ID: 1077058008

View in Genome Browser
Species Human (GRCh38)
Location 11:605339-605361
Sequence TGCCCACAGCCCCCAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 7, 3: 55, 4: 503}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077058008_1077058022 30 Left 1077058008 11:605339-605361 CCTCTCCCTGGGGGCTGTGGGCA 0: 1
1: 0
2: 7
3: 55
4: 503
Right 1077058022 11:605392-605414 GGTTTTGTGTTTGAGAGTGAGGG 0: 1
1: 0
2: 1
3: 46
4: 476
1077058008_1077058021 29 Left 1077058008 11:605339-605361 CCTCTCCCTGGGGGCTGTGGGCA 0: 1
1: 0
2: 7
3: 55
4: 503
Right 1077058021 11:605391-605413 AGGTTTTGTGTTTGAGAGTGAGG 0: 1
1: 0
2: 3
3: 33
4: 392
1077058008_1077058015 -1 Left 1077058008 11:605339-605361 CCTCTCCCTGGGGGCTGTGGGCA 0: 1
1: 0
2: 7
3: 55
4: 503
Right 1077058015 11:605361-605383 ACGGGGCCCCGAGGTGCATGCGG 0: 1
1: 0
2: 0
3: 8
4: 102
1077058008_1077058014 -10 Left 1077058008 11:605339-605361 CCTCTCCCTGGGGGCTGTGGGCA 0: 1
1: 0
2: 7
3: 55
4: 503
Right 1077058014 11:605352-605374 GCTGTGGGCACGGGGCCCCGAGG 0: 1
1: 0
2: 5
3: 35
4: 320
1077058008_1077058020 9 Left 1077058008 11:605339-605361 CCTCTCCCTGGGGGCTGTGGGCA 0: 1
1: 0
2: 7
3: 55
4: 503
Right 1077058020 11:605371-605393 GAGGTGCATGCGGAGGCGTTAGG 0: 1
1: 0
2: 0
3: 10
4: 104
1077058008_1077058016 2 Left 1077058008 11:605339-605361 CCTCTCCCTGGGGGCTGTGGGCA 0: 1
1: 0
2: 7
3: 55
4: 503
Right 1077058016 11:605364-605386 GGGCCCCGAGGTGCATGCGGAGG 0: 1
1: 0
2: 1
3: 18
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077058008 Original CRISPR TGCCCACAGCCCCCAGGGAG AGG (reversed) Intronic
900109364 1:999101-999123 TGCCCGCCGCCCCCAGGGCGGGG - Exonic
900169606 1:1260189-1260211 CGGCCACATCCACCAGGGAGAGG + Intronic
900246715 1:1639702-1639724 CGCCCACAGGCACCAAGGAGGGG + Intronic
900257936 1:1706834-1706856 CGCCCACAGGCACCAAGGAGGGG + Intronic
900458654 1:2789770-2789792 CGCACACAGCCCCCCGGGTGCGG + Intronic
900610249 1:3541676-3541698 TTCCCACTGTCCCCAGGGAGAGG - Intronic
900751855 1:4402911-4402933 TGCCCAGATGCCCCAGGGATGGG - Intergenic
901033864 1:6324604-6324626 TGCCCACACCCCCCGGGGTCTGG + Intronic
901239823 1:7686434-7686456 GGAGCAAAGCCCCCAGGGAGAGG + Intronic
902688850 1:18096996-18097018 TGCAGGCAGCTCCCAGGGAGTGG - Intergenic
902962872 1:19977157-19977179 GGCCTCCAGCACCCAGGGAGGGG - Intronic
902984931 1:20149404-20149426 TGCCCACAGCCCAGGGAGAGAGG - Exonic
903184881 1:21623162-21623184 TGGCCACAGCACCTAGGGAGGGG + Intronic
903373803 1:22853425-22853447 TGCTCACAGCCTCCTAGGAGAGG + Intronic
903943965 1:26950348-26950370 TGACAACAACCCCCTGGGAGTGG - Intronic
904494410 1:30878581-30878603 TGGTCACTGCCCCCAGGCAGAGG + Intronic
904795817 1:33055602-33055624 TGTCCACAGGCCCCAGGCTGGGG - Intronic
904909947 1:33927229-33927251 AGTCCAAAGCCCCCAGGAAGAGG - Intronic
904945833 1:34198040-34198062 TGGGCACAGCCCCGAGGGACGGG + Intronic
905217329 1:36418102-36418124 CGTCCTCTGCCCCCAGGGAGAGG - Exonic
905352899 1:37359818-37359840 TTCCCACAGTCCTCAGGGAAGGG - Intergenic
905365542 1:37449201-37449223 TGCACACAGCTGCCAGGGAGTGG + Intergenic
905874647 1:41424062-41424084 GGCACACAGCCCCGAGGCAGCGG - Intergenic
906610083 1:47195380-47195402 TGTCCACAGCCCTCTGGGAAGGG - Intergenic
907396090 1:54190965-54190987 TTCCCACTGTCCCCAAGGAGAGG + Intronic
907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG + Intronic
907472815 1:54685456-54685478 GGCCCAGAGGCGCCAGGGAGTGG + Intronic
907476793 1:54711195-54711217 TGCACACAGCCCAGAGAGAGAGG + Intronic
908435754 1:64104258-64104280 TGCCCACAGCACCTAGGGTGTGG - Intronic
909585287 1:77282123-77282145 AGACCACAGCCCCCGGGGAGAGG + Exonic
910768618 1:90808405-90808427 TGGCCACAGCCCCATTGGAGAGG + Intergenic
911751206 1:101500040-101500062 TGCCCAAAGCCCCATTGGAGGGG + Intergenic
912391737 1:109307503-109307525 TGCCCGCTGCCCCCGGGGAGCGG - Intergenic
912913623 1:113789161-113789183 TACCCCCAACCTCCAGGGAGGGG + Intronic
914310073 1:146458652-146458674 TGACCACAGCCCCCGGGGCTTGG - Intergenic
914460415 1:147878366-147878388 TCCCCAGAGCCTCCAGGGTGAGG + Intergenic
915004359 1:152622982-152623004 GGCCCACAGCCCCCAGAGCTTGG + Exonic
915087190 1:153396825-153396847 TCCCCACTGCCCACTGGGAGGGG + Intergenic
915279908 1:154815262-154815284 TGCCCAAACCCCCCAGGTAGGGG - Intronic
915437535 1:155919929-155919951 TGCTCACAGCCCACAGGTAAGGG + Intronic
915598018 1:156906374-156906396 TGGCTACTGACCCCAGGGAGTGG + Intronic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916863944 1:168836462-168836484 TTCCCACAGCCACCAAGGAAAGG + Intergenic
918873386 1:190006588-190006610 TTTCCACAGACCACAGGGAGTGG - Intergenic
919437531 1:197580533-197580555 TGCCCCCAGACCTCAGGAAGAGG - Intronic
919743135 1:200992438-200992460 GGCCCACACTCTCCAGGGAGGGG + Intronic
919791940 1:201297347-201297369 GCCCCACAGACCTCAGGGAGAGG + Intronic
919804879 1:201375645-201375667 TACCCAAAGCCCCAGGGGAGCGG + Intronic
919821609 1:201476513-201476535 AGCCCCCAGCTCCCAGGGAGAGG - Intergenic
920341754 1:205279557-205279579 TTCCCACAGCCCCCAGGGCTTGG - Intergenic
922350898 1:224733899-224733921 TGGCCACAGCCCCTGAGGAGGGG - Intronic
922905238 1:229169018-229169040 CCTCCTCAGCCCCCAGGGAGGGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923671217 1:236042907-236042929 TCCCCACTGCCTCCAGGGAGGGG + Intronic
1062800892 10:379438-379460 TGCCCACAGCCCACTGGCTGTGG - Intronic
1063048940 10:2424382-2424404 AGCCCACAGATCCCAGGAAGAGG - Intergenic
1063364600 10:5482029-5482051 TGATCACAGGCTCCAGGGAGAGG - Intergenic
1064392466 10:14953857-14953879 AGCCCCCAGCGCCCCGGGAGCGG + Intronic
1065424256 10:25582557-25582579 AGCCCCCAGCTCCTAGGGAGTGG + Intronic
1065968095 10:30784990-30785012 TCCCCAGAGCGCGCAGGGAGCGG + Intergenic
1066107785 10:32170715-32170737 TGCCCAGGGTCCCCAGTGAGAGG + Intergenic
1067716460 10:48694511-48694533 AGCTCACAGCCTCCTGGGAGAGG - Intronic
1068657647 10:59591608-59591630 TGACCTCAGGCCCCTGGGAGGGG - Intergenic
1068910670 10:62374973-62374995 AGCCCCCGGCCCCCAGAGAGGGG - Intronic
1069550498 10:69360664-69360686 TGCCCACAGCCCCTTGGGCAGGG - Intronic
1069568365 10:69478947-69478969 TGCCCACATCCCACATGGAAGGG + Intronic
1069918084 10:71799320-71799342 TGCCCAAAGACCCCAAGGAATGG - Intronic
1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG + Intronic
1070813232 10:79308740-79308762 TGCCCTCAGGGCCCAGGAAGGGG - Intronic
1071240439 10:83699099-83699121 TCCCCACATCCACCAGCGAGTGG - Intergenic
1071289335 10:84177186-84177208 TGTCCCCAGGCCTCAGGGAGAGG - Intronic
1072488171 10:95875887-95875909 TTCCCACAGGACCCAGGGGGAGG - Exonic
1072619354 10:97069291-97069313 TGCCCACAGGCACCAGTGACCGG + Intronic
1072781725 10:98256034-98256056 TGAGCACAGCCCCCAGGGAGAGG - Intronic
1074021910 10:109593401-109593423 TGGTGACAGCCCACAGGGAGTGG + Intergenic
1074121321 10:110496337-110496359 TGCCCCCAGCCCAGAGGGAAGGG - Intergenic
1075345321 10:121677956-121677978 TGGCCACTGCCCCTGGGGAGGGG + Intergenic
1075726190 10:124612062-124612084 TGCCCACAGCCCCTAGGATGAGG + Intronic
1076719575 10:132387248-132387270 ACCCCAAAGCCACCAGGGAGGGG - Intergenic
1076779609 10:132717000-132717022 TGCCCCCAGCCCCAAGGCTGAGG + Intronic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1077067118 11:646542-646564 TCTGCACAGGCCCCAGGGAGTGG - Intronic
1077104878 11:837859-837881 TGCCTCCAGCCTCCAGGGTGTGG - Intronic
1077535734 11:3123066-3123088 TGCCCACGGCTCCCAGGGGATGG - Intronic
1078083746 11:8221501-8221523 TGCCCACATGCCCCAGGCTGAGG + Intergenic
1078099885 11:8323738-8323760 TGCCCACAGCTTCTAGGGTGGGG + Intergenic
1078256574 11:9663994-9664016 CGCCCACAGCCGCCAGAGTGTGG - Intergenic
1078699487 11:13668018-13668040 GGCCCACAGTCCCCTGGGACTGG + Intergenic
1079127624 11:17730285-17730307 CTCCCACAGCCTGCAGGGAGAGG + Intergenic
1079152983 11:17918152-17918174 TACCCACAGGCACCATGGAGTGG - Intronic
1079752156 11:24212925-24212947 TGCCCACAGACCCCTGGCTGGGG - Intergenic
1080407867 11:31995845-31995867 TGCCCAGAGCTCCTTGGGAGGGG - Intronic
1080663284 11:34314556-34314578 TGCACACAGCTGCAAGGGAGAGG + Intronic
1083201172 11:61121911-61121933 TGGCCACAGCCCACAGTGGGTGG + Intronic
1083223497 11:61268884-61268906 TGCCCCAAGCCCCCAGGGCAGGG - Intronic
1083224345 11:61275221-61275243 TTCTCACAGCCTCCAGGGGGTGG - Intronic
1083631008 11:64095528-64095550 AGCCTCCAGCCCCCAGGGACAGG - Intronic
1084110379 11:67010494-67010516 TGGGCACAGAGCCCAGGGAGGGG - Intronic
1084533529 11:69743369-69743391 TGTCCACTGCCCACAGGGACTGG + Intergenic
1084603224 11:70158838-70158860 AGCCCCCAGCCCCCACCGAGGGG - Intronic
1084721192 11:70906720-70906742 TGCCCAAAGACCCCAGGGCCTGG + Intronic
1084974684 11:72790261-72790283 TGCCCACAGCCACATGGGAGGGG - Intronic
1085352752 11:75810587-75810609 TAGACACAGCCCCCAGAGAGGGG - Intergenic
1085521957 11:77144328-77144350 TGCCCAGAGCCCCCAGGGTGGGG + Intronic
1085963984 11:81498439-81498461 CAGCCACAGGCCCCAGGGAGAGG + Intergenic
1087012156 11:93524517-93524539 TGTCCAGTGCTCCCAGGGAGTGG - Intronic
1089366695 11:117924952-117924974 TGCCCCCCACCCCCAGGGCGAGG - Intronic
1089466486 11:118689532-118689554 AGCCCACAGCCCCCACTGAGAGG - Intergenic
1090408230 11:126490311-126490333 TGGACACAGCCGCTAGGGAGAGG + Intronic
1091888297 12:4032165-4032187 CGCCCACAGGCCCCAGGAAGGGG - Intergenic
1092683432 12:11014960-11014982 TGCTCACAGGCACCAGGGAGAGG + Intronic
1092687698 12:11070143-11070165 TGGTCACAGGCGCCAGGGAGAGG + Intronic
1092912929 12:13164280-13164302 TTCCAACAGCCCTCAGAGAGGGG - Intergenic
1092950894 12:13501963-13501985 TGGCCACAGCCCCCAGAGTCTGG + Intergenic
1093516306 12:19990679-19990701 TGCTCACAGGCTCCAGGGACGGG - Intergenic
1096547818 12:52353108-52353130 TTCACACAGCCTGCAGGGAGAGG - Intergenic
1096743783 12:53712717-53712739 TGACCATGGCCCCCAGGGATAGG - Intronic
1096842060 12:54385686-54385708 TGCCTGCTGCCCCCAGGCAGTGG + Intronic
1097967423 12:65595856-65595878 AGCCCACACCACCCAGGGAGAGG + Intergenic
1100091974 12:90983883-90983905 TGCCCAAAGCCCCATTGGAGGGG + Intronic
1101588036 12:106101984-106102006 TGCTCCCAACCCCCAGGGAAGGG + Intronic
1102204733 12:111082777-111082799 TGCTCAGGGCCCCCAGGGTGTGG - Intronic
1102531205 12:113547723-113547745 TGTCCCCAGACCCCAGAGAGGGG + Intergenic
1103042818 12:117709870-117709892 TGCCCGCTGTCCCCTGGGAGGGG + Intronic
1103379348 12:120481734-120481756 TTCCCCCAACCTCCAGGGAGGGG - Intronic
1103597900 12:122035252-122035274 TGCTCAGAGCCCCTGGGGAGTGG - Intronic
1103894050 12:124261658-124261680 TGTCCACAGGTCCCAGGGTGAGG + Intronic
1103915717 12:124374630-124374652 TGGCCAGAGCCCAGAGGGAGAGG - Intronic
1103915952 12:124375867-124375889 TTTCCACTGCCCCCGGGGAGGGG + Intronic
1103926153 12:124424473-124424495 TGCCCACAGCACCGAGTGAGTGG - Intronic
1104030994 12:125065674-125065696 CGCCCACAGCCGCCCGGAAGCGG - Exonic
1104581827 12:130016400-130016422 ATCCCACCCCCCCCAGGGAGTGG + Intergenic
1104948761 12:132429338-132429360 TTCCCACAGGCCCCATGGAAAGG - Intergenic
1104961993 12:132492653-132492675 TGCCCCCAGCCTGCAGGCAGTGG + Intronic
1106920847 13:34561757-34561779 TGTCCACAGATCCCAGGGATTGG - Intergenic
1107717723 13:43217116-43217138 TGCCCACCTCCACCAGGGAGAGG + Intronic
1108623520 13:52206170-52206192 TTCCCACAGCCCCAAGGGGATGG + Intergenic
1110736350 13:78941546-78941568 TGCCGGCAGCCCCCAGGAACTGG + Intergenic
1111076726 13:83246797-83246819 TATGCACAGTCCCCAGGGAGAGG + Intergenic
1112171018 13:96971728-96971750 TGAACACAGGCACCAGGGAGAGG - Intergenic
1112436503 13:99394505-99394527 TACTCACAGCTCCCAAGGAGAGG - Intergenic
1113493913 13:110713560-110713582 AGCCCGCAGCCCCCAGGGCCTGG + Intronic
1113513208 13:110872161-110872183 TGCTCACCCCCCGCAGGGAGAGG - Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113737613 13:112689854-112689876 TGCCCTCTGCCCCCAGGGTCTGG + Intergenic
1113853463 13:113431084-113431106 GGCCCACAGCCACCTAGGAGAGG + Intronic
1114126243 14:19729801-19729823 TCCCCAAAGCCCACTGGGAGAGG - Intronic
1114528384 14:23380143-23380165 GGCCCACAGGACGCAGGGAGAGG + Intergenic
1117191050 14:53292223-53292245 TGACCACAGCACCAAGAGAGTGG - Intergenic
1117546598 14:56798420-56798442 GGCCCACAGCGCCCTGGGACCGG + Intergenic
1117912510 14:60648868-60648890 TGCCCACGGCGCCCAGGGGTCGG + Exonic
1118734463 14:68691600-68691622 AGCCCACAGCACCCCAGGAGGGG - Intronic
1119666986 14:76491777-76491799 TGCCCACAGGCCCCAGGGATGGG - Intronic
1121815576 14:96925647-96925669 TGCCCTCTGGCCTCAGGGAGGGG - Intronic
1122257260 14:100487935-100487957 TGCCCTAAGATCCCAGGGAGAGG - Intronic
1122266282 14:100548429-100548451 TACCCACAGCCCTCGGGAAGAGG + Intronic
1122544874 14:102516862-102516884 TGCCGACCGCCCTCGGGGAGAGG + Intergenic
1122603363 14:102932044-102932066 TGCCAGCAGCCCCAAGGGACAGG - Intronic
1122821081 14:104345525-104345547 AGCCCTGAGCCTCCAGGGAGAGG + Intergenic
1125259057 15:37801373-37801395 TACTCAGAGCCCACAGGGAGGGG + Intergenic
1125731974 15:41897601-41897623 TCTCCCCAGCTCCCAGGGAGGGG - Exonic
1126406416 15:48327427-48327449 TGCCCAAACCTCCCATGGAGAGG - Intergenic
1126523962 15:49629602-49629624 TGCTCAGAGACCCTAGGGAGAGG + Intronic
1127730607 15:61798619-61798641 CTTCTACAGCCCCCAGGGAGGGG - Intergenic
1127875202 15:63106105-63106127 TGCCCACAACCCCCAATGGGAGG + Intergenic
1128577168 15:68784038-68784060 TTTCCAAAGCCCCCAGGGAGTGG - Intronic
1129693688 15:77728501-77728523 TCCTCCCAGCCTCCAGGGAGGGG + Intronic
1129730963 15:77932619-77932641 TGCCCACTGCCTGCAGGTAGGGG - Intergenic
1131153698 15:90062326-90062348 TGCCCTCGGTCCCCAGGGTGGGG - Intronic
1131841339 15:96441136-96441158 TGACTAGAGCCCCCAGGCAGTGG + Intergenic
1131853692 15:96569585-96569607 TCCCCACAGCCCTCCGTGAGGGG + Intergenic
1131994464 15:98120679-98120701 TGCAGGCTGCCCCCAGGGAGTGG + Intergenic
1132383783 15:101385391-101385413 TGCCCACAGCAACCAGGAACGGG + Intronic
1132656525 16:1043919-1043941 TGCCCACTGCCCCCAGGCCTGGG - Intergenic
1132668861 16:1094652-1094674 ACCCAACAGCCCACAGGGAGTGG - Intronic
1132872830 16:2123321-2123343 GTCCCCCAGCCCCCAGGGTGTGG + Intronic
1133087526 16:3376394-3376416 TGGTCACTGCCCCAAGGGAGAGG - Intronic
1133121492 16:3611401-3611423 GGCCCGCAGCCCCGACGGAGAGG - Intronic
1133150633 16:3826470-3826492 TGCCCACAGCCACCTGGTTGAGG - Intronic
1133229912 16:4361519-4361541 TGCCCGCAGCCCCTGGGGACTGG - Intronic
1134551918 16:15142500-15142522 GTCCCCCAGCCCCCAGGGTGTGG + Intergenic
1134676656 16:16095376-16095398 TGCCAACTGTCCCCAGGGTGGGG - Intronic
1136220175 16:28823427-28823449 CGGCCACAGGCCCCAGGCAGGGG - Exonic
1136610336 16:31362080-31362102 TCCCCACAGCCCCCAGAACGGGG - Exonic
1136617985 16:31410400-31410422 TCCCCACAGCCCCCAGGAAGAGG - Exonic
1137319626 16:47367366-47367388 TCCCCACAGCCTCCAGGAATGGG - Intronic
1137719928 16:50621929-50621951 TGGGCACAGCCCGCATGGAGGGG - Intronic
1137988811 16:53131535-53131557 GGCCCACAGCCCCCGGGGTCGGG + Intronic
1138510174 16:57504091-57504113 TGCCCTCAGTCCCAAGGGACAGG - Intergenic
1139354774 16:66361041-66361063 TGACCACAGCCCACAGGAGGTGG + Intergenic
1139690533 16:68638835-68638857 AGCACACAGCGCCAAGGGAGGGG + Intronic
1141296560 16:82775093-82775115 TGCTCACAGTCCCAAGTGAGTGG - Intronic
1141552550 16:84815873-84815895 TCTCCACTGCCCCCAGAGAGTGG + Intergenic
1141558820 16:84853532-84853554 TGCCCACAGGCCCCTCGGTGAGG + Intronic
1141702630 16:85649585-85649607 GGCGCACAGGCCCCAGGCAGCGG - Intronic
1141840522 16:86571432-86571454 TGCCCACGTTCCCCAAGGAGTGG - Intergenic
1142175493 16:88643257-88643279 CGCCCACCGGCCCCAGGCAGAGG + Intergenic
1142233112 16:88909047-88909069 TGACCACAGGCCCCAGGCAGGGG + Intronic
1142286270 16:89172742-89172764 TGGCTTCAGCCCCCAGGGACTGG + Intronic
1142317309 16:89355998-89356020 TCGCCTCAGCCCCCAGGGCGGGG - Intronic
1143608109 17:8002693-8002715 GGCCCACGGCCCCCGGTGAGGGG - Exonic
1144026630 17:11282559-11282581 TGCCGACAGGCCCCAGTGTGTGG + Intronic
1144573478 17:16415281-16415303 TGTGGACAGCCCCCAGGGAGAGG - Intergenic
1144836573 17:18159506-18159528 TGGCCAAGGCTCCCAGGGAGGGG + Intronic
1144962271 17:19051594-19051616 TGCCCCCAGCTCCCAGTGGGAGG + Intergenic
1144972890 17:19122926-19122948 TGCCCCCAGCTCCCAGTGGGAGG - Intergenic
1145786645 17:27598042-27598064 TCCCCACAGACACCAGGCAGTGG - Intronic
1146687226 17:34849252-34849274 TGCCCACAGCACACAGAGTGGGG - Intergenic
1146949091 17:36893370-36893392 AGCCCAGAGCTCCCAGGGAATGG + Intergenic
1146949846 17:36898323-36898345 AGCCCAGAGCTCCCAGGGAATGG - Intergenic
1147163079 17:38578986-38579008 CGCCTACGGCCCCTAGGGAGGGG + Intronic
1147323271 17:39658558-39658580 TACCCACAGCCCCAAGAGAGGGG + Intronic
1147427675 17:40353889-40353911 TGCCTACAGCTCCCAGGATGAGG - Intronic
1147686428 17:42289058-42289080 GGCCCACAGGCCCCCTGGAGAGG - Intronic
1147870330 17:43582606-43582628 TGCTCACTGCCCCCAGTGATTGG + Intergenic
1147979313 17:44264991-44265013 TCCCCACAGCCCCCAGTGCTCGG - Intronic
1147979335 17:44265050-44265072 TCCCCACAGCCCCCAGTGCTCGG - Intronic
1148145306 17:45360948-45360970 TGGCAACAGCCCCCACAGAGGGG - Intergenic
1148199363 17:45739851-45739873 TTCCTGCAGGCCCCAGGGAGGGG + Intergenic
1148291976 17:46460173-46460195 TGCCCATGGCCCCTAAGGAGGGG + Intergenic
1148314166 17:46677864-46677886 TGCCCATGGCCCCTAAGGAGGGG + Intronic
1149020887 17:51962683-51962705 TGGTCACACCCCACAGGGAGTGG + Intronic
1149656372 17:58311539-58311561 TGCCCACTGTACCCTGGGAGTGG - Intronic
1150467113 17:65403152-65403174 CCTCCACAGACCCCAGGGAGGGG + Intergenic
1151305966 17:73262813-73262835 TGCCCAAACCCAGCAGGGAGAGG + Intergenic
1151665095 17:75541226-75541248 TGCCTGCAGACTCCAGGGAGGGG - Intronic
1151924671 17:77186262-77186284 GACCCACAGCCCCCAGGGGAGGG - Intronic
1152255947 17:79239560-79239582 TGCCCACTGCCCCCAGGAGACGG + Intronic
1152278006 17:79369317-79369339 TGCCCCCACTCCCCGGGGAGGGG + Intronic
1152570192 17:81118293-81118315 TGCCAACAGCCACCAGGACGTGG + Exonic
1152651049 17:81493113-81493135 GGCCTGCAGCCCCCAGGGAATGG - Intergenic
1152684514 17:81687487-81687509 TGGCCACATCCCACAGGCAGGGG + Intronic
1152756821 17:82090486-82090508 AGGCCACCTCCCCCAGGGAGTGG + Exonic
1152827944 17:82479285-82479307 TGCCCTCAGCCTCCAGGCACAGG - Intronic
1152898736 17:82928201-82928223 TGCCCAGTGCCCCCAGGACGAGG + Intronic
1154133899 18:11759765-11759787 TGCACACATCTCCCAAGGAGAGG - Intronic
1155229480 18:23758556-23758578 TAGCCTCAGCCCCCAGGGAGAGG - Intronic
1157331172 18:46704871-46704893 TGCCTACACTCCCAAGGGAGTGG - Intronic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1157712324 18:49858516-49858538 GCCCCCCACCCCCCAGGGAGGGG + Intronic
1157888477 18:51391823-51391845 TGCCCACAGTCCCCTCAGAGGGG + Intergenic
1158649239 18:59272219-59272241 TGCCCAGAGTCTCAAGGGAGAGG - Intronic
1160024070 18:75204634-75204656 TCCCCACCGCCACCACGGAGAGG + Intronic
1160429017 18:78798920-78798942 TGCCCACAGCCTGCAGTGGGAGG + Intergenic
1160662144 19:306186-306208 TGCCCACGACCCCCAGGGCTGGG + Exonic
1160691772 19:463666-463688 GGGTCACAGCCCCCAGGGACTGG + Exonic
1160803098 19:979604-979626 AGCCCGCCGGCCCCAGGGAGAGG + Intergenic
1160914702 19:1491023-1491045 TGCCCAGACCCCGCCGGGAGAGG - Exonic
1160982677 19:1823529-1823551 TGCCCACGGCCCCCCGGCACAGG + Intronic
1161456823 19:4373780-4373802 TCCCCACGGCCCCCAGGCTGTGG + Intronic
1161468548 19:4445304-4445326 TCCCCACAGCCCCCAAGGGATGG + Exonic
1161527449 19:4765555-4765577 TGCCCAAGGACCACAGGGAGAGG - Intergenic
1161697223 19:5776120-5776142 TGCCCACTGGCCCTAGGGACTGG - Intronic
1162479718 19:10921240-10921262 GGCCGAGAGCCCCCAGGAAGAGG - Intronic
1162866669 19:13553177-13553199 ACCCTTCAGCCCCCAGGGAGTGG - Intronic
1162925023 19:13926576-13926598 TGCCCACACCCCCAGGTGAGGGG + Exonic
1162979286 19:14228284-14228306 CGCTCACAGCCGCCGGGGAGAGG + Intergenic
1163322828 19:16584569-16584591 TCCCCACTGCTCCCAGGGTGTGG - Intronic
1163364759 19:16869725-16869747 AGACCACAGACCCCAGTGAGCGG + Exonic
1163370668 19:16899603-16899625 TGACCACTGCCCCCAGGGGATGG - Intronic
1163534991 19:17871984-17872006 TGAGCACAGCGCCCAGGGAGAGG + Exonic
1163826099 19:19525796-19525818 TGCACACAGCTGCCAGGGACAGG - Intronic
1165020378 19:32919542-32919564 TGCTACCAGCACCCAGGGAGTGG + Intronic
1165068449 19:33241859-33241881 CCCCCACCGCCCCCGGGGAGGGG + Intergenic
1165232103 19:34393673-34393695 TGCCCACAGGACGCAGGGTGTGG + Intronic
1165364860 19:35359199-35359221 TGCTCACAGCTGCCAGGAAGAGG - Exonic
1165366679 19:35371668-35371690 TGCTCACAGCTGCCAGGAAGAGG - Exonic
1167435672 19:49477147-49477169 TGCACCCAGCCCTCAGAGAGAGG - Intronic
925004150 2:428157-428179 AGGGCACAGCCCCCAGGCAGAGG - Intergenic
925800940 2:7599725-7599747 TGCCCAGAGCGCACCGGGAGCGG + Intergenic
925867803 2:8244337-8244359 TTCCCAGAGCCCCCATGGTGAGG - Intergenic
927040467 2:19225527-19225549 ATCCCACTGCCCCCAGGCAGAGG + Intergenic
927478087 2:23429294-23429316 TGCCCACATGTCCCTGGGAGAGG + Intronic
927505297 2:23609449-23609471 TCCCCACAGCCCTCAGGATGTGG - Intronic
927874697 2:26647600-26647622 CTCCCACATGCCCCAGGGAGGGG + Intergenic
927964049 2:27258242-27258264 TGCCCACATCCGCCAGCAAGTGG + Exonic
929431448 2:41890793-41890815 CACCCACAGCCTCCAGGGAGGGG + Intergenic
929782265 2:44964800-44964822 GGAACACAGACCCCAGGGAGAGG - Intergenic
929788621 2:45008789-45008811 TGCCCACGGCGCCCAGGGGTCGG + Exonic
931203447 2:60123633-60123655 ACCCCACAGTCACCAGGGAGAGG - Intergenic
931267661 2:60674764-60674786 TTCCCACAGTCCCCAGGCATTGG + Intergenic
931364086 2:61603719-61603741 TGCTCACAGCCCCCTGGGAAAGG - Intergenic
932462565 2:71892527-71892549 AGCTCTCAGCCCCCAAGGAGGGG + Intergenic
932551574 2:72775224-72775246 TTCCCCCAACCTCCAGGGAGGGG - Intronic
934508457 2:94916576-94916598 AGCCCACAGGCATCAGGGAGGGG - Intergenic
934553769 2:95277027-95277049 TGCCCACGGCCGCCAGCAAGGGG - Exonic
934854078 2:97718256-97718278 TGACCCCAGACCCCAGGCAGGGG - Intronic
935303531 2:101715202-101715224 TGGACACAGACACCAGGGAGGGG - Intronic
936548290 2:113411959-113411981 TGCCCACACCTCTCAGAGAGAGG + Intergenic
936614313 2:114033047-114033069 TGCCCCCAACCCCCATGGTGTGG + Intergenic
937025346 2:118692960-118692982 TCCCCTCAGCCTGCAGGGAGAGG + Intergenic
937298429 2:120823758-120823780 TGCCACAAGCTCCCAGGGAGTGG - Intronic
937361221 2:121231482-121231504 GGGCGACAGTCCCCAGGGAGAGG - Intronic
937980516 2:127611972-127611994 GGTCACCAGCCCCCAGGGAGGGG - Intronic
937993906 2:127679220-127679242 TCTACACAGACCCCAGGGAGGGG - Intronic
938135872 2:128755989-128756011 TCCCCACAGCCCACAGGATGGGG - Intergenic
938406292 2:131035010-131035032 GGCCCGCAGCGCCCGGGGAGAGG - Intronic
944310216 2:198224843-198224865 TGCCCCCATCCCCCAGGGGCTGG + Intronic
945025082 2:205612866-205612888 TGCTCACAGCTCACAGTGAGGGG - Intronic
945067567 2:205960049-205960071 TCCACACACCCCACAGGGAGAGG + Intergenic
945887973 2:215397150-215397172 TGCTCACAGTCTCCTGGGAGAGG - Exonic
946229344 2:218282059-218282081 TGCCCATAGCCCCCAGGGGGCGG + Exonic
946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG + Intergenic
946693998 2:222333719-222333741 TGTCCTCAGGCCCCTGGGAGGGG - Intergenic
947525372 2:230874046-230874068 TGCCCAGGTCCCCCGGGGAGGGG - Intronic
947793163 2:232879158-232879180 TGCCCCTGGCCCCCAGGGACTGG - Exonic
947856324 2:233326895-233326917 GGCCCAAAGCCCCCAGAGGGAGG - Intronic
948099179 2:235359881-235359903 TCCCCACAGCCCTCTGGAAGGGG + Intergenic
948439592 2:237978240-237978262 TGCCCACAGCCCTCACTGAGGGG + Intronic
948593645 2:239066248-239066270 TGCTCTGAGCCCCCAGGGACAGG - Intronic
948811867 2:240482456-240482478 AGTCCACAGGCTCCAGGGAGGGG + Intronic
948908419 2:240991069-240991091 GGTCCACAGCTCCCAAGGAGAGG - Intronic
1168997964 20:2146724-2146746 TGGCTACAGCCCTCAGGAAGAGG - Exonic
1169073241 20:2746501-2746523 TGCCACCAGCTCCCAAGGAGGGG + Intronic
1169075941 20:2759852-2759874 TGCCCAAAGCCCCCACAGGGAGG - Exonic
1169142557 20:3234513-3234535 TCACCTCAGCCCCCAGGTAGAGG + Intronic
1170749613 20:19133863-19133885 TGCCCACTGTCTCCAGTGAGTGG - Intergenic
1171210301 20:23311222-23311244 TTCCCACAGAGCCCGGGGAGGGG + Intergenic
1171372506 20:24670649-24670671 TGCCCAGGGCTCCCAGGGTGGGG + Intergenic
1171372528 20:24670714-24670736 TGCACAGAGCTCCCAGGGTGGGG + Intergenic
1172390940 20:34564912-34564934 AGCACCCTGCCCCCAGGGAGAGG + Intronic
1172488055 20:35311302-35311324 TTCCCAAAGCGTCCAGGGAGGGG + Intronic
1172799252 20:37564686-37564708 CGCCCAGAGCCCCCAGGAAGGGG + Intergenic
1174201586 20:48809898-48809920 TGCCCACAGGCCACAGGAAGTGG + Intronic
1174378511 20:50141731-50141753 TGTCCCCTGCCCCCAGGGATGGG - Intronic
1174390568 20:50216223-50216245 TCCCCACAGCCTCCAGGCTGGGG - Intergenic
1174450344 20:50616220-50616242 GGCACACAGCCCCCAGTGTGAGG - Intronic
1174840311 20:53895166-53895188 TGCTCTCAGCCCCCATGAAGTGG - Intergenic
1175234997 20:57503653-57503675 TCCCCACAGGCCCCTGAGAGGGG - Intronic
1175384775 20:58587185-58587207 TGCCTACAGCCCGAGGGGAGAGG - Intergenic
1175687634 20:61043313-61043335 CGCCCACTGCCCTCAGGGAGCGG + Intergenic
1175734100 20:61373268-61373290 TGCCCTCAGCCCTCACCGAGAGG - Intronic
1176100405 20:63361907-63361929 GGCGCACGGTCCCCAGGGAGGGG + Intronic
1176232627 20:64039913-64039935 GGCCCCCAGCCTCCAGGCAGGGG - Intronic
1176293454 21:5058577-5058599 TGCCTGCAGCCCCCAGGGACGGG - Intergenic
1178361341 21:31950878-31950900 GGTCCAAAGCCTCCAGGGAGGGG - Intronic
1178582949 21:33851235-33851257 TGCCCATAGCCCCCAGTGTATGG + Intronic
1178913243 21:36693136-36693158 CGCGCACACCCCCCAGGTAGGGG - Intergenic
1179243037 21:39608831-39608853 TTTCCTCAGCCCCCTGGGAGGGG + Intronic
1179497272 21:41780513-41780535 TGAGCACAGTCCACAGGGAGGGG + Intergenic
1179584866 21:42368008-42368030 TGACCGCAGGACCCAGGGAGGGG + Intergenic
1179863806 21:44205071-44205093 TGCCTGCAGCCCCCAGGGACGGG + Intergenic
1179878520 21:44283770-44283792 TCCCCACAGCCTCAAAGGAGAGG + Intergenic
1179893285 21:44348539-44348561 GGCCCACATCGCCCTGGGAGCGG - Intergenic
1180159742 21:45993682-45993704 AGCGCACAGCCCCCGTGGAGGGG + Intronic
1180703236 22:17793094-17793116 CGCCCACGGCCGCCAGGCAGGGG + Intronic
1180836847 22:18934233-18934255 TCCCCACAGCCCAGAGGGTGAGG + Intronic
1180938868 22:19643906-19643928 TCCCATCAGCCCCCAGGGTGGGG + Intergenic
1181577745 22:23806234-23806256 TTCCTACAGCCCTCAGGAAGAGG + Intronic
1182266437 22:29119424-29119446 CCCCCACATCCTCCAGGGAGAGG - Intronic
1183161584 22:36117185-36117207 GGCCCACAGGCCCCTGGGAGAGG - Intergenic
1183187598 22:36300823-36300845 TGCCCGCTGCACCCGGGGAGGGG - Intronic
1183303470 22:37069861-37069883 TCCCCACTGCCCTCAGGTAGAGG - Intronic
1183365051 22:37402581-37402603 TGCCCACAGTTCCCAAGGAAGGG + Intronic
1183527875 22:38334760-38334782 TGCTCCCAGCCCACAAGGAGCGG + Intronic
1183708833 22:39490832-39490854 TGGCCACAGGCCCGAGGAAGAGG - Exonic
1183858549 22:40652788-40652810 TGCCCACACCTCCCAGGTGGGGG - Intergenic
1184068560 22:42134603-42134625 TGGCCACAGCTCGCAGGGAATGG - Intergenic
1184389041 22:44192546-44192568 TGGCCACACCCCCCAGTGGGTGG - Intronic
1184748848 22:46472775-46472797 GACCCCCAGCCCCCAGGGAAAGG - Intronic
1184866225 22:47203112-47203134 TACCCACAGCCTCCAGCGTGGGG + Intergenic
1184878655 22:47291304-47291326 TCCACACAGCCCCCTGGGATGGG + Intergenic
1185041747 22:48507782-48507804 TCCCGACAGCTCCCAGGCAGGGG - Intronic
1185165314 22:49258305-49258327 CGGCCACAGCCCCCAGTGGGAGG + Intergenic
1185249775 22:49794634-49794656 AGCACACAGACCCCAGAGAGAGG + Intronic
1185267948 22:49914410-49914432 TTCTCCCAGCCCCCAGGGTGGGG - Intronic
1185343600 22:50302073-50302095 TGCCTGGAGCCCCGAGGGAGGGG + Intronic
1185366695 22:50440114-50440136 CTCCCACTGCCCCCAAGGAGGGG - Intronic
1203286940 22_KI270734v1_random:159532-159554 TCCCCACAGCCCAGAGGGTGAGG + Intergenic
951071797 3:18337638-18337660 TCCCCAGTGTCCCCAGGGAGTGG - Intronic
951786966 3:26432078-26432100 TGCTTACATCCCCCAGTGAGTGG - Intergenic
952160873 3:30691714-30691736 TCCCCACAGCTTACAGGGAGGGG - Exonic
952886800 3:38017274-38017296 TGCCCATAGACCCCAGGGCTGGG - Intronic
952964735 3:38614147-38614169 TGCCCCCACCCCCGTGGGAGGGG - Intronic
953718670 3:45336697-45336719 TGACCGCAGCACCCATGGAGTGG - Intergenic
954200753 3:49021895-49021917 TGCCCATAGTCCCGGGGGAGTGG - Exonic
954460327 3:50622970-50622992 TGCCCACTGCTCCAAGGGTGAGG + Intronic
954624882 3:52016897-52016919 GTCCCAGAGCACCCAGGGAGGGG - Intergenic
954712997 3:52514177-52514199 TGCCCTGGGCCTCCAGGGAGCGG - Exonic
954803351 3:53200418-53200440 GGCCCAAAGCCCACAGTGAGAGG - Intergenic
954807623 3:53229606-53229628 TGCCCTCGGACCCCAGGGAGGGG - Intronic
955019925 3:55110061-55110083 TGACCACAGTCCACAGGGATTGG - Intergenic
957517182 3:81270448-81270470 TGCACAAAGGCACCAGGGAGAGG - Intergenic
959420214 3:106119108-106119130 TGCCCACAGCCCCAACAGAGTGG - Intergenic
960376054 3:116902944-116902966 TGCTCACAGCCCCCAGGGTCTGG - Intronic
961208552 3:125107596-125107618 TGCCCGCTGCCTCCTGGGAGGGG - Exonic
961477793 3:127159416-127159438 AGCCCATAGGCCACAGGGAGGGG - Intergenic
961651745 3:128420426-128420448 AGCCCACAGCCTCCCAGGAGAGG + Intergenic
961695566 3:128701746-128701768 TGACCACAGCCATCAGGAAGTGG + Intergenic
961832978 3:129633924-129633946 CCACCACAGCCCCCAGGGCGGGG - Intergenic
963023790 3:140898931-140898953 TGCCCATTGCCCACTGGGAGAGG - Intergenic
966661127 3:182416133-182416155 TGCCATCAGCCCACAGAGAGAGG + Intergenic
966864320 3:184248775-184248797 TGCCCACCTCCGCCAGGCAGAGG + Exonic
967479252 3:189955446-189955468 TGCCCATCGCACCCAGGAAGTGG + Intergenic
968289278 3:197526253-197526275 TTCCCACAGCCCTCAGGGCTGGG - Intronic
968512773 4:1002811-1002833 CGCCCACCGCCCCCAGGGCCCGG + Exonic
968536414 4:1133274-1133296 TGCTCACAGCCCACAGTGTGTGG + Intergenic
968561578 4:1285984-1286006 TGCACTCAGCCCCCAGTGGGAGG + Intergenic
968659893 4:1794562-1794584 CGCCCTCGGCCCCCAGGCAGGGG - Intronic
968904986 4:3446885-3446907 GGACCACAGCTCCCAGGGTGGGG + Intronic
968920748 4:3521178-3521200 TTCCCCCAGCCCCCAGGAAAGGG - Intronic
969487316 4:7479534-7479556 TGCACACCGCTGCCAGGGAGAGG + Intronic
969846490 4:9924025-9924047 TGCCCACAGGTCACAGGGGGTGG + Intronic
970008896 4:11436917-11436939 TGTCCCCAGCCCCCAGGTTGTGG - Intergenic
971969849 4:33606592-33606614 GGGACACAGCTCCCAGGGAGAGG + Intergenic
972768270 4:42171743-42171765 TGCCCACAGACCCAAGTGTGGGG - Intergenic
974033839 4:56799977-56799999 TTCCCACAGCCATCAGGAAGAGG - Intergenic
975760286 4:77613446-77613468 TGCCCAGATCCCCCTGGGATTGG - Intergenic
980291903 4:130855195-130855217 TAGCCACAGCCCACAGGCAGGGG - Intergenic
981935064 4:150230406-150230428 CAAACACAGCCCCCAGGGAGAGG + Intronic
984860176 4:184230696-184230718 TGCCCTTAGCCCCCAGGAGGAGG + Intergenic
985412110 4:189695910-189695932 TGCCCACAAGCCCCGGGCAGTGG - Intergenic
985527555 5:414956-414978 TGCCCACAGGGCCCAGGCGGGGG + Intronic
985548483 5:521659-521681 TGCCCACAGCCCCCGGACTGGGG - Intronic
985627759 5:998721-998743 GGCCCTCAGCTCCCAGGAAGAGG + Intergenic
985631257 5:1015255-1015277 TGCCCACAGCCTCCCTGGCGTGG + Intronic
985874096 5:2582269-2582291 TGCCCACAGTCCCTGGGCAGGGG + Intergenic
986148342 5:5102326-5102348 TGCTCAGGTCCCCCAGGGAGTGG + Intergenic
986691783 5:10319357-10319379 TGAACACAGGTCCCAGGGAGAGG - Intergenic
986730484 5:10631717-10631739 TGAACACAGGTCCCAGGGAGAGG - Intronic
987373202 5:17212024-17212046 TTCCTACAGACACCAGGGAGGGG - Intronic
987402893 5:17496448-17496470 GGCCCACAGCCTCCATGGAGAGG - Intergenic
987409691 5:17602776-17602798 GGCCCACAGCCTCCGTGGAGAGG - Intergenic
987411585 5:17620539-17620561 GGCCCACAGCCTCCGTGGAGAGG - Intergenic
989077112 5:37575473-37575495 TACCCCCATCCTCCAGGGAGAGG + Intronic
989170100 5:38465295-38465317 TGAACACTGCCCCCAAGGAGGGG + Intergenic
990368107 5:55090171-55090193 TGCCCAAAGCCCCACTGGAGCGG - Intergenic
990655521 5:57950509-57950531 AGCCCACAGATCTCAGGGAGGGG - Intergenic
992828017 5:80569252-80569274 TGCCCACAGCCGCTGCGGAGCGG + Intronic
993454918 5:88116608-88116630 TTCCCACAGCCTCCAGGTAGAGG - Intergenic
993836256 5:92823665-92823687 TTCCCACAGCCCCCACTGACAGG + Intergenic
997129713 5:131264298-131264320 AGCCCACAGCCCGCAGCGCGCGG - Intronic
997210619 5:132074705-132074727 TGCCCCCAGCCCCCAGGAGTAGG - Intronic
997239896 5:132298821-132298843 TGCCCACTGTCCCCAGCCAGTGG - Intronic
997365606 5:133323386-133323408 GGCTCAAAGCCCCAAGGGAGGGG + Intronic
997580495 5:135013803-135013825 TGGGCACAGCCACCAGGGTGTGG + Intergenic
997676041 5:135714097-135714119 AGCCCAGCGCCCCCAGGGAATGG - Intergenic
999512927 5:152271633-152271655 TACCCACAGCTCTCAGAGAGAGG + Intergenic
999697915 5:154202758-154202780 TGACAACCGCCCCGAGGGAGGGG - Intronic
1000920213 5:167129160-167129182 TGCCCCCAGAACCCAGGAAGTGG + Intergenic
1001454167 5:171848143-171848165 TGCCCTCCGCCCCCAGGGCCTGG + Intergenic
1002327099 5:178416798-178416820 AGCACACAGCCCCCAGGGCAGGG + Intronic
1002543842 5:179925227-179925249 ACCCCCCAGCCTCCAGGGAGCGG + Intronic
1003474717 6:6470738-6470760 TGGCCAGAGCCCCCTGGGAGTGG - Intergenic
1003998347 6:11567016-11567038 TGGTCACAGGCACCAGGGAGAGG - Intronic
1004325467 6:14670443-14670465 TGCCAACAACCCACAGGGACAGG + Intergenic
1004351382 6:14893182-14893204 TGACCTCAGCCCCCAGGGCCAGG - Intergenic
1004545403 6:16593321-16593343 TTTCCATAGTCCCCAGGGAGGGG - Intronic
1005268357 6:24137143-24137165 TGAGCACAGCCCCCAGTGAGAGG - Intronic
1005483520 6:26277203-26277225 TCCCAACAGCTCCAAGGGAGTGG + Intergenic
1005599517 6:27412035-27412057 TGCCCACAGCCACCATGTTGCGG - Intergenic
1005845223 6:29771819-29771841 TGTCAACAGCACCCAGAGAGTGG - Intergenic
1005874729 6:30002276-30002298 TGTCAACAGCACCCAGAGAGTGG - Intergenic
1005999786 6:30955862-30955884 AGCCCCCAGCCCCCAGGGAGGGG + Intergenic
1006066254 6:31464487-31464509 TATCAACAGCCCCCAGAGAGTGG + Intergenic
1006305420 6:33215539-33215561 TGCTCCCAGCCTGCAGGGAGAGG - Intergenic
1006512520 6:34529293-34529315 GGCTCACAGGTCCCAGGGAGTGG + Intronic
1007108916 6:39301764-39301786 TGGCCACAGCCTTCAGGCAGAGG + Intronic
1007750335 6:44067303-44067325 TGCCCACTGCCCTCAGCTAGGGG + Intergenic
1007788436 6:44295392-44295414 GGACCACAGTCCCCAGGGAAAGG + Intronic
1010178440 6:73056249-73056271 TGACTAGAGCCCCCAGGCAGTGG - Intronic
1010269595 6:73904967-73904989 TGCCCAAAGCCCCAATGTAGTGG + Intergenic
1011434458 6:87322417-87322439 AGCCCGCAGACCCCAAGGAGGGG + Intronic
1012474915 6:99607539-99607561 TGCCCTGAGCCCCCAGAAAGAGG - Intronic
1013471638 6:110471845-110471867 TATCTACAGCGCCCAGGGAGAGG + Intronic
1015819624 6:137246376-137246398 TGCCCCCAGTCCCCAGGCCGTGG - Intergenic
1017228564 6:152047832-152047854 TGGCCACAGGCCACAGGAAGAGG - Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1017869913 6:158478614-158478636 TGGCCACAGTCCCCAGGGGAGGG - Intronic
1017980591 6:159397961-159397983 TACACACAGCCCCCAGACAGAGG - Intergenic
1018284836 6:162226339-162226361 TATCCACAGCACCCAGGAAGGGG - Intronic
1018667890 6:166156264-166156286 TCCCCACAGCCCCCACAGTGGGG + Intergenic
1019179597 6:170177977-170177999 TGACCCCAGCACCCAGGAAGTGG + Intergenic
1019318825 7:405693-405715 CCCCCACACCCCCCATGGAGGGG + Intergenic
1019378954 7:711718-711740 TCCCCACAGACCCCCGGCAGGGG + Intronic
1019414681 7:921873-921895 TGCCAACGGCCCTCAGGGCGGGG + Intronic
1019428374 7:987763-987785 TGCCCACAGGACACACGGAGGGG - Intronic
1019486927 7:1293642-1293664 TCCCCGCAGCCCCCAGGGTCCGG - Intergenic
1019505144 7:1386807-1386829 TGGCCACAGCACCCAGGCAGCGG + Intergenic
1019552648 7:1610752-1610774 TGCCCCCACCCCCCAGGCTGCGG - Intergenic
1019610808 7:1935829-1935851 TGCAGACACCCCCAAGGGAGGGG + Intronic
1019667934 7:2261629-2261651 TGCCCACTCCCCCCAGGTGGAGG - Intronic
1019693618 7:2432257-2432279 TGCCCACAACTCCCAAGAAGAGG - Intronic
1026878803 7:73895079-73895101 TCCCCACAACCCCCAGGGAGGGG + Intergenic
1027129310 7:75579935-75579957 TGCTTACATCCCCCAGGGAAAGG + Intronic
1027236244 7:76299678-76299700 TGCCCACATCACAGAGGGAGAGG - Intergenic
1027363217 7:77430842-77430864 GAGCCACAGACCCCAGGGAGAGG + Intergenic
1029361173 7:100089451-100089473 TGCTCACCTCCCCCAGGCAGTGG + Intronic
1029734760 7:102459456-102459478 TGCCCACAGCCCCAAGGTCTGGG + Intronic
1030086033 7:105816573-105816595 TCCCCACAGCCCTCAGGGAAGGG + Intronic
1032087380 7:128891178-128891200 TGCCCGCAGTGCCCAGGTAGGGG - Exonic
1032152659 7:129443473-129443495 TGCCCACAGCCACAAAGCAGAGG - Intronic
1032256669 7:130302733-130302755 TACCCACTGACCCTAGGGAGTGG - Intronic
1033992101 7:147300865-147300887 TGCCCAGTGACCCCCGGGAGAGG - Intronic
1034338516 7:150338372-150338394 AGACCCCAGCCCCCAGGGAGAGG - Exonic
1034400250 7:150857266-150857288 TGCCCCTTGCCCCCAGGCAGCGG - Exonic
1034808078 7:154106068-154106090 TCTCCACAGCCCCCATGGAGAGG + Intronic
1035012294 7:155729970-155729992 TGCCCACAAAGCACAGGGAGAGG - Intronic
1035286707 7:157811428-157811450 TGCCAACAGCCACGATGGAGAGG - Intronic
1035861414 8:3032422-3032444 TGCCAACAGCCCCCACGGAATGG + Intronic
1036075102 8:5489911-5489933 CACCCACAGGCCCAAGGGAGAGG - Intergenic
1037710616 8:21352624-21352646 TGCGCACAGCCCTGAGGCAGGGG + Intergenic
1038421649 8:27437660-27437682 CTCCCACCGCCCCCAGGGAAGGG + Intronic
1039816632 8:41100416-41100438 TGCCCACACCCGCCAGCAAGAGG + Intergenic
1039821714 8:41140892-41140914 TGCACTCATCCCCCAGGAAGGGG + Intergenic
1039947099 8:42139795-42139817 TTCACCCAGCCCCCAGGGACGGG + Intergenic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1042612432 8:70613842-70613864 TGCCCACAGCAACCAGATAGAGG + Intronic
1043091165 8:75906386-75906408 TGATCACAGGCGCCAGGGAGAGG + Intergenic
1044812587 8:96079392-96079414 TGACCACAGCCACCAGGAAGTGG - Intergenic
1045250978 8:100483323-100483345 TGGCCACAGCCCCTAGAGAGGGG + Intergenic
1047953280 8:129953403-129953425 TGCCTAGAGCCCCCAGGTATTGG + Intronic
1048201638 8:132379518-132379540 TGCCCACATCCCACAAGGTGAGG + Intronic
1048252913 8:132882074-132882096 TGCCCACAGCAGCCTGGCAGGGG - Intronic
1048423724 8:134303317-134303339 TGCCCACAGCATCCAGAGTGTGG + Intergenic
1048477500 8:134756629-134756651 TGACCACAGTTCCCAGAGAGGGG - Intergenic
1048539590 8:135330719-135330741 TCCCCACAGCCCTTAGGCAGAGG + Intergenic
1048859144 8:138711026-138711048 TGTCCACAGCCCTCAGGATGAGG - Intronic
1049303292 8:141883212-141883234 TTCCCAGAGCCCCCAGGGCAGGG - Intergenic
1049312742 8:141942092-141942114 TGCCCAGAGCCCCCAGGGGTTGG - Intergenic
1049373843 8:142279884-142279906 TGCCCACGGTCCCCAAGGCGAGG - Intronic
1049397770 8:142409557-142409579 TGCCCTCATCCCCCAGGCTGGGG + Intergenic
1049462506 8:142736630-142736652 TGCCCTCAGCTCCCAGAGAGGGG + Exonic
1049569581 8:143362865-143362887 TGCCCAGAGTGGCCAGGGAGGGG - Intergenic
1049618744 8:143588405-143588427 AGCCCACAGCACCCAGAGGGAGG + Intronic
1049705337 8:144039590-144039612 TGCCCACTGCCCCCAGCCATGGG - Intronic
1051697963 9:19789090-19789112 AGCGCACAGCCCAGAGGGAGGGG - Intergenic
1052999205 9:34568265-34568287 TGCCCACAGCCCACAGGACAAGG - Intronic
1053177927 9:35942779-35942801 TGACTAGAGCCCCCAGGCAGTGG + Intergenic
1053727272 9:41016828-41016850 TGCCCACACCTCTCAGAGAGAGG - Intergenic
1054701244 9:68415284-68415306 TGCCCACACCTCTCAGAGAGAGG + Intronic
1056672192 9:88639766-88639788 TGCCCACAGGCCACATGCAGGGG + Intergenic
1056789170 9:89614709-89614731 TGCCCACAGTCCCCATGCAGGGG + Intergenic
1057168999 9:92949654-92949676 TGCCCAGGGCCACCAGGCAGCGG + Intronic
1057182156 9:93036046-93036068 TGCCTGCAGCCCCCAGGAGGTGG + Exonic
1059285462 9:113168343-113168365 TGCACACAGAGTCCAGGGAGTGG + Intronic
1059342460 9:113605590-113605612 TGAGCCCAGCCCACAGGGAGGGG - Intergenic
1060008916 9:120026323-120026345 TGCACACAACCCCCAAGAAGGGG + Intergenic
1060224455 9:121782699-121782721 TGCCCGCACCCCACAGGGAGCGG - Intronic
1060405913 9:123373053-123373075 TCCCCACTTCCCCCAGCGAGTGG - Intronic
1061119742 9:128635482-128635504 TGGCCACAGGGCCCTGGGAGTGG + Intronic
1061573541 9:131492267-131492289 AGCACGCAGTCCCCAGGGAGTGG - Intronic
1061912536 9:133732619-133732641 TGCCATCACTCCCCAGGGAGTGG + Intronic
1062178145 9:135175772-135175794 TCCCCACAGCCCCCAGAGCCAGG + Intergenic
1062417686 9:136461091-136461113 TGCCGCCTGCCCCCAGGGTGCGG + Intronic
1203670484 Un_KI270755v1:7071-7093 TGCCCACAAGCCCCGGGCAGTGG + Intergenic
1185615465 X:1419172-1419194 TCCCCCCGACCCCCAGGGAGAGG - Intronic
1185865399 X:3619624-3619646 TGCCCGGAGCCCCCAGGGGCTGG + Intronic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1189363412 X:40370400-40370422 GCCCCACAGCCACCAAGGAGGGG - Intergenic
1189709556 X:43795520-43795542 CACCCCCAGCCTCCAGGGAGGGG - Intronic
1190541205 X:51480695-51480717 TGCCCAAAGCCCCGTCGGAGCGG + Intergenic
1192925048 X:75747317-75747339 TGCCCACAGACCAGAGGAAGGGG + Intergenic
1193026419 X:76850536-76850558 TGAGAACAGCCCCCAGGGAGTGG + Intergenic
1193135640 X:77968441-77968463 TGACTAGAGCCCCCAGGCAGTGG + Intronic
1195256860 X:103099401-103099423 TGGTCACAGGCACCAGGGAGAGG - Intergenic
1195272958 X:103251111-103251133 TCCGCACAGCCCCCAGAGGGTGG - Intergenic
1196301062 X:114050412-114050434 TGATCACAGGCACCAGGGAGAGG + Intergenic
1199016910 X:142828321-142828343 GGCCCACACCTACCAGGGAGGGG - Intergenic
1199212279 X:145226810-145226832 TTCCTACATCCTCCAGGGAGGGG - Intergenic
1199715841 X:150506846-150506868 AGCACACAACCCCCAGGGACAGG + Intronic
1200182492 X:154159293-154159315 TGCCCTCAGCACCCAGGAGGAGG + Intergenic
1200188146 X:154196407-154196429 TGCCCTCAGCACCCAGGAGGAGG + Intergenic
1200193796 X:154233547-154233569 TGCCCTCAGCACCCAGGAGGAGG + Intergenic
1200199551 X:154271351-154271373 TGCCCTCAGCACCCAGGAGGAGG + Exonic
1200231627 X:154446587-154446609 CGCCCGCAGCCCCTGGGGAGGGG + Intronic