGG - Intronic
908345296 1:63226372-63226394 ATACTATCACATTGGGAGTTAGG - Intergenic
908366551 1:63429748-63429770 TAACAGTCACATTGGGGGTTAGG + Intronic
908484099 1:64573134-64573156 ATACCATCACATTGGGGGTTAGG - Intronic
908799415 1:67864159-67864181 CTCCTGTGAGAATGGGGGTTGGG + Intergenic
908814532 1:68018215-68018237 ATGCCATCACATTGGGGATTCGG - Intergenic
908846376 1:68328760-68328782 ATACTATCACCTTGGGGGTTAGG - Intergenic
908873126 1:68637492-68637514 ATACCATCACATTGGGGGTTAGG + Intergenic
909351138 1:74654688-74654710 ATACTATCACATTGGGGATTAGG + Intronic
909465570 1:75970230-75970252 ATACAGTCACATTGAGGGTTAGG + Intergenic
909845805 1:80393482-80393504 ATATAGTCACATTGGGGGTTGGG - Intergenic
909870054 1:80728069-80728091 ATACAGTCACATTAGGGGTTAGG + Intergenic
910010088 1:82451080-82451102 ATACAATCACATTGGGGGTTAGG + Intergenic
910988222 1:93027237-93027259 ATGCTGTCCTACTGGGGGTTAGG + Intergenic
911355186 1:96808533-96808555 GTACAGTTACATTGGGGGTTAGG + Intronic
911393022 1:97269813-97269835 ATACAGTCACATTGGAGGTTAGG + Intronic
911461950 1:98202550-98202572 ATGCCATCACATTGGAGGTTAGG - Intergenic
911979286 1:104545832-104545854 ATACAGTCACATTGGGGGTTAGG - Intergenic
912204279 1:107493253-107493275 ATCCAGTCCCATTGGGGGTTAGG - Intergenic
913082287 1:115399791-115399813 ATACTATCACCTTGGGGGTTAGG - Intergenic
913168204 1:116208858-116208880 ATACTGTCACATTGGGGGTCAGG + Intergenic
913339055 1:117738974-117738996 ATACAGTCACATTGGGGATTAGG + Intergenic
914949233 1:152097345-152097367 ATACTTTCACACTGGGGGTTAGG + Intergenic
915674499 1:157517833-157517855 ATGCCATCACATTGGGGATTAGG - Intronic
916194601 1:162211486-162211508 ATGCAGTCACATTGGGGTTTAGG + Intronic
916456957 1:164980851-164980873 ATACTATCACATTGGGAGTTAGG + Intergenic
917468415 1:175305263-175305285 GTACAGTCACATTGGGAGTTAGG - Intergenic
917908453 1:179613766-179613788 ATACTATCACCTTGGGGGTTAGG + Intronic
918025511 1:180741006-180741028 ATACCATCACATTGGGGGTTAGG + Intronic
918586491 1:186194276-186194298 ATGCAGTCACATTGAGGGTTAGG - Intergenic
918608185 1:186455342-186455364 ATACTGTCATATTGGGGGTTAGG + Intronic
918636361 1:186779454-186779476 ATACCATCACATTGGGGGTTAGG + Intergenic
918800583 1:188965200-188965222 ATACTGTCAGATTGGGGGTTGGG + Intergenic
919141321 1:193575166-193575188 ATACTATCACATTGGGTGTTAGG + Intergenic
919412744 1:197266445-197266467 ATACTATCACATTGGGGATTAGG + Intergenic
919560521 1:199113329-199113351 ATACCATCACATTGGGGGTTAGG + Intergenic
919598268 1:199591398-199591420 ATACTATCACATTGGGGGTCAGG - Intergenic
920040803 1:203094760-203094782 ATACTATTACATTGGGGGTTAGG + Intronic
920396157 1:205647619-205647641 ATGCCATCACACTGGGGGTTAGG + Intergenic
920779329 1:208973283-208973305 ATACTATCACATTGGGGTTTAGG - Intergenic
921130759 1:212217588-212217610 CTATTGTCACATTAGGGGGTAGG + Intergenic
921249708 1:213285333-213285355 ATGCTGTCATACTGGGGGGTAGG + Intergenic
921306302 1:213800113-213800135 ATACCGTCACATAGGGGGTTAGG + Intergenic
921441904 1:215197592-215197614 ATGCAGTCACACTGGGGCTTAGG + Intronic
921483331 1:215688803-215688825 ATACAGTCACCTTGGGGGTTAGG + Intronic
922864686 1:228849465-228849487 CTGCTCTCACACTGGAGCTTGGG + Intergenic
922995182 1:229951737-229951759 ATACTATCACATTGGGAGTTAGG + Intergenic
923125650 1:231032431-231032453 ATCCTGTCACAGTGAGGGTTTGG - Intronic
923968247 1:239168386-239168408 ATACAGTCACATTGAGGGTTGGG + Intergenic
924551354 1:245080931-245080953 CTGCTGACACATTGGCGGCTAGG - Intronic
924562766 1:245170777-245170799 CTACCATCACTTTGGGGGTTAGG + Intronic
1062878865 10:962401-962423 ATGCAGTCACATGGGGGGTTAGG + Intergenic
1063190451 10:3689197-3689219 CTCCAGTTACATTGGGGTTTAGG + Intergenic
1063208510 10:3857360-3857382 ATACAGTCACATTTGGGGTTAGG - Intergenic
1063347957 10:5328643-5328665 ATACGGTCACATTGGAGGTTAGG - Intergenic
1063462425 10:6223083-6223105 CTGCTGTGCCATGGGGTGTTAGG + Intronic
1063487927 10:6437205-6437227 CTACAGTTACATTGTGGGTTAGG - Intronic
1063553507 10:7056019-7056041 ATACTGTCATATTGGAGGTTAGG - Intergenic
1063788210 10:9409166-9409188 ATACTGTCACACTGGGGGCTAGG - Intergenic
1064172907 10:13049996-13050018 TTTATGTCACATTGTGGGTTTGG - Intronic
1064187342 10:13173856-13173878 CTGCTCTCACACTGGGGGCCAGG - Intronic
1064270536 10:13861222-13861244 CTGCAAATACATTGGGGGTTAGG - Intronic
1064347863 10:14548889-14548911 ATACTGTCACTTTGGGGGTTAGG - Intronic
1064354763 10:14606541-14606563 ATACAGTCACATTGGAGGTTAGG - Intronic
1064854058 10:19745506-19745528 ATGCTATCACATTGGGGGTTAGG - Intronic
1064959991 10:20953148-20953170 ATACAGTCACATTGGTGGTTAGG - Intronic
1065052477 10:21810093-21810115 ATACAGTCACATTGGGAGTTAGG + Intronic
1066117084 10:32249994-32250016 ATACAGTCACACTGGGGGTTGGG + Intergenic
1067043055 10:42968074-42968096 GTGGTGTCACATTGTGGTTTTGG + Intergenic
1067803101 10:49373476-49373498 ATGCTGTCACCTTGGGGTTTAGG - Intronic
1067841340 10:49681861-49681883 CTGTAGTCACATTGGGAGTTAGG + Intronic
1067963934 10:50887856-50887878 ATACCATCACATTGGGGGTTAGG + Intergenic
1068036561 10:51766752-51766774 ATACTATCACATTGAGGGTTGGG + Intronic
1068061690 10:52075940-52075962 ATACTGTCACATTGGGGGTTAGG + Intronic
1068417426 10:56742166-56742188 ATACTGTCACATTGTTGGTTGGG + Intergenic
1068780842 10:60917689-60917711 ATACAATCACATTGGGGGTTAGG + Intronic
1068825778 10:61437258-61437280 ATATTGTCACATTTGGGGTTAGG + Intronic
1070084274 10:73220604-73220626 ATACAGTCACTTTGGGGGTTAGG - Intronic
1070394729 10:76002313-76002335 CTACTGTCACATTGAGGGCTAGG + Intronic
1070635620 10:78124887-78124909 CTACCATCACATTGGGGATTAGG + Intergenic
1070667512 10:78355861-78355883 GTGCTATCACACTGGGGGTTAGG - Intergenic
1070932034 10:80267839-80267861 CTGATATCACATTGGAGGTTAGG - Intergenic
1071185001 10:83032670-83032692 AAACAGTCACATTGGGGGTTAGG + Intergenic
1071260096 10:83911966-83911988 ATACAGTCACATTGGGGGTTAGG + Intergenic
1071300344 10:84251796-84251818 ATGCCATCACATTGGGGATTAGG + Intronic
1071457684 10:85863384-85863406 ATACTGTCACCTTGGGGATTAGG + Intronic
1071548760 10:86549634-86549656 ATACTATCATATTGGGGGTTTGG - Intergenic
1071642963 10:87333318-87333340 ATACTGTCACATTGTGGGGTAGG - Intergenic
1071725846 10:88197653-88197675 ATATAGTCACATTGGGGGTTAGG - Intergenic
1072121504 10:92409106-92409128 ATACAGTCACATTAGGGGTTAGG + Intergenic
1072192905 10:93090596-93090618 ATACAGTCACATTGGGGATTAGG + Intergenic
1072215787 10:93286139-93286161 ATACTGTCACACTGGGGGTTAGG - Intergenic
1072760312 10:98051238-98051260 CTCCAGTCACATTGGGGGTTAGG + Intergenic
1073703774 10:105959460-105959482 GTACAGTCACATTGGGGGTTGGG - Intergenic
1074079730 10:110157914-110157936 ATACTATCACATTGGGGATTAGG + Intergenic
1074321382 10:112406429-112406451 ATACTGTCACATTGGGGATTAGG + Intronic
1074671906 10:115800664-115800686 ATACCATCACATTGGGGGTTAGG - Intronic
1074672178 10:115804344-115804366 ATGCCATCACATTGAGGGTTAGG - Intronic
1074955848 10:118388493-118388515 ATGCCATCACATTGGGTGTTAGG - Intergenic
1074983290 10:118636537-118636559 ATGCCATCACCTTGGGGGTTAGG + Intergenic
1075077125 10:119359022-119359044 ATATAGTCACATTGGGGGTTAGG + Intronic
1075161812 10:120031013-120031035 ATACTATCACATTGGGGATTAGG - Intergenic
1075389249 10:122080633-122080655 ATACAGTCACATTGGGGATTAGG + Intronic
1075397656 10:122139589-122139611 GTGCTGTGAAATTGTGGGTTTGG - Intronic
1075702767 10:124479768-124479790 ATGCAGTCACATTGGGGGTTAGG + Intronic
1075807028 10:125196577-125196599 CTGATGTCCCAGTGGGGGTCTGG - Intergenic
1075832989 10:125427293-125427315 ATACAGTCACATTGGGGGTGGGG + Intergenic
1076557347 10:131335905-131335927 ATACCGTCGCATTGGGGGTTAGG - Intergenic
1076749588 10:132536105-132536127 ATACAGTCACATTGGAGGTTAGG + Intergenic
1076777861 10:132708017-132708039 CTGCTCTCACATGGGGGCATGGG + Intronic
1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG + Intronic
1078016128 11:7616694-7616716 GTGCTGACACGTTGGGTGTTTGG + Intronic
1078587971 11:12610479-12610501 CTGCGGCCACTTTGGGGGATGGG - Intergenic
1078814786 11:14809607-14809629 ATACTGTCTCATTGGGGATTAGG - Intronic
1078837500 11:15045117-15045139 ATGCTACCACATTGAGGGTTAGG + Intronic
1078867699 11:15313165-15313187 ATACTATCACCTTGGGGGTTGGG - Intergenic
1079142909 11:17824835-17824857 ATACAGTCACATTGGGGGTTAGG + Intronic
1080232708 11:30035613-30035635 ATGCTTTCACACTGGGGGTTAGG - Intergenic
1080512242 11:32986427-32986449 ATACTATCACATTGGGGGTTAGG + Intronic
1081036778 11:38158114-38158136 ATACAGTTACATTGGGGGTTAGG - Intergenic
1081426454 11:42931375-42931397 ATGCAGTCACATTAGAGGTTAGG - Intergenic
1081565194 11:44256425-44256447 ATGCAGTTACATTGGGGGTTAGG - Intergenic
1081658301 11:44872329-44872351 ATGAAGTCACGTTGGGGGTTAGG + Intronic
1082006841 11:47424063-47424085 ATACAGTGACATTGGGGGTTTGG - Exonic
1082757981 11:57096834-57096856 ATTCAGTCACATTGGGAGTTAGG + Intergenic
1082923598 11:58522188-58522210 ATACAGCCACATTGGGGGTTAGG - Intergenic
1082990251 11:59201267-59201289 ATACTGTCACCTTGGGGGTGAGG + Intronic
1083304388 11:61755013-61755035 GTGCTGTCACACTCGGGGCTGGG + Intronic
1083504140 11:63139565-63139587 CTCATTTCTCATTGGGGGTTGGG - Intronic
1083916526 11:65748173-65748195 ATATAGTCACATTGGGGGTTAGG + Intergenic
1084075164 11:66769609-66769631 ATACTATCACACTGGGGGTTGGG - Intronic
1084744530 11:71160335-71160357 ATACCATCACATTGGGGGTTAGG - Intronic
1084918865 11:72452734-72452756 ATACAGTCACATTGGGGGTTAGG + Intergenic
1085598119 11:77829058-77829080 ATACAGTCACATTAGGGGTTAGG - Intronic
1085712684 11:78844239-78844261 ATACAGTCACATTGGGGGTTAGG - Intronic
1085808522 11:79658836-79658858 ATGCTGTCACATTGGGGTTTAGG + Intergenic
1085839174 11:79990993-79991015 ATATTGTCACATTGGAGGTTAGG - Intergenic
1086561241 11:88172264-88172286 CTGCTGTCCCCTATGGGGTTTGG + Intronic
1086996999 11:93369261-93369283 ATGCTGTCACTTTGGGGTTTAGG + Intronic
1087021118 11:93604314-93604336 ATACTATCACATTGGGGATTAGG + Intergenic
1087024278 11:93634441-93634463 ATACTATCACATTGGGGGTTAGG + Intergenic
1087186519 11:95204511-95204533 ATACCATCACATTGGGGGTTAGG - Intronic
1087347862 11:96993760-96993782 ATACAGTCACATTGGAGGTTAGG + Intergenic
1087702185 11:101447825-101447847 ATGCCCTCACATTGGCGGTTAGG - Intergenic
1088350382 11:108880355-108880377 ATACAGCCACATTGGGGGTTAGG + Intronic
1088353112 11:108911840-108911862 ATACTATCACTTTGGGGGTTAGG + Intronic
1088442258 11:109884547-109884569 ATACAGTCACATTGCGGGTTAGG - Intergenic
1088456666 11:110039923-110039945 ATACAGTCACATTGGTGGTTAGG + Intergenic
1088850191 11:113697922-113697944 ATACAGTCACATTGAGGGTTGGG - Intronic
1089393960 11:118122815-118122837 CTACCATCACCTTGGGGGTTAGG - Intergenic
1089645980 11:119879327-119879349 ATACTATCACCTTGGGGGTTAGG + Intergenic
1089900643 11:121979948-121979970 TTACAGTCACATTAGGGGTTAGG + Intergenic
1089918426 11:122182871-122182893 ATACCGTCACATTGGGGGTTAGG - Intergenic
1090032822 11:123222097-123222119 ATACCATCACATTGGGGGTTAGG - Intergenic
1090047391 11:123347992-123348014 ATACTGTTACATTGGGGATTAGG - Intergenic
1090237707 11:125161576-125161598 ATACGGTCACATTGGGGGTTAGG - Intergenic
1090474533 11:127007526-127007548 ATACAGTCACATTGGAGGTTAGG + Intergenic
1090886421 11:130880911-130880933 CTGCCATCACCTTGAGGGTTAGG - Intronic
1090939152 11:131372346-131372368 CTGCTGTCCCCTAGGGGCTTTGG + Intronic
1091275800 11:134348982-134349004 ATACCGTCACAGTGGGGGTTAGG + Intronic
1091496674 12:979092-979114 ATACAGGCACATTGGGGGTTAGG - Intronic
1092908319 12:13122621-13122643 CTGCCATCATATTGGGGGTTAGG + Intronic
1093130385 12:15384645-15384667 ATGCCGTTACATTGGGGGTTAGG + Intronic
1093656590 12:21701874-21701896 ATATTATCACATTGGGGGTTAGG - Intronic
1093805922 12:23432953-23432975 ACCCTGTCATATTGGGGGTTAGG - Intergenic
1093967718 12:25345095-25345117 ATACTATCACTTTGGGGGTTAGG - Intergenic
1094257215 12:28445883-28445905 CTGCTATCACATTGGGGATTAGG + Intronic
1094781303 12:33795195-33795217 CTGCTGGCACATTTGGGGGTGGG - Intergenic
1095627350 12:44331833-44331855 CTGCTGTGAAATTGGGTGCTTGG - Intronic
1095712708 12:45307603-45307625 CAACTCTCACATCGGGGGTTGGG - Intronic
1095779760 12:46046799-46046821 ATACTGTCACATTAGGAGTTAGG - Intergenic
1096266065 12:50123572-50123594 ATGCTGTCCCACTGGGGGTTAGG + Intergenic
1097472374 12:60010581-60010603 ATACTGTCACATGGGGGATTAGG - Intergenic
1097480074 12:60112966-60112988 CTGCTGTCACATGGGTCTTTTGG + Intergenic
1097907519 12:64935679-64935701 ATGCAGTCACACTGGGTGTTAGG + Intergenic
1098163721 12:67672373-67672395 ATACAGACACATTGGGGGTTAGG - Intergenic
1098624153 12:72641901-72641923 ATACTATCATATTGGGGGTTAGG - Intronic
1098718225 12:73860143-73860165 ATACTATCACATTGGGGGTTAGG - Intergenic
1098750290 12:74284567-74284589 ATACTGTTACATTGTGGGTTAGG - Intergenic
1099207359 12:79743873-79743895 CTACTATCACATTGGGGGGTGGG - Intergenic
1099425371 12:82517479-82517501 ATACTGTCTCATTAGGGGTTAGG - Intergenic
1099504828 12:83460694-83460716 ATACTGTCACCTTAGGGGTTAGG + Intergenic
1099632923 12:85173786-85173808 ATACCATCACATTGGGGGTTAGG + Intronic
1099783548 12:87231636-87231658 ATACAGTCACATTGGGAGTTAGG + Intergenic
1099787841 12:87289068-87289090 ATACAGTCACATTAGGGGTTAGG - Intergenic
1099977833 12:89564759-89564781 ATACAGTCACATTGGGGGTTAGG + Intergenic
1100206029 12:92350833-92350855 ATACCATCACATTGGGGGTTAGG - Intergenic
1100223760 12:92535373-92535395 ATACTATCACCTTGGGGGTTAGG + Intergenic
1100593593 12:96052498-96052520 ATACCCTCACATTGGGGGTTAGG - Intergenic
1100599388 12:96099833-96099855 ATGCCATTACATTGGGGGTTAGG + Intergenic
1100606293 12:96154602-96154624 ATGCCATCACATTAGGGGTTAGG - Intergenic
1101468235 12:104970134-104970156 ATACTATCACCTTGGGGGTTAGG - Intergenic
1101553306 12:105783723-105783745 ATACCATCACATTGGGGGTTTGG + Intergenic
1101579025 12:106025166-106025188 ATACAGTCACATTGGGGATTGGG - Intergenic
1101861362 12:108485065-108485087 ATGTAGTCACATTGGGCGTTAGG - Intergenic
1102638465 12:114345256-114345278 CTACAGTCATATTGAGGGTTGGG - Intergenic
1102710066 12:114918081-114918103 CTTCAGTGGCATTGGGGGTTGGG - Intergenic
1102712654 12:114941676-114941698 CTGCTGTGGCATTGCAGGTTGGG + Intergenic
1103156732 12:118691773-118691795 ATACAGTCACAGTGGGGGTTAGG + Intergenic
1103300985 12:119926575-119926597 ATACTATCACATTGGGGATTAGG - Intergenic
1103929991 12:124445043-124445065 CTGCTGCCTCATTTGGGGGTCGG - Intronic
1104404297 12:128504767-128504789 GTGCAGTCACATTGAGGGTTAGG + Intronic
1104469821 12:129020546-129020568 ATGCATTCACATTGGGAGTTAGG + Intergenic
1104510602 12:129374396-129374418 ATACAGTCACATTGAGGGTTAGG + Intronic
1104574394 12:129953594-129953616 ATATTGTCACATTGGAGGTTAGG - Intergenic
1105031113 12:132884538-132884560 ATACAGTCACATTGGGGATTAGG - Intronic
1105395423 13:20029358-20029380 ATACTGTCACCTTGGGGTTTAGG + Intronic
1105641258 13:22267481-22267503 ATGCTGTCACATTGGGCATCAGG + Intergenic
1105932500 13:25065966-25065988 ATACTGTCACATTGGGGGTTAGG + Intergenic
1105977110 13:25481937-25481959 ATCCCATCACATTGGGGGTTAGG + Intronic
1106025060 13:25948581-25948603 CAGCCATCACATTGGAGGTTAGG - Intronic
1106051963 13:26199852-26199874 ATACTATCACATTGTGGGTTAGG - Intronic
1106591665 13:31103809-31103831 ATCCTATCACATTGGAGGTTAGG + Intergenic
1106593145 13:31114977-31114999 ATACTGTCACACTGGGGATTAGG + Intergenic
1107360586 13:39613377-39613399 ATACCGTCACATTGGGAGTTAGG + Intergenic
1107571994 13:41671577-41671599 ATACTATCATATTGGGGGTTAGG - Intronic
1108014597 13:46061413-46061435 ATACAGTCACATTGGGGCTTAGG - Intronic
1108223555 13:48263855-48263877 ATACTGTCACCTTGGGGGTAAGG + Exonic
1108294251 13:48997467-48997489 ATACTGTCACATTGGTGGTTAGG - Intronic
1108893432 13:55293243-55293265 CTGCTGTCACAATCAGGGATTGG + Intergenic
1109535987 13:63720308-63720330 ATTCTGTCACACTGAGGGTTAGG + Intergenic
1109540113 13:63765978-63766000 ATTCTGTCACACTGAGGGTTAGG - Intergenic
1109643555 13:65223060-65223082 ATACTATCACATTGGGGATTAGG - Intergenic
1110455598 13:75687015-75687037 ATACTGTCACATTGAGGGTTAGG + Intronic
1110800030 13:79683992-79684014 GTACTATCACAATGGGGGTTAGG - Intergenic
1111311479 13:86493015-86493037 ATGCTATCACTTTAGGGGTTAGG - Intergenic
1112130138 13:96514456-96514478 ATACTGTCACATTGGAGGTTAGG - Intronic
1112248216 13:97753911-97753933 ATGCAGTCACATTGTGGGTTAGG + Intergenic
1112555124 13:100460002-100460024 ATACTGTCACATTGAGGGTTAGG + Intronic
1112657488 13:101467166-101467188 ATACTGTCACGTTGGGGATTAGG + Intronic
1112739282 13:102455357-102455379 ATACTATCACATTGGGGATTAGG - Intergenic
1112744526 13:102511789-102511811 CTACAGTCGCACTGGGGGTTAGG - Intergenic
1112893892 13:104273990-104274012 GTGCAATCACATTGGGGTTTAGG - Intergenic
1113360943 13:109630975-109630997 ATACAGTCACATTGAGGGTTAGG - Intergenic
1113501087 13:110774752-110774774 ATGCCGTCAAATTGGTGGTTAGG + Intergenic
1113528387 13:111000642-111000664 ATGCAGTCACATTAAGGGTTAGG - Intergenic
1113548263 13:111171780-111171802 ATACTGTCACCTTGGGGGTTAGG - Intronic
1114394248 14:22342529-22342551 ATACAGTCACATTGGGGGCTAGG + Intergenic
1114690050 14:24573212-24573234 ATGCCATCACATTGGGGATTAGG - Intergenic
1114901024 14:27058175-27058197 ATACCATCACATTGGGGGTTGGG - Intergenic
1115273911 14:31584991-31585013 GTGCTTTCACATTAGAGGTTAGG + Intronic
1115300027 14:31875035-31875057 ATACTATCACCTTGGGGGTTAGG - Intergenic
1115375653 14:32672632-32672654 ATATAGTCACATTGGGGGTTAGG + Intronic
1115503247 14:34067947-34067969 ATACTGTCACATTGGGTATTAGG + Intronic
1115582611 14:34776660-34776682 ATACAGTCACATTGGAGGTTAGG - Intronic
1115946611 14:38668534-38668556 ATACTATCACATTGGGGGTTAGG - Intergenic
1115960982 14:38836114-38836136 CTGCTGTCAGCATGGGGGTGAGG + Intergenic
1116070316 14:40035487-40035509 ATGCCATCACATTGAGGGTTAGG + Intergenic
1116112508 14:40604843-40604865 ATGCAGTCACATTGGAGGTTAGG + Intergenic
1117211458 14:53505001-53505023 ATACAGTCACATTGAGGGTTAGG + Intergenic
1117581338 14:57154393-57154415 ATACAGTCACATTGGGGGATAGG - Intergenic
1118628495 14:67681042-67681064 ATACAGTCACACTGGGGGTTAGG - Intronic
1118739343 14:68727762-68727784 CTTCTGTCACTTTGGGGGTGAGG + Intronic
1119036373 14:71233015-71233037 ATGCCCTCACCTTGGGGGTTAGG - Intergenic
1119577870 14:75743979-75744001 ATGCTGTCACATTGGAGGTTAGG + Intronic
1119873658 14:78038045-78038067 ATACAGTCACATTGGAGGTTAGG - Intergenic
1120056294 14:79928042-79928064 ATGCCATCACATTGGGGGTTAGG + Intergenic
1120507716 14:85374336-85374358 GTGCTGTCACATTAGTGGTTAGG - Intergenic
1120842154 14:89095442-89095464 GTACTGTCACATTGGGGATTAGG - Intergenic
1120934832 14:89884764-89884786 ATACTGTCACATTGTGGGTGAGG - Intronic
1121246063 14:92461666-92461688 ATACAGTTACATTGGGGGTTAGG + Intronic
1121566942 14:94917066-94917088 ATATAGTCACATTGGGGGTTAGG - Intergenic
1121579575 14:95017619-95017641 ATACCATCACATTGGGGGTTAGG + Intergenic
1121979423 14:98441657-98441679 ATGCCATCACATTAGGGGTTAGG + Intergenic
1122160405 14:99780218-99780240 ATACAGTCACATTGGGGGTTGGG + Intronic
1122676872 14:103422891-103422913 ATACAGTCACACTGGGGGTTAGG - Intronic
1122827925 14:104380373-104380395 GAACAGTCACATTGGGGGTTAGG + Intergenic
1123986428 15:25650367-25650389 ATACTGTCACATTGGGGGTTAGG + Intergenic
1124239054 15:28015034-28015056 CAGCTGTGAGATTGGGCGTTGGG - Intronic
1124626418 15:31310038-31310060 CCACCGTCACACTGGGGGTTGGG + Intergenic
1125397124 15:39261182-39261204 ATACAGTCACAATGGGGGTTAGG + Intergenic
1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG + Intronic
1125768240 15:42149188-42149210 ATACTGTCACATTGGGGGTTAGG - Intronic
1125885222 15:43224319-43224341 ATACAGTCACATTGGGGGTTAGG + Intergenic
1126078362 15:44934779-44934801 CTACAGTCACATTGGGAGTTAGG + Intergenic
1126079485 15:44945567-44945589 CTACAGTCACATTGGGGGTTAGG - Intergenic
1126466330 15:48964458-48964480 CTGCTGAAACACTGGGGGTGTGG + Intergenic
1126796317 15:52262875-52262897 ATACGGTCACATTGGGGGTTAGG - Intronic
1126960761 15:53991502-53991524 CTGCTGGCAGATTGGGTATTTGG + Intergenic
1127484061 15:59403251-59403273 ATACAGTCATATTGGGGGTTAGG - Intronic
1127526150 15:59793644-59793666 CTGTTGTCTTATTGGCGGTTTGG + Intergenic
1127637854 15:60888582-60888604 CTGCTGTTACCTTGTGGTTTGGG - Intronic
1127764253 15:62169448-62169470 ATACTGTCACATTGGGGGTTAGG - Intergenic
1128291721 15:66483237-66483259 CTGGAGTCACAGTGGGGGGTAGG - Intronic
1128631234 15:69269995-69270017 AAACTGTCACAATGGGGGTTGGG - Exonic
1129029362 15:72607382-72607404 CTCCTCTCACAGTGGGGGCTGGG + Intergenic
1129037299 15:72658426-72658448 CTCCTCTCACAGTGGGGGCTGGG + Intronic
1129212588 15:74078799-74078821 CTCCTCTCACAGTGGGGGCTGGG - Intronic
1129397811 15:75262280-75262302 CTCCTCTCACAGTGGGGGCTGGG + Intronic
1129401422 15:75286561-75286583 CTCCTCTCACAGTGGGGGCTGGG + Intronic
1129705093 15:77789758-77789780 CTGCTGACACCTTGGGGTTTGGG + Intronic
1129729725 15:77923120-77923142 CTCCTCTCACAGTGGGGGCTGGG - Intergenic
1130043612 15:80427034-80427056 ATACTTTCACATTGGGGGTTAGG + Intronic
1130387905 15:83428334-83428356 ATGCCATCACATTAGGGGTTAGG - Intergenic
1130702287 15:86196700-86196722 ATACAGTAACATTGGGGGTTAGG - Intronic
1131342740 15:91617940-91617962 GTACAGTCACATTGGGGCTTAGG - Intergenic
1131372386 15:91893602-91893624 ATACTATCACATTGGTGGTTAGG + Intronic
1131409474 15:92194815-92194837 ATGCTATTACATTGGTGGTTAGG - Intergenic
1131714105 15:95089914-95089936 ATACCATCACATTGGGGGTTAGG - Intergenic
1131822310 15:96285674-96285696 GTCCTTTCACATTGGGGGTGGGG - Intergenic
1132138323 15:99366717-99366739 ATGCCCTCACACTGGGGGTTTGG + Intronic
1132240110 15:100251386-100251408 CTATAGTCACATTGGGAGTTAGG - Intronic
1133228905 16:4357067-4357089 CTGCTGTCCCAGTCTGGGTTGGG + Intronic
1133707644 16:8370315-8370337 ATGCTATCATATTGTGGGTTAGG + Intergenic
1134429999 16:14194471-14194493 ATGCAGTCACATTGGGGGTTAGG + Intronic
1134747589 16:16600045-16600067 CTGCTGTCACGCTGGAGTTTTGG - Intergenic
1134768497 16:16783420-16783442 ATACAGTTACATTGGGGGTTAGG - Intergenic
1134997882 16:18753612-18753634 CTGCTGTCACGCTGGAGTTTTGG + Intergenic
1135157153 16:20062219-20062241 GTCCCATCACATTGGGGGTTAGG - Intronic
1135161548 16:20101128-20101150 GTACTGTCACTCTGGGGGTTAGG + Intergenic
1135281407 16:21156606-21156628 ATCCCATCACATTGGGGGTTAGG + Intronic
1135348649 16:21710472-21710494 ATGCCATCACATTAGGGGTTAGG + Intronic
1135463954 16:22669304-22669326 CATATCTCACATTGGGGGTTAGG + Intergenic
1135621760 16:23961991-23962013 GTGCTGTCACATGAGGGGATGGG + Intronic
1135821114 16:25687104-25687126 ATACAGTCACATTGGAGGTTAGG + Intergenic
1136159908 16:28413051-28413073 ATGCTATGACATTGGGGATTAGG + Intergenic
1136203180 16:28702241-28702263 ATGCTATGACATTGGGGATTAGG - Intronic
1136516899 16:30773871-30773893 CTGCTGTCAGCTTGGGGTCTGGG + Intronic
1137466345 16:48713301-48713323 ATACAGTCACATTGGGGGTTAGG - Intergenic
1137539178 16:49350279-49350301 ACACAGTCACATTGGGGGTTAGG - Intergenic
1137542296 16:49373052-49373074 ATGCCATCACCTTGGGGGTTAGG + Intergenic
1137721333 16:50629344-50629366 ATACAATCACATTGGGGGTTAGG + Intronic
1138120088 16:54393832-54393854 ATACCGTCACATTGGGGGTTAGG - Intergenic
1138231176 16:55337565-55337587 ATACAGTCACATTAGGGGTTAGG + Intergenic
1138310211 16:56017143-56017165 ATATAGTCACATTGGGGGTTAGG - Intergenic
1138593833 16:58018718-58018740 ATACTATCACATTGGGGGTTAGG + Intronic
1138903338 16:61301034-61301056 ATGTAGTCACATTGGGGTTTAGG - Intergenic
1139194637 16:64905020-64905042 ATACTATCACATTGGGGATTAGG - Intergenic
1139263340 16:65616793-65616815 ATATAGTCACATTGGGGGTTGGG - Intergenic
1140066839 16:71618604-71618626 ATACTGTCACATTGGGTATTGGG - Intergenic
1140596411 16:76419974-76419996 ATACAGTCACATTGTGGGTTAGG + Intronic
1140764665 16:78145858-78145880 ATGCAGTCATGTTGGGGGTTAGG + Intronic
1140807631 16:78547652-78547674 CTGCTGGCAGATTGAGTGTTTGG + Intronic
1141062335 16:80884909-80884931 ATGCAGTCACATTGAGGGTTGGG + Intergenic
1141215898 16:82023580-82023602 ATACCATCACATTGGGGGTTAGG + Intergenic
1141328175 16:83082132-83082154 ATGTTATCACATTGGGGTTTAGG + Intronic
1142565353 17:836543-836565 CTGGTGTGACATTGGAGGCTGGG - Intronic
1143395201 17:6589140-6589162 ATACTACCACATTGGGGGTTAGG - Intronic
1143868009 17:9938103-9938125 ATGCAGCCACATTGTGGGTTAGG - Intronic
1144114853 17:12078046-12078068 GTACAGTCACATTTGGGGTTAGG + Intronic
1144125904 17:12202713-12202735 ATACCATCACATTGGGGGTTAGG - Intergenic
1144959566 17:19037522-19037544 CTGCTGTCACATGGGGGATTAGG - Intronic
1144975593 17:19137002-19137024 CTGCTGTCACATGGGGGATTAGG + Intronic
1145408347 17:22631234-22631256 ATACTGTCACATTGTGGGGTAGG - Intergenic
1145923805 17:28631100-28631122 ATACTGTTACATTGGGGGTTAGG - Intronic
1146366779 17:32234980-32235002 ATACTGTCACCTTGGAGGTTAGG + Intronic
1146484874 17:33234835-33234857 ATGCCATCACATTAGGGGTTAGG + Intronic
1146580061 17:34029539-34029561 CTACAGTCATATTGGGGGTTAGG - Intronic
1146892825 17:36517736-36517758 ATGCAGTCACATTGGGAGTGAGG - Intronic
1147462154 17:40580004-40580026 CTGCAGCCATATTGGGGGTTAGG + Intergenic
1148149843 17:45390126-45390148 ATGCCATCACATTGAGGGTTAGG - Intergenic
1148160471 17:45447151-45447173 CTGTTGTCCCCTTGAGGGTTGGG + Intronic
1148202110 17:45756162-45756184 CTGCTCTCAAATTGGGGTTCTGG - Intergenic
1149321932 17:55490333-55490355 TTGCTGTTACATTAGTGGTTTGG + Intergenic
1149443739 17:56697694-56697716 ATATAGTCACATTGGGGGTTAGG + Intergenic
1149743347 17:59069715-59069737 ATACAGTCACATTGGGGGTTAGG - Intronic
1150088991 17:62303492-62303514 ATACAGTCACATTGGGGATTAGG + Intergenic
1150166440 17:62948093-62948115 ATACTCTCACCTTGGGGGTTAGG - Intergenic
1150263053 17:63812335-63812357 CTGCTGCTTCCTTGGGGGTTTGG - Intronic
1150391760 17:64794031-64794053 CTGTTGTCCCCTTGAGGGTTGGG + Intergenic
1150415346 17:64983757-64983779 ATACTATCACGTTGGGGGTTAGG - Intergenic
1150788834 17:68184079-68184101 CTGTTGTCCCCTTGAGGGTTGGG + Intergenic
1150796320 17:68240279-68240301 ATACTATCACATTGGGGGTAAGG + Intergenic
1151106919 17:71625880-71625902 ATACTATCACATTGGAGGTTAGG - Intergenic
1151371548 17:73649711-73649733 ATACTATCACATTGAGGGTTAGG + Intergenic
1152749336 17:82055426-82055448 CTGCTGTCACTGTGGGCGTGAGG + Intronic
1152792292 17:82287840-82287862 ATGCAGTCACATCGGGGGCTAGG - Intergenic
1152908514 17:82983815-82983837 ATACAGTCACATTGGGAGTTAGG - Intronic
1153263232 18:3244384-3244406 ATACAGTCACACTGGGGGTTAGG - Intergenic
1153433871 18:5048199-5048221 ATGCCATCACAGTGGGGGTTAGG + Intergenic
1153653122 18:7259162-7259184 ATACTGTCACATTGGGTATTAGG - Intergenic
1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG + Exonic
1154132505 18:11749721-11749743 CCTCCCTCACATTGGGGGTTAGG - Intronic
1154287500 18:13073822-13073844 GTACTGTCACATTGGGGACTAGG + Intronic
1155028356 18:21962461-21962483 ATACAGTCACATTGGGGGTTAGG + Intergenic
1155178588 18:23323677-23323699 ATACTATCACACTGGGGGTTGGG - Intronic
1155233406 18:23795869-23795891 ATACAGTCACACTGGGGGTTAGG - Intronic
1155319509 18:24605205-24605227 TTGTAATCACATTGGGGGTTAGG - Intergenic
1155728047 18:29114604-29114626 ATACTATCACATTGGGGATTAGG - Intergenic
1156034993 18:32756077-32756099 ATGTAGTCACTTTGGGGGTTAGG - Intronic
1156260877 18:35444188-35444210 ATACAGTCACATTTGGGGTTAGG + Intronic
1156461582 18:37324257-37324279 ATACAGTCACAATGGGGGTTAGG - Intronic
1156891857 18:42199225-42199247 ATACAGTCACACTGGGGGTTAGG + Intergenic
1157042542 18:44057839-44057861 ATGCCATCACATTGGGAGTTAGG + Intergenic
1157111912 18:44828709-44828731 ATACAGTCACATTGGGAGTTAGG - Intronic
1157348589 18:46863811-46863833 ATACAGTCACATTGGGGGTTAGG - Intronic
1158028610 18:52934657-52934679 ATACAGTCACATTGGGGGTTAGG - Intronic
1158107646 18:53904086-53904108 CTCCTGTCACTTTTGGGATTTGG + Intergenic
1158226896 18:55210816-55210838 ATACAGTTACATTGGGGGTTAGG - Intergenic
1158550668 18:58433252-58433274 ATGATGTCTCAATGGGGGTTAGG - Intergenic
1158762965 18:60412145-60412167 GTACTGTCACATTGGGGATTAGG - Intergenic
1159409462 18:68052761-68052783 ATGCTATCACATTGGCGATTAGG + Intergenic
1159427526 18:68309425-68309447 ATGCTATTATATTGGGGGTTGGG - Intergenic
1159580600 18:70230872-70230894 ATACAGCCACATTGGGGGTTAGG + Intergenic
1159584979 18:70275258-70275280 ACACTGTCACATTGGGGATTAGG - Intergenic
1159611950 18:70535569-70535591 CTATAGTCACATTAGGGGTTAGG + Intergenic
1159807997 18:72978716-72978738 ATGCTATCACATTCGGGGTTAGG + Intergenic
1159955067 18:74513289-74513311 CTGCTGCCTCATTGGCTGTTTGG + Intronic
1160838368 19:1135465-1135487 GTGCTGTCACATTGGGGCCTGGG - Intronic
1161750081 19:6089482-6089504 ATGCCGTCATATTGGGGGTTAGG - Intronic
1161778275 19:6275639-6275661 CTGCTGGCACACTGGGGCTAGGG + Intronic
1162994494 19:14325560-14325582 ATATAGTCACATTGGGGGTTAGG + Intergenic
1163083072 19:14957381-14957403 ATACTATCCCATTGGGGGTTAGG - Intronic
1163528311 19:17834801-17834823 CTTCTGTCAAAGTGGGGGTTCGG + Intronic
1164427296 19:28152994-28153016 GTACAGTCACATTAGGGGTTAGG - Intergenic
1164861693 19:31566847-31566869 ATACCGTCACATTGGGGGTTAGG - Intergenic
1168020726 19:53606908-53606930 ATTCTGTCTCATCGGGGGTTTGG - Intergenic
1168641581 19:58034630-58034652 CTGCTGTTCCAGTGGGGGATGGG - Intronic
925586511 2:5470053-5470075 ATACTATCACATTTGGGGTTAGG - Intergenic
925693245 2:6547124-6547146 ATACTGTCACATTGGGAGTTGGG + Intergenic
925718461 2:6806524-6806546 GTGCTGTCACAATGAGTGTTTGG + Intergenic
925767763 2:7253506-7253528 ATACCATCACATTGGGGGTTAGG - Intergenic
926109711 2:10174008-10174030 ATGCAGCCACACTGGGGGTTTGG - Intronic
926288476 2:11509610-11509632 ATACTATCACATTGGGGATTAGG - Intergenic
926578082 2:14604790-14604812 CAGCTGTCACAATGGGTGGTGGG - Intergenic
926596311 2:14792913-14792935 ATATAGTCACATTGGGGGTTAGG - Intergenic
926608583 2:14922667-14922689 ATACAGTTACATTGGGGGTTAGG + Intergenic
926775161 2:16414921-16414943 ATTCCGTCACATTGGGGTTTAGG - Intergenic
927004382 2:18833076-18833098 ATACTGTCACCTTAGGGGTTGGG - Intergenic
927365250 2:22287364-22287386 ATACAGTCACATTGGGGGTTAGG + Intergenic
927789163 2:25996638-25996660 ATACTGTCACCTTGGGGGTTAGG + Intergenic
928275446 2:29896378-29896400 ATGCAGTCACATTGGGGATTAGG - Intronic
928357306 2:30630287-30630309 GTATAGTCACATTGGGGGTTAGG + Intronic
928415436 2:31087817-31087839 ATGCCATCACATTGGGGTTTAGG - Intronic
928702070 2:33909143-33909165 ATCCAGTCACATTAGGGGTTAGG + Intergenic
928707872 2:33970954-33970976 CTAATATCACATTGGGAGTTAGG - Intergenic
928861332 2:35860983-35861005 ATGTCGTCACCTTGGGGGTTAGG - Intergenic
929217048 2:39425433-39425455 ATGCTGCCACATTGAGGGTTAGG - Intronic
929794138 2:45046076-45046098 ATGCTGTCACAATGGAGGTTAGG + Intergenic
929797826 2:45073609-45073631 ATACTGTCACTTTGGGGGTTAGG - Intergenic
930001529 2:46864913-46864935 ATACCATCACATTGGGGGTTAGG + Intergenic
931128014 2:59299036-59299058 ATGCAGTCACAGTGGGGGTTAGG - Intergenic
931382635 2:61767568-61767590 ATACAGTCACATTGGGGGCTGGG + Intergenic
931967947 2:67554119-67554141 ATACTATCACATTGGGGATTGGG + Intergenic
932020317 2:68077943-68077965 ATGCAGTCACATTGAGGGTTAGG + Intronic
932094782 2:68838064-68838086 ATTCTGAGACATTGGGGGTTAGG + Intergenic
932266023 2:70367492-70367514 TTATAGTCACATTGGGGGTTAGG + Intergenic
932711840 2:74071257-74071279 ATGCTATCCCATTGGGGATTAGG + Intronic
933100031 2:78243903-78243925 ATACCATCACATTGGGGGTTAGG - Intergenic
933364977 2:81341042-81341064 ATGCAGTTACATTGAGGGTTAGG + Intergenic
933809767 2:86026026-86026048 CTGCTGTGACCTTAGGGGTAGGG - Exonic
934973879 2:98786777-98786799 CAGCTGTCAAACTGGGCGTTTGG + Intergenic
935063663 2:99629910-99629932 ATACTATCACATTGGGGATTAGG + Intronic
935322432 2:101902139-101902161 GTGCAGTCACACTGGGGGTGAGG - Intergenic
935420833 2:102867212-102867234 TTGCTATCGCACTGGGGGTTAGG - Intergenic
935495504 2:103776060-103776082 GTGCTGACAGATTGGGTGTTGGG - Intergenic
935563204 2:104579196-104579218 ATACAGTCACAATGGGGGTTAGG + Intergenic
936576949 2:113665233-113665255 CTGCGGTCACAAAGGGGTTTTGG - Intergenic
937332932 2:121043379-121043401 ATATTGCCACATTGGGGGTTAGG - Intergenic
937415337 2:121710219-121710241 CTGATGCCACTGTGGGGGTTAGG - Intergenic
937423800 2:121780375-121780397 ATACAGTCACATTGGTGGTTAGG + Intergenic
937581278 2:123491577-123491599 CTACTATCATTTTGGGGGTTAGG + Intergenic
938131688 2:128721331-128721353 ATGCTGTCACACTGAAGGTTAGG + Intergenic
938373544 2:130789343-130789365 ATACAGTCACATTGGGAGTTAGG - Intergenic
938664617 2:133521762-133521784 ATACAGTCACATTGGGAGTTAGG + Intronic
939045059 2:137240056-137240078 ATGTTTTCACTTTGGGGGTTAGG + Intronic
939256578 2:139751253-139751275 ATACAGTCACATTGTGGGTTAGG + Intergenic
939471732 2:142630863-142630885 GTACAGTTACATTGGGGGTTAGG - Intergenic
939495829 2:142926751-142926773 ATGCTGTCACCTTGTTGGTTAGG - Intronic
939791627 2:146585298-146585320 ATACAGTCACATTGAGGGTTAGG + Intergenic
939944305 2:148390370-148390392 ATGCAGTCACTTTAGGGGTTAGG + Intronic
939956297 2:148530303-148530325 AAACAGTCACATTGGGGGTTAGG - Intergenic
939993220 2:148895995-148896017 ATACAGTCACATTGGGTGTTAGG + Intronic
940196791 2:151103877-151103899 ATACTATCACATTGAGGGTTAGG - Intergenic
940214674 2:151292246-151292268 ATACTGTCACCTTGGGGGTTAGG - Intergenic
940550882 2:155154745-155154767 GGACAGTCACATTGGGGGTTAGG + Intergenic
940703815 2:157078985-157079007 ATTCAGTCACATTGTGGGTTAGG - Intergenic
940778402 2:157907666-157907688 ATGCAGTCACATTGGGGGTTGGG + Intronic
941142510 2:161802924-161802946 ATACAGTCACATTTGGGGTTGGG + Intronic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
941878985 2:170462561-170462583 CTGCTGTCAGCATGTGGGTTAGG - Intronic
941957786 2:171221906-171221928 ATACAGTCACATGGGGGGTTAGG + Intronic
942169446 2:173275754-173275776 ATACTGTCACATTGGAGATTAGG - Intergenic
942222129 2:173780597-173780619 ATACCATCACATTGGGGGTTAGG - Intergenic
942225090 2:173807933-173807955 ATACTATCACCTTGGGGGTTAGG + Intergenic
942650226 2:178158535-178158557 ATACTATCACTTTGGGGGTTAGG + Intergenic
942942063 2:181630445-181630467 ATACAGTCACACTGGGGGTTAGG - Intronic
943409538 2:187529618-187529640 ATGCAGTCACATTGGGGGTTAGG + Intronic
943719506 2:191189060-191189082 ATACCATCACATTGGGGGTTAGG + Intergenic
944233194 2:197416372-197416394 ATACAGTCACACTGGGGGTTAGG - Intronic
944360878 2:198854979-198855001 ATGCCATCACCTTGGGGGTTAGG - Intergenic
945126475 2:206516680-206516702 GTACCATCACATTGGGGGTTAGG + Intronic
945161026 2:206890624-206890646 ATATTGTCACATTGAGGGTTAGG - Intergenic
945195718 2:207235738-207235760 ATGCCATCACATTGGGGGTTAGG + Intergenic
945323421 2:208454313-208454335 ATAGAGTCACATTGGGGGTTAGG - Intronic
945333087 2:208561870-208561892 ATACCATCACATTGGGGGTTAGG - Intronic
945471193 2:210229360-210229382 CTTCTGTATCATTGGGAGTTAGG + Intergenic
945636908 2:212366950-212366972 ATACAGTCACATTGGGGGTTAGG - Intronic
946024225 2:216662120-216662142 CTCCTGTCACCATGGGGATTGGG + Intronic
946079284 2:217103259-217103281 ATACCGTCACCTTGGGGGTTAGG + Intergenic
946533735 2:220604598-220604620 ATACAGTCACATTGGGGGTTAGG + Intergenic
946618623 2:221536508-221536530 ATGTAATCACATTGGGGGTTAGG - Intronic
946773411 2:223112523-223112545 ATACAGTCACATTGGGGGTTAGG + Intronic
946881273 2:224179580-224179602 ATGCTGTCACACTGGGGATTAGG + Intergenic
947133729 2:226955868-226955890 ATACAGTCACATTGGGGGTTAGG + Intronic
947136883 2:226984519-226984541 ATGCCATCACATTGAGGGTTTGG + Intronic
947530208 2:230904251-230904273 ATACTGTTACACTGGGGGTTAGG - Intergenic
947647555 2:231754955-231754977 ATACCATCACATTGGGGGTTAGG - Intronic
947654405 2:231813840-231813862 ATACAGTCACATTGGGGGTTAGG + Intergenic
947702641 2:232247573-232247595 ATACGGTCACACTGGGGGTTAGG + Intronic
947950423 2:234142382-234142404 ATACAGTCACATTGGGGGTTAGG - Intergenic
948102967 2:235390048-235390070 ATGCAGTCACATCAGGGGTTAGG + Intergenic
1168787372 20:551623-551645 ATAGTGTCACATTGGGTGTTAGG - Intergenic
1169300621 20:4439152-4439174 ATACTATCACATTAGGGGTTAGG - Intergenic
1169315824 20:4590416-4590438 ATACTATCACCTTGGGGGTTAGG - Intergenic
1169474709 20:5920636-5920658 GTGCTATCACATTGAGGATTAGG + Intronic
1169953775 20:11078449-11078471 GTACTGCCACATTGGGGATTAGG + Intergenic
1170023753 20:11865839-11865861 CTACTGTCACTCTGGGAGTTTGG - Intergenic
1170147992 20:13198482-13198504 ATACTATCACATTGAGGGTTAGG + Intergenic
1170148724 20:13205700-13205722 ATGCCATCACATTGGGGATTAGG + Intergenic
1170220275 20:13934819-13934841 CTGGTATCACATTGTGGTTTTGG + Intronic
1170279077 20:14625638-14625660 CTGCTGTCAGATTAGGCATTTGG - Intronic
1170325982 20:15154764-15154786 CTAATATCACATTGGGGCTTAGG + Intronic
1170728396 20:18949675-18949697 ATACAATCACATTGGGGGTTAGG + Intergenic
1172608598 20:36232347-36232369 CTGATGTCACATGGTGAGTTAGG - Exonic
1172942603 20:38664681-38664703 ATGCACTCACCTTGGGGGTTAGG + Intergenic
1173109045 20:40168171-40168193 CTTCAGTCACATTGAGGGTTAGG + Intergenic
1173179443 20:40793224-40793246 ATACTATCACCTTGGGGGTTAGG - Intergenic
1173202849 20:40966818-40966840 GTGCTGGTACATTGGGTGTTGGG - Intergenic
1173850722 20:46216233-46216255 CTGCTGGCACAGCGGGGGTTGGG - Intronic
1174590812 20:51643423-51643445 CTGCTATCATATTGGGGATTAGG - Intronic
1174851997 20:54004769-54004791 ATGTAGTCACATTGAGGGTTAGG - Intronic
1175029740 20:55940066-55940088 CTACTGTCACCTGGGGGGTTAGG + Intergenic
1175150223 20:56928126-56928148 CTCCTGGCTCAGTGGGGGTTTGG - Intergenic
1175152830 20:56948567-56948589 ATACTATCACACTGGGGGTTAGG - Intergenic
1175568250 20:59998060-59998082 CTGCTCTCACATTTGGGATGCGG - Intronic
1175588780 20:60170196-60170218 ATACAGTCACATTGGGAGTTAGG - Intergenic
1177069934 21:16492198-16492220 ATGCTATCACATTGGGGGTTAGG - Intergenic
1177378057 21:20299535-20299557 ATACTGTCACATTGGGAATTAGG - Intergenic
1177379978 21:20327201-20327223 ATATTGTCTCATTGGGGGTTAGG + Intergenic
1177707053 21:24720001-24720023 ATACTATCACATTGGGGATTAGG + Intergenic
1177781761 21:25629561-25629583 CTACCATCACTTTGGGGGTTAGG + Intergenic
1177897159 21:26867031-26867053 CGCCTGTAACATTAGGGGTTAGG + Intergenic
1177937073 21:27362245-27362267 CTGCTGAAACACTTGGGGTTAGG - Intergenic
1178343457 21:31805418-31805440 ATACCATCACATTGGGGGTTAGG + Intergenic
1178356665 21:31914862-31914884 ATACAGTCACGTTGGGGGTTAGG + Intronic
1178523990 21:33309904-33309926 ATACAGTCACATTGGGGATTAGG - Intergenic
1178898360 21:36579243-36579265 ATTCTGTGACACTGGGGGTTAGG + Intergenic
1179027857 21:37694733-37694755 GTACAGTCACATTGGGAGTTAGG - Intronic
1179030485 21:37715608-37715630 ATACTGTCACCTTAGGGGTTGGG - Intronic
1179357258 21:40672184-40672206 ATACAGTCACATTGGGGGTTAGG + Intronic
1179368065 21:40777282-40777304 CTACCATCACATTGGGGATTAGG + Intronic
1179472170 21:41618573-41618595 GTACCATCACATTGGGGGTTAGG - Intergenic
1179900780 21:44392668-44392690 CTATAGTCACACTGGGGGTTAGG + Intronic
1180088174 21:45517474-45517496 CTGCTGACTCCTTGGGGGTGAGG - Intronic
1180088444 21:45520614-45520636 ATGCAGTGACATTGTGGGTTAGG - Intronic
1180255949 21:46627621-46627643 ATACAGTCACATTGGGGATTGGG - Intergenic
1180748401 22:18108183-18108205 CTACAGTCACACTGGGGATTAGG + Intronic
1180848580 22:18998212-18998234 CTGCTGGCAATTTGGGGGTGGGG + Intergenic
1181003940 22:20000681-20000703 ATACTGTCACATTGGAGATTAGG - Intronic
1181089238 22:20460898-20460920 CTACCATCACAATGGGGGTTAGG - Intronic
1181148813 22:20867922-20867944 CTGCTGTCACATTAGGAGGGAGG - Intronic
1181377519 22:22471810-22471832 ATACTATCACATGGGGGGTTAGG - Intergenic
1181899902 22:26145144-26145166 ATACCATCACATTGGGGGTTGGG - Intergenic
1182493310 22:30688713-30688735 ATACAGTCACACTGGGGGTTAGG + Intergenic
1184159399 22:42688986-42689008 CTGCTGTGAGGTTGGGGGTCAGG + Intergenic
1184435490 22:44472240-44472262 CTGCTGTATCATCGGGGATTTGG - Intergenic
1185133730 22:49056556-49056578 CTGCTGTCACACTGGGAGCCTGG + Intergenic
1185423291 22:50747441-50747463 CTGCGGTCACAAAGGGGTTTTGG + Intergenic
949178310 3:1093866-1093888 ATACTGTAACATTGGGGTTTGGG + Intronic
949185827 3:1190298-1190320 ATACCGTCACATCGGGGGTTAGG + Intronic
949769189 3:7560018-7560040 ATACAGTCATATTGGGGGTTAGG + Intronic
949798027 3:7872243-7872265 ATACAGTCACATTGGGGATTGGG - Intergenic
949931460 3:9081886-9081908 ATACCATCACATTGGGGGTTAGG - Intronic
949932304 3:9088562-9088584 TGGTTGTCACACTGGGGGTTGGG - Intronic
950459269 3:13111602-13111624 ATACTGTCACATTGGGGGTTAGG - Intergenic
951467556 3:23018818-23018840 ATATTGTCACATTGGGTGTTAGG - Intergenic
951805120 3:26635359-26635381 ATACCATCACATTGGGGGTTAGG - Intronic
951955635 3:28250100-28250122 ATACAGTCACATTGAGGGTTAGG + Intronic
952183234 3:30941607-30941629 CTGCTGTCACTGTGGAGGTTGGG + Intergenic
952274634 3:31865543-31865565 ATGCTATCAACTTGGGGGTTAGG - Intronic
952290427 3:32009976-32009998 ATACAGTCACATTGGGAGTTAGG - Intronic
952327568 3:32335002-32335024 CTGCTGGCACATTTGGGGGCTGG + Intronic
952478364 3:33734344-33734366 ATACTATCACATTGGTGGTTGGG - Intergenic
952569140 3:34693498-34693520 ATACAGTCACATTGAGGGTTAGG - Intergenic
952585672 3:34889094-34889116 ATACCATCACATTGGGGGTTAGG + Intergenic
952585870 3:34891244-34891266 AAACAGTCACATTGGGGGTTAGG + Intergenic
952842916 3:37663466-37663488 GTGCTGTTACCATGGGGGTTGGG + Intronic
953358080 3:42271216-42271238 ATACCATCACATTGGGGGTTAGG + Intergenic
954895231 3:53969535-53969557 ATACTATCACCTTGGGGGTTAGG + Intergenic
955011778 3:55024418-55024440 ATACTATCACATTGGGGATTAGG - Intronic
955163712 3:56490124-56490146 ATGCAGTCCCATTGGGGGTTAGG - Intergenic
955646165 3:61139410-61139432 ATTCCATCACATTGGGGGTTAGG - Intronic
956144689 3:66180827-66180849 ATACAGTCACACTGGGGGTTAGG - Intronic
956230963 3:67016166-67016188 ATACCATCACATTGGGGGTTAGG + Intergenic
956794896 3:72709032-72709054 ATGCAGTCACATTGGGGGTTAGG - Intergenic
957217715 3:77343172-77343194 ATACAGTCACATTGGGGGTTAGG + Intronic
957285041 3:78207391-78207413 ATTCTGTCACATTGGGTCTTAGG - Intergenic
957310866 3:78516903-78516925 ATACTATCACATTGGGGCTTAGG + Intergenic
957311122 3:78520177-78520199 ATACTATCACCTTGGGGGTTAGG + Intergenic
957313766 3:78551598-78551620 ATACAGTCACATTGAGGGTTAGG - Intergenic
957432077 3:80123739-80123761 ATACAGTCATATTGGGGGTTAGG + Intergenic
957520101 3:81308382-81308404 ATACCATCACATTGGGGGTTAGG - Intergenic
957883267 3:86249521-86249543 ATGTTATCACATTGGGGATTAGG - Intergenic
958591896 3:96169607-96169629 CTCCTGTCACCCTGGGGGATTGG + Intergenic
958826987 3:99042057-99042079 CTACTGTCACCATTGGGGTTAGG + Intergenic
959101608 3:102016736-102016758 GTGCAGTCACACTGGTGGTTAGG + Intergenic
959123751 3:102265325-102265347 ATACTATCACATTGGGGGTAGGG - Intronic
959509239 3:107190707-107190729 ATGCTATCACATTAGGGATTAGG + Intergenic
959638165 3:108599659-108599681 ATACTATCACATTGGGGGTTAGG - Intronic
959712991 3:109403289-109403311 ATGGGATCACATTGGGGGTTAGG + Intergenic
959910615 3:111759420-111759442 ATGCTGTCACATTGGTGATTAGG + Intronic
960463034 3:117960197-117960219 ATGCCGTCACATTTGGGATTAGG - Intergenic
960703086 3:120456074-120456096 GAACAGTCACATTGGGGGTTCGG + Intergenic
961518600 3:127454245-127454267 CTGCTGCCACACTGGGCTTTTGG - Intergenic
962023678 3:131526307-131526329 CTGCTGCCACAGTGGTAGTTAGG - Intergenic
962687374 3:137860553-137860575 ATGCCATCACATTGGGGATTAGG - Intergenic
962815408 3:138992841-138992863 ATACCATCACATTGGGGGTTAGG - Intergenic
963526727 3:146424373-146424395 ATACAGTCACATTGCGGGTTTGG + Intronic
963773958 3:149419954-149419976 TTACAGTCACAGTGGGGGTTAGG - Intergenic
963877907 3:150497472-150497494 ATACAGTCACATTGGGGGTTAGG - Intergenic
963907225 3:150782685-150782707 ATACTATCACATTGGGGGTTAGG - Intergenic
963990043 3:151642477-151642499 GTGCCATCACATTGGGAGTTGGG + Intergenic
964639307 3:158891672-158891694 ATACTGTCACATTGGGGATTAGG + Intergenic
964918878 3:161871744-161871766 ATACCATCACATTGGGGGTTAGG - Intergenic
965327881 3:167330487-167330509 ATGTAGTCACATTGGGGGTTAGG - Intronic
965404647 3:168254134-168254156 CTACCATCACATTGGGAGTTAGG + Intergenic
965985990 3:174753788-174753810 GTGCAATCACACTGGGGGTTAGG - Intronic
966022282 3:175229674-175229696 ATACTATCACCTTGGGGGTTAGG + Intronic
966082853 3:176026169-176026191 ATACAGTCACATTGGGGGTTAGG + Intergenic
966793037 3:183690833-183690855 ATACTGTCACATTGGGGATTAGG + Intergenic
967259180 3:187625304-187625326 ATGCCATCACCTTGGGGGTTGGG - Intergenic
967854499 3:194106519-194106541 ATACTGTCACATTCAGGGTTCGG + Intergenic
968149098 3:196323004-196323026 AGACTGTCATATTGGGGGTTAGG + Intronic
969343921 4:6559617-6559639 CATATCTCACATTGGGGGTTAGG - Intronic
969519070 4:7665313-7665335 CTGCTTTAACAGTGGGGGATGGG - Intronic
969592263 4:8128707-8128729 ATCCTGTCACACTGGGGTTTAGG - Intronic
969854956 4:9991606-9991628 ATGCAGTCACATTAGGGGTTAGG - Intronic
970124148 4:12790434-12790456 ATACTGTCACACTGGGGCTTAGG + Intergenic
970172704 4:13305414-13305436 TTACTATCACATTGGGAGTTAGG + Intergenic
970269263 4:14326149-14326171 ATGCTATCACATTGGAAGTTAGG - Intergenic
970353583 4:15230461-15230483 CTACCATCACATTGGTGGTTAGG + Intergenic
970633278 4:17978620-17978642 CTGCTTTCACTTTGGGTGGTGGG + Intronic
970770546 4:19607038-19607060 ATACAGTCACATTGGGGGTTAGG + Intergenic
970866270 4:20762316-20762338 ATACTATCACATTGGGGGTTAGG + Intronic
970950475 4:21749702-21749724 CTGCCGTCACACTGAGGGTCAGG + Intronic
971286372 4:25293770-25293792 TTACTGTCACACTGGGGATTAGG + Intergenic
971982372 4:33769214-33769236 ATACCATCACATTGGGGGTTAGG - Intergenic
972057552 4:34823433-34823455 ATGCAGTCACATTGGAGGTTAGG + Intergenic
972220262 4:36947340-36947362 ATATAGTCACATTGGGGGTTTGG - Intergenic
972352106 4:38245410-38245432 ATACTATCACCTTGGGGGTTAGG - Intergenic
972426030 4:38933862-38933884 CTGCTTTGACATTGTCGGTTGGG + Intronic
972490991 4:39587055-39587077 ATGCTAGCACATTGGGGATTAGG + Intronic
972495120 4:39627224-39627246 ATACTATCACACTGGGGGTTAGG + Intronic
972533702 4:39982156-39982178 CTGTAGTGAAATTGGGGGTTAGG - Intergenic
972638739 4:40907219-40907241 ATACAGTCACATTGGGGGTTAGG - Intronic
972742283 4:41898889-41898911 ATACTATCATATTGGGGGTTAGG - Intergenic
972914041 4:43853733-43853755 CTGCCTTCACATTGAGGGTTAGG + Intergenic
973090709 4:46132836-46132858 TTACCATCACATTGGGGGTTAGG - Intergenic
973163936 4:47053528-47053550 ATGCCATCACATTGAGGGTTAGG + Intronic
973766370 4:54166902-54166924 CTGTTATCACATTGGGTGTTAGG + Intronic
973849858 4:54950117-54950139 CTACTGTCACTTTGTGGGTTAGG + Intergenic
974013764 4:56630411-56630433 ATACTATCACATTGGGGGTTAGG + Intergenic
974031983 4:56784452-56784474 ATGCCATCACATTGAGGGTTAGG - Intergenic
974095759 4:57362098-57362120 ATGCAGCCACATTGGAGGTTAGG + Intergenic
974318805 4:60317024-60317046 GTACCATCACATTGGGGGTTAGG - Intergenic
974389020 4:61240327-61240349 ATACTGTCACATTGGGTCTTAGG + Intronic
974586280 4:63882937-63882959 ATGCCATTACATTGGGGGTTTGG - Intergenic
974676694 4:65099972-65099994 CTGCTGTCACATTAGGATTTTGG + Intergenic
975357869 4:73429433-73429455 GTGTCATCACATTGGGGGTTAGG + Intergenic
975684266 4:76904256-76904278 ATACCATCACATTGGGGGTTAGG - Intergenic
976248553 4:83027532-83027554 ATAATGCCACATTGGGGGTTAGG - Intergenic
976713803 4:88101590-88101612 ATACCATCACATTGGGGGTTGGG - Intronic
976736627 4:88316888-88316910 ATACCATCACATTGGGGGTTAGG - Intergenic
976746746 4:88410610-88410632 ATACTATCATATTGGGGGTTAGG + Intronic
976783083 4:88783672-88783694 ATATGGTCACATTGGGGGTTAGG - Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
976936965 4:90648510-90648532 ATACAGTCACATTGGTGGTTAGG - Intronic
977187314 4:93955799-93955821 CTACCATCACATTGGGGGTTAGG - Intergenic
977268965 4:94890857-94890879 GTACCATCACATTGGGGGTTAGG + Intronic
977295053 4:95200890-95200912 ATACTATCACACTGGGGGTTAGG - Intronic
977448509 4:97163028-97163050 ATACTATCACATTGGGGGTTAGG - Intergenic
978161788 4:105557504-105557526 ATACTGTCACATTGGGGATTAGG - Intronic
978608985 4:110516011-110516033 ATACTATCACACTGGGGGTTAGG + Intronic
979393999 4:120163899-120163921 ATACAGTCATATTGGGGGTTAGG - Intergenic
979480501 4:121210825-121210847 ATGCAGTCACATTGGGGTTTAGG + Intronic
979672083 4:123370744-123370766 ATACAGTCATATTGGGGGTTAGG - Intergenic
979704297 4:123703272-123703294 ATACAGTCATATTGGGGGTTAGG - Intergenic
979784035 4:124692548-124692570 ATACCATCACATTGGGGGTTAGG - Intronic
979975780 4:127194625-127194647 ATGCAATCTCATTGGGGGTTAGG + Intergenic
980093182 4:128463299-128463321 ATACAGTCACCTTGGGGGTTGGG + Intergenic
980899149 4:138887894-138887916 ATGCCATCACATTGGGGATTAGG - Intergenic
980975204 4:139604566-139604588 CTACAGTCACACTAGGGGTTAGG - Intronic
981046083 4:140266535-140266557 ATGCCATCACATTGGGGATTAGG + Intronic
981506712 4:145508944-145508966 ATTCTGTCACCTTTGGGGTTAGG + Intronic
981563249 4:146070072-146070094 ATACTATCACTTTGGGGGTTAGG - Intergenic
981670079 4:147276624-147276646 ATACTGTCACATTGAGGGTTAGG + Intergenic
982082462 4:151804023-151804045 GTCCCATCACATTGGGGGTTGGG + Intergenic
982126014 4:152184586-152184608 ATACCGTCACCTTGGGGGTTAGG - Intergenic
982237356 4:153263948-153263970 ATCCCATCACATTGGGGGTTAGG + Intronic
982558321 4:156898052-156898074 ATGCCATCACATTGGGGATTAGG - Intronic
982768031 4:159369791-159369813 ATGCAGTCACATTGGGAGTTAGG + Intergenic
982880016 4:160702191-160702213 GTGCCATCACATTGGGGATTAGG + Intergenic
982951169 4:161698016-161698038 ATGCCATCACATTGGGGGTTAGG - Intronic
982996384 4:162353055-162353077 ATACCATCACATTGGGGGTTAGG + Intergenic
983052528 4:163065512-163065534 ATACTGTCACATTGGGGTTAGGG - Intergenic
983142215 4:164165223-164165245 ATATAGTCACATTGGGGGTTGGG - Intronic
983268072 4:165528831-165528853 GGGCCGTCACATTGGCGGTTAGG - Intergenic
983672300 4:170252400-170252422 ATACCATCACATTGGGGGTTAGG - Intergenic
983849704 4:172565202-172565224 ATACTGTCACATTGGGTATTAGG + Intronic
983968024 4:173837395-173837417 ATACTATCACATTGAGGGTTAGG - Intergenic
984632169 4:182072865-182072887 ATACTGTCATGTTGGGGGTTAGG - Intergenic
985055224 4:186030266-186030288 CTGCTGTGACCTTTGGGGTGGGG - Intergenic
985130340 4:186732694-186732716 ATACAGTCACATTGAGGGTTAGG + Intergenic
985562514 5:596694-596716 ATACAGTTACATTGGGGGTTAGG + Intergenic
985771563 5:1815040-1815062 ATACAGTCACATCGGGGGTTAGG + Intronic
985864240 5:2500953-2500975 ATACTGTCACCTTGGGGATTAGG + Intergenic
986240635 5:5956644-5956666 ATGCTATCACATTGGATGTTAGG - Intergenic
986306919 5:6522963-6522985 CTACAGTCACACTGGGGGTTGGG + Intergenic
986482715 5:8204869-8204891 ATGCCATTACATTGGGGGTTAGG + Intergenic
986713307 5:10503268-10503290 ATACAGTCACATTGGGGGTTAGG + Intergenic
986856561 5:11875494-11875516 ATACTGTTACATTGGGAGTTAGG - Intronic
987107711 5:14656780-14656802 ATATAGTCACATTGGGGGTTAGG + Intergenic
987175361 5:15302540-15302562 ATGCCATCACATTGGAGGTTTGG - Intergenic
987225679 5:15838463-15838485 ATGCCATAACATTGGGGGTTAGG + Intronic
987588641 5:19893004-19893026 CTGCTATCACATTGGGAATTAGG - Intronic
987795025 5:22616770-22616792 ATACCATCACATTGGGGGTTAGG - Intronic
987963726 5:24845484-24845506 ATACAGTCACATTGAGGGTTAGG - Intergenic
988314853 5:29611143-29611165 GTACAGTCACAATGGGGGTTAGG + Intergenic
988329029 5:29810990-29811012 ATACAGACACATTGGGGGTTAGG - Intergenic
988428759 5:31094186-31094208 ATACCATCACATTGGGGGTTAGG + Intergenic
988488545 5:31687903-31687925 GTGCAGTCACATGGTGGGTTAGG + Intronic
988713166 5:33798832-33798854 ATATAGTCACATTGGGGGTTAGG + Intronic
988763882 5:34349149-34349171 CTGCCATCACCTTAGGGGTTAGG - Intergenic
988776679 5:34483168-34483190 ATACTGTCCCACTGGGGGTTAGG + Intergenic
988801418 5:34699619-34699641 ATTCTGAGACATTGGGGGTTAGG + Intronic
988972915 5:36487772-36487794 ATACTATCACCTTGGGGGTTAGG - Intergenic
988993666 5:36694336-36694358 ATATAGTCACATTGGGGGTTAGG - Intergenic
990152475 5:52834848-52834870 ATGCTGTCACTTTAGCGGTTAGG + Intronic
990182219 5:53174045-53174067 ATGCAGTCCCATTGGGGGTTAGG - Intergenic
990377241 5:55183680-55183702 ATACTATCACCTTGGGGGTTAGG + Intergenic
990500901 5:56396375-56396397 ATACTATCACATTGGGTGTTAGG + Intergenic
991088153 5:62667296-62667318 ATACAGTCACATTGGAGGTTAGG + Intergenic
991106728 5:62851873-62851895 CTACTGACACAATGGGGGATGGG + Intergenic
991445166 5:66691786-66691808 ATACTATCGCATTGGGGGTTAGG + Intronic
992110598 5:73488936-73488958 ATACAGTCACATTGAGGGTTAGG + Intergenic
992200224 5:74376301-74376323 ATACAGTCACATTGGGGGTTAGG - Intergenic
993572808 5:89563280-89563302 ATACCATCACATTGGGGGTTAGG + Intergenic
993756031 5:91731607-91731629 ATACTATCACCTTGGGGGTTAGG - Intergenic
993769210 5:91904058-91904080 ATGCCATCACATTGGGGATTAGG - Intergenic
993885246 5:93408480-93408502 CTGCTTGCACATTTGGGGTGTGG - Intergenic
994466491 5:100139858-100139880 TTACTGTCACATTGTGGGTTAGG + Intergenic
994665984 5:102705761-102705783 CTACATTCACATTGGGGGTTAGG + Intergenic
994717412 5:103338377-103338399 ATGCTGTCACAATGGGGGTCAGG - Intergenic
995027327 5:107439093-107439115 ATGCAATCACATTGTGGGTTGGG - Intronic
995128792 5:108608129-108608151 ATGTTGTCACATTTTGGGTTAGG - Intergenic
995247571 5:109951907-109951929 ATACTTTCACATTGGTGGTTAGG - Intergenic
995285654 5:110385559-110385581 ATACTGTCACATTGGGGATTAGG - Intronic
995558527 5:113355807-113355829 ATGCCATCACACTGGGGGTTAGG + Intronic
995921646 5:117321741-117321763 ATATTGTCACATTGGGGATTAGG - Intergenic
996261606 5:121477582-121477604 ATACAGTCACATTGGGAGTTAGG + Intergenic
996485362 5:124027345-124027367 ATGCCATCACATTGGGGGTTAGG - Intergenic
996488108 5:124060090-124060112 ATACAGTCACATTGGGGGTTGGG + Intergenic
996506767 5:124276566-124276588 ATACCGTCACACTGGGGGTTAGG + Intergenic
996730438 5:126712576-126712598 ATACTATCTCATTGGGGGTTAGG - Intergenic
996764306 5:127020471-127020493 ATACTATCACATTGGGGATTAGG - Intronic
997806874 5:136926942-136926964 ATACAGTCATATTGGGGGTTAGG - Intergenic
998312032 5:141142864-141142886 CTACCATCACGTTGGGGGTTAGG + Intronic
998452338 5:142244666-142244688 ATACAGTCACATTGGGGGTTAGG + Intergenic
998918648 5:147043275-147043297 ATGCAGCCACATTGGGGGTTGGG - Intronic
999461294 5:151759194-151759216 ATACAGTCGCATTGGGGGTTAGG + Intronic
999698874 5:154209730-154209752 ATACCGTCACCTTGGGGGTTAGG + Intronic
1000097563 5:157985208-157985230 ATACAGTCACATTGGGGATTAGG - Intergenic
1000131358 5:158303242-158303264 ATACCATCACATTGGGGGTTAGG + Intergenic
1000375054 5:160573097-160573119 ATGCTATCACATTGGAGATTAGG - Intronic
1000609017 5:163355308-163355330 ATATTGTTACATTGGGGGTTAGG - Intergenic
1000663800 5:163969759-163969781 CTATAGTCACATTGGGGGTTAGG + Intergenic
1001494253 5:172176799-172176821 ATGCTATCACCTTGGAGGTTGGG - Intronic
1001630386 5:173170763-173170785 CTACCCTCACCTTGGGGGTTAGG - Intergenic
1001701073 5:173706770-173706792 ATACTGTCACACTGGGGGTAGGG + Intergenic
1001830892 5:174788466-174788488 ATACTATCACATTGGGGGCTGGG + Intergenic
1001836997 5:174841125-174841147 ATCCCATCACATTGGGGGTTAGG - Intergenic
1003428556 6:6017538-6017560 ATACTATCACATTAGGGGTTGGG - Intergenic
1003652864 6:7977313-7977335 ATACTGTCACCTTGGGGCTTAGG + Intronic
1003720512 6:8696741-8696763 ATACTATTACATTGGGGGTTAGG + Intergenic
1003723445 6:8732624-8732646 GTGCCATCACATTGGGAGTTAGG - Intergenic
1003846873 6:10182984-10183006 ATACTATCACATTGAGGGTTAGG - Intronic
1003948668 6:11097702-11097724 GTACAGTCACACTGGGGGTTAGG + Intronic
1004031073 6:11870110-11870132 CTGTGTTCACATTGGGGATTAGG - Intergenic
1004043497 6:12005940-12005962 ATACAGTAACATTGGGGGTTAGG - Intergenic
1004761566 6:18672306-18672328 ACACAGTCACATTGGGGGTTAGG + Intergenic
1005104282 6:22206632-22206654 ATACAATCACATTGGGGGTTAGG - Intergenic
1005106816 6:22232747-22232769 ATACGGTCACATTGAGGGTTAGG - Intergenic
1005314275 6:24589134-24589156 ATACTATCACATTGAGGGTTAGG - Intronic
1005326143 6:24702495-24702517 CTAATATCACCTTGGGGGTTGGG + Exonic
1005467557 6:26130248-26130270 ATGCAGTCACACTGGGGTTTAGG + Intronic
1006118788 6:31791665-31791687 AGCCTGTCACATTGGGGGGTGGG + Exonic
1006195039 6:32235003-32235025 CTGCTGTCAGGTTGGGGGAGAGG + Intergenic
1007222170 6:40287336-40287358 ATACAGTCACATTGGGGGTTAGG - Intergenic
1007566707 6:42857115-42857137 CTGGTGTCACAGTGTGGGCTTGG - Exonic
1007859430 6:44892181-44892203 ATATAGTCACATTGGGGGTTAGG - Intronic
1007923615 6:45632802-45632824 ATACAGTCACATTGGGGATTAGG + Intronic
1008866934 6:56223602-56223624 CAGCTATTACATTGGGGTTTTGG + Intronic
1009446248 6:63745783-63745805 ATACTGTCACACTGGGGATTAGG - Intronic
1009496847 6:64359829-64359851 ATACAGTCACATTGGGGATTAGG + Intronic
1009744562 6:67796635-67796657 ATGCCATCACATTGGTGGTTAGG - Intergenic
1009896854 6:69762645-69762667 ATACTATCACATTGGGAGTTAGG - Intronic
1010504213 6:76636757-76636779 ATGATGTCCCATTGGGGGTTAGG - Intergenic
1011084838 6:83528094-83528116 ATACTGTCACCTTTGGGGTTAGG + Intergenic
1011215622 6:85002781-85002803 CTGCTATGACATTGAGGGTAGGG + Intergenic
1011284771 6:85711344-85711366 ATATTGCCACATTGGGGGTTAGG - Intergenic
1011324979 6:86140669-86140691 ATGCAGTCATATTGGGGATTAGG + Intergenic
1011408564 6:87041773-87041795 ATGCAGTCACACTGGGGCTTAGG + Intergenic
1011979005 6:93347787-93347809 ATACAGTTACATTGGGGGTTAGG + Intronic
1012785272 6:103617289-103617311 ATACCATCACATTGGGGGTTAGG - Intergenic
1013340113 6:109205677-109205699 ATGCCATCACCTTGGGGGTTAGG + Intergenic
1013355196 6:109340238-109340260 ATACTGTCACATTGCTGGTTAGG + Intergenic
1013607650 6:111765249-111765271 ATACAGTTACATTGGGGGTTAGG - Intronic
1013624325 6:111921444-111921466 CTGCAGTCAAGTTGGGGGTGGGG + Intergenic
1013626757 6:111945542-111945564 ATGCCATCACATTAGGGGTTAGG + Intergenic
1013655152 6:112238963-112238985 ATACAGTCACATTAGGGGTTAGG - Intronic
1013991359 6:116257824-116257846 ATACTCTCACATTGGGGATTAGG + Intronic
1014000647 6:116362398-116362420 ATATGGTCACATTGGGGGTTGGG - Intronic
1014253328 6:119137514-119137536 ATACAGTCACATTGGGGGTTAGG + Intronic
1014303460 6:119712183-119712205 ATACTTTCACATTGGGGATTAGG - Intergenic
1014317423 6:119884785-119884807 ATACAGTCACATTGAGGGTTAGG - Intergenic
1014356280 6:120414261-120414283 ATACAGTCACATTGCGGGTTAGG + Intergenic
1014394020 6:120901852-120901874 ATGCCATCACATTGGGGATTAGG - Intergenic
1014528400 6:122528967-122528989 CTACTGTCACATTTGGGACTAGG + Intronic
1014750074 6:125245583-125245605 CTGCAGCCACTGTGGGGGTTGGG + Intronic
1014866957 6:126544252-126544274 CTGCTGCCACATTGTATGTTGGG + Intergenic
1015022277 6:128490998-128491020 ATACAATCACATTGGGGGTTAGG + Intronic
1015280684 6:131430883-131430905 CTGCTGTCACAGAGTTGGTTGGG - Intergenic
1015479981 6:133698369-133698391 ATACTATCACATTGGGGGTTAGG - Intergenic
1016161016 6:140879487-140879509 ATGCAGTCACATTAGGGGTTAGG - Intergenic
1016301326 6:142635078-142635100 ATACAGTCACATTGTGGGTTAGG + Intergenic
1016460096 6:144272836-144272858 ATACTATCACATTGGGGGTTAGG + Intergenic
1016522510 6:144962568-144962590 ATACCATCACATTGGGGGTTAGG - Intergenic
1016915525 6:149240896-149240918 ATATTGTCACATTTGGGGTTAGG - Intronic
1016977417 6:149822962-149822984 CTGCAGTCACAATAGGGGTTAGG + Intronic
1017051743 6:150399892-150399914 ATACCATCACATTGGGGGTTAGG + Exonic
1017072350 6:150586762-150586784 CTGCTCTCACTTCGTGGGTTTGG - Intergenic
1017084927 6:150705021-150705043 ATACAGTCACTTTGGGGGTTAGG + Intronic
1017180905 6:151550905-151550927 ATACCATCACATTGGGGGTTAGG + Intronic
1017459208 6:154633426-154633448 ATGCCATTACATTGGGGGTTAGG - Intergenic
1017617117 6:156257546-156257568 ATACTCTCACATTGGGGATTAGG - Intergenic
1017780163 6:157709639-157709661 ATACTGTCACACTGGGGGGTTGG + Intronic
1018275700 6:162128677-162128699 ATGCTATCACATTGGGGATTAGG - Intronic
1018297189 6:162361293-162361315 ATACGATCACATTGGGGGTTAGG - Intronic
1018351349 6:162962461-162962483 ATGCTATCACATTGGGGTTTGGG - Intronic
1019162082 6:170075657-170075679 ATCCAGCCACATTGGGGGTTAGG + Intergenic
1019874204 7:3794440-3794462 ATACTGCCACATTGGGGATTAGG - Intronic
1019973757 7:4563488-4563510 CTGCTGTTAGGTTGGGGGTCAGG - Intergenic
1020676058 7:11186329-11186351 CTACCATCACCTTGGGGGTTAGG - Intergenic
1021022626 7:15622790-15622812 ATGCCGTCACCTTGAGGGTTAGG - Intronic
1021414742 7:20369580-20369602 ATACTGTCACATTGGAGGTTAGG + Intronic
1021523933 7:21565353-21565375 ATACAGTCACATTGGGAGTTAGG + Intronic
1021816503 7:24452354-24452376 ATACCATCACATTGGGGGTTAGG - Intergenic
1022041973 7:26590162-26590184 ATACAGTCACAATGGGGGTTAGG - Intergenic
1022097080 7:27147843-27147865 CTGCTGTCGCTTTTGGCGTTCGG - Intronic
1022206834 7:28172950-28172972 CTGCTGTCACATTTCTGTTTGGG - Intronic
1022386790 7:29907521-29907543 ATACTGTCACATTAGGGATTAGG - Intronic
1022458959 7:30586132-30586154 CTACTGATACATTGGGGGTTAGG + Intergenic
1022569488 7:31437657-31437679 ATCCTGTCACATTAGGGGATGGG - Intergenic
1022949996 7:35329077-35329099 ATGCCATCACATTGGGGATTAGG - Intergenic
1023184590 7:37519794-37519816 ATACTGTCACATTGGGGATTAGG - Intergenic
1023507706 7:40917906-40917928 ATACCATCACATTGGGGGTTAGG + Intergenic
1023895941 7:44432949-44432971 CTGCCATCACCTTCGGGGTTAGG - Intronic
1024196971 7:47068904-47068926 ATGCAATCATATTGGGGGTTAGG - Intergenic
1024214967 7:47240772-47240794 ATACAGTCACACTGGGGGTTAGG - Intergenic
1024331412 7:48159254-48159276 ATACAGTCACATTGGGGGTTAGG + Intergenic
1024436671 7:49364762-49364784 GTACTATCACTTTGGGGGTTAGG - Intergenic
1024442931 7:49442708-49442730 CTGCTGTCAAATGAGAGGTTTGG + Intergenic
1024548517 7:50541441-50541463 ATGCCATCACTTTGGGGGTTAGG - Intronic
1024582203 7:50809335-50809357 ATACAGTCACATTGGGGTTTGGG + Intergenic
1024677991 7:51655105-51655127 CTCCTGCCACATAGGGGTTTTGG - Intergenic
1026330014 7:69343878-69343900 AAACAGTCACATTGGGGGTTAGG - Intergenic
1026453985 7:70554850-70554872 CAGCTGTCACATTGGACGGTTGG + Intronic
1027593801 7:80147268-80147290 ACCCTATCACATTGGGGGTTAGG - Intronic
1027694101 7:81387217-81387239 ATACAGTCACATTGGAGGTTAGG + Intergenic
1027876842 7:83781702-83781724 TTGCCATCACATTGGAGGTTAGG - Intergenic
1028068293 7:86415686-86415708 CTGCTGCTACAGTGGGGGTGGGG + Intergenic
1028462838 7:91115478-91115500 ATGCCATCACATTAGGGGTTAGG + Intronic
1028665046 7:93332413-93332435 ATGCTATCACATTAAGGGTTAGG + Intronic
1029788975 7:102822568-102822590 TTACTGTCACAGTGGGAGTTAGG + Intronic
1030017616 7:105240310-105240332 ATACCATCACATTGGGGGTTAGG + Intronic
1030175736 7:106651162-106651184 ATGCCATCACATTGGTGGTTAGG + Intergenic
1030214655 7:107032090-107032112 ATGCGGTCACATTGGGGGTTAGG - Intergenic
1030460050 7:109823239-109823261 GTACTATCAAATTGGGGGTTGGG - Intergenic
1030653252 7:112138707-112138729 AAACTGTCACATTGGGGGTTAGG - Intronic
1030942277 7:115667848-115667870 CCACAGACACATTGGGGGTTGGG + Intergenic
1031114512 7:117653573-117653595 ATACTATCACCTTGGGGGTTAGG + Intronic
1031147072 7:118008249-118008271 ATACAATCACATTGGGGGTTAGG + Intergenic
1031322430 7:120348072-120348094 ATACCATCACATTGGGGGTTAGG + Intronic
1032109253 7:129061286-129061308 ATACAGTCACATTGGGGGCTAGG + Intergenic
1032130508 7:129224340-129224362 TTTCTGTCACATTCTGGGTTTGG - Intergenic
1032635779 7:133706917-133706939 ATACTGTCACACTGGGGATTAGG + Intronic
1032647478 7:133841268-133841290 ATACTGTCACCTTGGGGGTTAGG + Intronic
1032762379 7:134955723-134955745 GTACAATCACATTGGGGGTTAGG + Intronic
1033016826 7:137680029-137680051 ATTCTGTCACATTGAGGGTGAGG - Intronic
1033046456 7:137966926-137966948 ATACTATCACATTGGGGGTTAGG - Intronic
1033048410 7:137982782-137982804 ATACTGTCACATTGGAGGTTAGG - Intronic
1033310975 7:140261564-140261586 ATACAGTCACATCGGGGGTTAGG - Intergenic
1034069105 7:148165361-148165383 ATGCAGTCACATTGGAGGTTAGG + Intronic
1034175871 7:149099364-149099386 TTACAGTCACACTGGGGGTTAGG + Intergenic
1034288515 7:149907981-149908003 ATACAGTCACATTGAGGGTTAGG - Intergenic
1034512697 7:151549358-151549380 ATGCTGTCACACTGGGGATTAGG - Intergenic
1034526397 7:151666222-151666244 ATACAGTCACATTGGAGGTTAGG - Intronic
1034662558 7:152784886-152784908 ATACAGTCACATTGAGGGTTAGG + Intronic
1035116905 7:156532459-156532481 ACACAGTCACATTGGGGGTTAGG + Intergenic
1036425784 8:8644147-8644169 GTCCTGACATATTGGGGGTTAGG + Intergenic
1036539359 8:9689050-9689072 ATGCTATCATATTGGGGGTTGGG + Intronic
1037021298 8:13974901-13974923 ATACAGTCACATTGGGGATTAGG - Intergenic
1037537104 8:19835013-19835035 ATGCCCTCACATTGGGGGTTAGG + Intronic
1037577201 8:20218606-20218628 CTGCTTTGACATTTGGGGCTTGG + Intronic
1037737640 8:21580208-21580230 ATACAGTCACATTGGGGGTTAGG - Intergenic
1037738193 8:21583373-21583395 CTAATGTCACCTTGAGGGTTAGG - Intergenic
1037749661 8:21672946-21672968 TTACCATCACATTGGGGGTTAGG + Intergenic
1038000832 8:23390059-23390081 CTGCATTCACATTTGGGGTCAGG + Intronic
1038373741 8:27016986-27017008 ATACTATCACATTGGGGATTAGG + Intergenic
1038482302 8:27910042-27910064 AAACTGTCACATTGGGGATTAGG - Intronic
1038485624 8:27933032-27933054 ATACAGTCACATTGGGGGTTAGG + Intronic
1038984443 8:32793225-32793247 ATGCTTTCACTTTGGGGATTTGG + Intergenic
1039099769 8:33928604-33928626 ATGCTTTCACAGTGGGGATTAGG + Intergenic
1039460928 8:37743545-37743567 ATACAGTCACATTGGGGGTTAGG + Intronic
1039630804 8:39109013-39109035 ATACTGTCACATTGGGGGTTAGG + Intronic
1039928806 8:41963478-41963500 CTGCTGTTGGATTGGGAGTTAGG - Intronic
1040370876 8:46772367-46772389 CTGGTGTCTCATTGTGAGTTTGG + Intergenic
1040541600 8:48362065-48362087 ATGCAGCCACACTGGGGGTTAGG + Intergenic
1040724730 8:50369194-50369216 ATACAGTCACATTAGGGGTTAGG - Intronic
1040982901 8:53263746-53263768 ATTCAGTCACATTGAGGGTTAGG + Intergenic
1040994679 8:53389647-53389669 ATGCTATTACATTGAGGGTTAGG + Intergenic
1041241658 8:55853752-55853774 CTGCTGTCAGCCTGGGGGTTGGG - Intergenic
1041355516 8:56995294-56995316 CTGCTGTCATAGTGTAGGTTGGG - Intergenic
1041599007 8:59693607-59693629 GTACAGTCACATTGGAGGTTAGG - Intergenic
1041740608 8:61152791-61152813 ATACTATCACGTTGGGGGTTAGG + Intronic
1041775945 8:61522926-61522948 ATACAGTCACACTGGGGGTTAGG + Intronic
1042353839 8:67804427-67804449 ATACTATCACATTGGGGATTAGG + Intergenic
1042653102 8:71065206-71065228 ATGCAGTCACATTGGGGGTTAGG - Intergenic
1043984594 8:86679392-86679414 ATTCAGTCACATTAGGGGTTAGG - Intronic
1044079558 8:87867025-87867047 ATACAGTCACATTGGGGGTTAGG - Intergenic
1044416298 8:91944161-91944183 ATACTGTCACATTGGGAATTAGG - Intergenic
1044586849 8:93876266-93876288 ATACAGTCACATTGGAGGTTAGG + Intronic
1044740398 8:95320857-95320879 ATATAGTCACATTGGGGGTTAGG - Intergenic
1045669335 8:104530293-104530315 ATACAGTCACATTGGGAGTTAGG - Intronic
1045687693 8:104728488-104728510 ATGCCGTCATATTGGGGGTAAGG + Intronic
1045876725 8:106990541-106990563 ATACTATCACATTGGAGGTTAGG - Intergenic
1046304689 8:112349902-112349924 ATACAGTCACATTAGGGGTTAGG - Intronic
1046331372 8:112719637-112719659 ATACTATCATATTGGGGGTTAGG + Intronic
1046863771 8:119123501-119123523 ATGCCTTCACACTGGGGGTTAGG + Intergenic
1047017398 8:120738016-120738038 CTGCTATCACCCTGGGAGTTAGG - Intronic
1047441064 8:124879161-124879183 ATACCATCACATTGGGGGTTAGG + Intergenic
1047574756 8:126140554-126140576 ATACAGTCACATTGAGGGTTAGG + Intergenic
1047896168 8:129368891-129368913 ATACCGTCACATTGGGGGTCGGG - Intergenic
1048050889 8:130814973-130814995 ATGCCATCACATTGGGGGTTAGG - Intronic
1048140643 8:131790962-131790984 ATGCAGTCACAGTGGAGGTTAGG + Intergenic
1048577324 8:135703315-135703337 ATACAGTCACATTGAGGGTTAGG - Intergenic
1048944344 8:139430355-139430377 ATACTATCACATTGGGGATTGGG + Intergenic
1049596530 8:143486548-143486570 ACGTAGTCACATTGGGGGTTAGG + Intronic
1049755818 8:144310939-144310961 CTGGTGTCACGTAGGGTGTTGGG - Intronic
1050053849 9:1631505-1631527 ATGCCATCACATTGGGGATTAGG + Intergenic
1050102600 9:2134707-2134729 CTAATATCACATTGGGGGTTAGG - Intronic
1050518247 9:6468642-6468664 CTGCTTTCACCTTTGGGCTTTGG + Intronic
1051261197 9:15266678-15266700 ATTCCATCACATTGGGGGTTTGG - Intronic
1051326849 9:15981179-15981201 ATATTATCACATTGGGGGTTAGG - Intronic
1051480106 9:17550348-17550370 ATACTGTCACATTGGGGATCAGG + Intergenic
1051652714 9:19345049-19345071 ATACTGTCACACTGAGGGTTAGG + Intronic
1051744788 9:20285202-20285224 ATGCAGTCACATTGGATGTTAGG - Intergenic
1052085383 9:24259041-24259063 CTGCTGACAAATTGGGGGATGGG - Intergenic
1052344097 9:27390769-27390791 CTAATATCACCTTGGGGGTTAGG - Intronic
1052399105 9:27978388-27978410 ATGCCATCACCTTGGGGGTTAGG - Intronic
1053348806 9:37397897-37397919 ATACAGTCACATTGGGGTTTAGG + Intergenic
1054833500 9:69651907-69651929 ATGCAGTCACATTGGGGGTTTGG - Intronic
1055390380 9:75815394-75815416 ATATTGTCACATTGGTGGTTAGG + Intergenic
1055392968 9:75843277-75843299 ATGCTATCACGTTGGTGGTTAGG - Intergenic
1055653583 9:78432067-78432089 ATACAGTGACATTGGGGGTTAGG - Intergenic
1055689789 9:78817053-78817075 ATACAGTCACATTGGGGATTAGG + Intergenic
1055726677 9:79237578-79237600 ATACTATCACCTTGGGGGTTAGG + Intergenic
1055877339 9:80959335-80959357 ATGCCATCCCATTGGGGGTTAGG - Intergenic
1055928219 9:81532507-81532529 CTCCTGTTACATTGGGGCTTAGG + Intergenic
1056217472 9:84418726-84418748 ATACTATCACATTGGAGGTTAGG - Intergenic
1056442592 9:86635621-86635643 ATACCATCACATTGGGGGTTGGG - Intergenic
1056485654 9:87054585-87054607 ATACTGTCACCTTGAGGGTTAGG + Intergenic
1056819791 9:89831211-89831233 ATACAGTCACATTGGAGGTTAGG - Intergenic
1056844769 9:90027707-90027729 ATGCTTTCACATTGGGGATTAGG + Intergenic
1057522125 9:95768526-95768548 ATACCATCACATTGGGGGTTAGG - Intergenic
1057589644 9:96361284-96361306 ATACAGTCACATTGGGGATTAGG - Intronic
1057887975 9:98845553-98845575 GAACTGTCATATTGGGGGTTTGG + Intronic
1058014490 9:100015105-100015127 ATACTGTCACATTGGGGATTAGG + Intronic
1058304896 9:103427590-103427612 ATACCATCACATTGGGGGTTAGG + Intergenic
1058850304 9:109005417-109005439 ATACCATCACATTGGGGGTTAGG - Intronic
1059323572 9:113487968-113487990 CTGCAGTCACTTTGGTGTTTGGG + Intronic
1059358085 9:113716845-113716867 ATACTGTCACATTGGTGATTAGG + Intergenic
1059365428 9:113783118-113783140 ATTCAGTCACATTGGGGATTAGG - Intergenic
1059388927 9:113986679-113986701 ATCCAGTCACACTGGGGGTTAGG + Intronic
1059496972 9:114718009-114718031 ATACAGTCACCTTGGGGGTTAGG - Intergenic
1059898839 9:118899470-118899492 ATACTGTCACATTGGGGATTAGG + Intergenic
1060306797 9:122420975-122420997 CTCATGTCTCAGTGGGGGTTGGG + Intergenic
1060332029 9:122681522-122681544 ATACTGTTACATTGGGGATTAGG + Intergenic
1060345057 9:122808662-122808684 ATACAGTCACTTTGGGGGTTTGG + Intronic
1060470311 9:123942986-123943008 CTGCAGTCAGCTTGGGAGTTTGG + Intergenic
1060496343 9:124121981-124122003 ATACAGTCACACTGGGGGTTAGG + Intergenic
1061897653 9:133656861-133656883 CTCCTGTCACCTTGGCGGGTGGG - Intronic
1062304530 9:135896797-135896819 CCACTGCCACATTGGGGATTAGG - Intronic
1186028216 X:5337537-5337559 ATCCTGCCACATTGGGGATTAGG - Intergenic
1186057066 X:5661165-5661187 ATGCTGTCACCTTGGAGATTGGG - Intergenic
1186313924 X:8348646-8348668 ATGCCATCACTTTGGGGGTTAGG + Intergenic
1186408723 X:9327020-9327042 ATACTCTCACCTTGGGGGTTAGG - Intergenic
1186683748 X:11902590-11902612 ATTCTATCACATTGGGGGTTAGG + Intergenic
1186685559 X:11921441-11921463 ATACAATCACATTGGGGGTTAGG + Intergenic
1186806442 X:13144754-13144776 ATACTATCACATTGGGGGTTAGG + Intergenic
1187138106 X:16567842-16567864 ATGCCGTCACATTGGGGATTAGG + Intergenic
1187306149 X:18097026-18097048 ATGCAGTCACATTCGGGGTTAGG + Intergenic
1187581920 X:20616321-20616343 ATACAGTCACATTGGGGATTAGG + Intergenic
1187673487 X:21691980-21692002 ATACTGTCACACTGGAGGTTAGG + Intergenic
1188023833 X:25187538-25187560 ATACCATCACATTGGGGGTTAGG - Intergenic
1188287007 X:28339349-28339371 ATACAGTCACATTGGGGGTTAGG + Intergenic
1188768053 X:34121423-34121445 CTACTGTCACATTGGCAGTTAGG + Intergenic
1188936812 X:36185935-36185957 ATACGGTCACATTGGTGGTTAGG + Intergenic
1189154568 X:38744055-38744077 ATACTATCACACTGGGGGTTAGG + Intergenic
1189343687 X:40223866-40223888 ATGCAGTCACATTGGGGTTAGGG + Intergenic
1189545871 X:42042188-42042210 ATACAGTCACATTGGGGGTTAGG + Intergenic
1189629950 X:42942436-42942458 ATATAGTCACATTGGGGGTTAGG - Intergenic
1189920235 X:45896402-45896424 CTTCTGTCCCAGTGGGAGTTGGG + Intergenic
1190089988 X:47429199-47429221 TTTCAGTCACATTGAGGGTTAGG + Intergenic
1190155721 X:47991077-47991099 ATATAGTCACATTGGGGGTTAGG - Intronic
1190241082 X:48658691-48658713 ATACTATCACATTAGGGGTTAGG + Intergenic
1190451856 X:50590122-50590144 ATGCCATCACATTGGGGATTAGG - Intergenic
1190838811 X:54127170-54127192 ATACCATCACATTGGGGGTTAGG + Intronic
1191752317 X:64556287-64556309 ATACAGTCAGATTGGGGGTTAGG - Intergenic
1192153563 X:68726714-68726736 CTGCTGTCACCTAGGGGTCTTGG + Intergenic
1192251214 X:69415380-69415402 ATACAGTCACATTGGGGGTTAGG + Intergenic
1192594170 X:72388688-72388710 ATGCAGCCACATTAGGGGTTAGG - Intronic
1192918422 X:75679670-75679692 ATATTGTCACATTAGGGGTTAGG + Intergenic
1193369619 X:80678848-80678870 CTGCAGTCACTTCGGGGATTAGG - Intronic
1193825590 X:86222078-86222100 ATACTTTCACATTGGGGGTTAGG + Intronic
1193919409 X:87407032-87407054 CTGATCTCACAGTGAGGGTTGGG - Intergenic
1194123193 X:89985704-89985726 CTGCTGGCATATTGGGCGCTTGG - Intergenic
1194234659 X:91367311-91367333 ATGCCATCACATTGGAGGTTAGG - Intergenic
1194364645 X:92999395-92999417 ATACTATCACATTGTGGGTTAGG - Intergenic
1194678119 X:96817811-96817833 CCCCAATCACATTGGGGGTTAGG + Intronic
1194745181 X:97620457-97620479 ATACTATCACCTTGGGGGTTAGG + Intergenic
1194798931 X:98247450-98247472 ATATAGTCACATTGGGGGTTAGG - Intergenic
1195228324 X:102820842-102820864 ATACTGTCACATTGGAGATTAGG + Intergenic
1195462742 X:105145880-105145902 ATACTATCACATTGGGGGTTAGG - Intronic
1195508885 X:105691092-105691114 ATGCAGTCACATTGAGGGTTAGG + Intronic
1195571063 X:106399243-106399265 ATTCAGTCACATTGGGAGTTGGG + Intergenic
1195663394 X:107404877-107404899 CTACAATCACATTGTGGGTTAGG + Intergenic
1196134563 X:112194275-112194297 ATACTATCACATTGGGGATTAGG - Intergenic
1196187682 X:112762115-112762137 ATGCAGTCACATTGGGAGTTAGG + Intergenic
1196889443 X:120277937-120277959 ATACAGTCACATTGGGGGATAGG - Intronic
1197037456 X:121892181-121892203 ATACTATCACATTGGAGGTTAGG - Intergenic
1197242513 X:124135207-124135229 ACACTGTCACATTGGGGATTAGG - Intronic
1197270908 X:124423857-124423879 ATACAGTCACACTGGGGGTTAGG - Intronic
1197299649 X:124762244-124762266 ATACTATCACATTGGTGGTTAGG + Intronic
1197551447 X:127897594-127897616 GTACAGTCACTTTGGGGGTTAGG - Intergenic
1197711696 X:129676163-129676185 ACACTGTCACCTTGGGGGTTAGG + Intergenic
1197731916 X:129818025-129818047 GTGCAGCTACATTGGGGGTTAGG - Intronic
1197883042 X:131189512-131189534 ATACTGTCACATTGGGGATTAGG - Intergenic
1197966115 X:132063913-132063935 ATACCATCACATTGGGGGTTAGG - Intergenic
1198078843 X:133219583-133219605 ATACAGTCAAATTGGGGGTTAGG + Intergenic
1198922905 X:141750389-141750411 ATGCTATTACACTGGGGGTTAGG + Intergenic
1199692427 X:150318723-150318745 ATACCATCACATTGGGGGTTAGG + Intergenic
1199827348 X:151513734-151513756 CTGTTGTTAGATTGGGGGTTGGG + Intergenic
1200476054 Y:3643150-3643172 CTGCTGGCATATTGGGCGCTTGG - Intergenic
1200672873 Y:6115656-6115678 ATACTATCACATTGTGGGTTAGG - Intergenic
1200833941 Y:7714429-7714451 ATATAGTCACATTGGGGGTTAGG - Intergenic
1201148180 Y:11078008-11078030 ATGCCATCACATTGGGGGTTAGG - Intergenic
1201646644 Y:16240649-16240671 ATCCAGTCACATTGGGAGTTAGG + Intergenic
1201656169 Y:16344668-16344690 ATCCAGTCACATTGGGAGTTAGG - Intergenic