ID: 1077059327

View in Genome Browser
Species Human (GRCh38)
Location 11:610827-610849
Sequence CTGAGTTTATGGGCGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077059316_1077059327 18 Left 1077059316 11:610786-610808 CCCCATGTTCCCATCTTACTTTG 0: 1
1: 0
2: 0
3: 25
4: 345
Right 1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 83
1077059319_1077059327 9 Left 1077059319 11:610795-610817 CCCATCTTACTTTGAAACTAAAG 0: 1
1: 0
2: 2
3: 27
4: 340
Right 1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 83
1077059314_1077059327 26 Left 1077059314 11:610778-610800 CCCACTTTCCCCATGTTCCCATC 0: 1
1: 0
2: 3
3: 32
4: 364
Right 1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 83
1077059318_1077059327 16 Left 1077059318 11:610788-610810 CCATGTTCCCATCTTACTTTGAA 0: 1
1: 0
2: 0
3: 28
4: 285
Right 1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 83
1077059313_1077059327 29 Left 1077059313 11:610775-610797 CCTCCCACTTTCCCCATGTTCCC 0: 1
1: 0
2: 4
3: 42
4: 556
Right 1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 83
1077059320_1077059327 8 Left 1077059320 11:610796-610818 CCATCTTACTTTGAAACTAAAGT 0: 1
1: 0
2: 1
3: 32
4: 320
Right 1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 83
1077059315_1077059327 25 Left 1077059315 11:610779-610801 CCACTTTCCCCATGTTCCCATCT 0: 1
1: 0
2: 2
3: 52
4: 855
Right 1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 83
1077059317_1077059327 17 Left 1077059317 11:610787-610809 CCCATGTTCCCATCTTACTTTGA 0: 1
1: 0
2: 2
3: 19
4: 244
Right 1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077059327 Original CRISPR CTGAGTTTATGGGCGGAAGC TGG Intronic
907799571 1:57751350-57751372 CTGAGTTCAAGGGAGCAAGCAGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
915201205 1:154230560-154230582 CAGATTTTATGGGGGGAATCAGG + Intronic
915553488 1:156648205-156648227 CTGAGTTTAAGGGGGCAAGCAGG + Intronic
915779930 1:158536510-158536532 CTGAATTTTTGGGAGGAAGGAGG - Intergenic
916582309 1:166120014-166120036 CTGACTTTATGGGAGGGAGTGGG - Intronic
919165326 1:193885108-193885130 ATGGATTTCTGGGCGGAAGCTGG - Intergenic
920043488 1:203118699-203118721 CTGAGGGAATGGGCTGAAGCCGG + Intronic
1068678324 10:59791260-59791282 CTCAGTTTGGGGGTGGAAGCAGG + Exonic
1070414970 10:76180891-76180913 CTGAGTTTAGGGGTGGGAACAGG + Intronic
1074666265 10:115729571-115729593 ATCAGTTTATGGACAGAAGCTGG - Intronic
1077059327 11:610827-610849 CTGAGTTTATGGGCGGAAGCTGG + Intronic
1079107499 11:17580916-17580938 CTGTGGTTGTGGGAGGAAGCAGG - Intronic
1080145986 11:28984426-28984448 CTGAATTTATGTGCGCAAGGAGG + Intergenic
1081603006 11:44508278-44508300 CAGAGTTGATGTGAGGAAGCAGG - Intergenic
1083858255 11:65404578-65404600 CTGACTCCATGGGCAGAAGCAGG - Intronic
1087071110 11:94081855-94081877 GTGAGTTTCTGGGCAGAAGATGG + Intronic
1087132372 11:94679278-94679300 CTGAGTGTTTGGGAGGGAGCTGG - Intergenic
1094135726 12:27123599-27123621 CTGTTTTTATGGGCAGAATCAGG - Intergenic
1094165561 12:27439163-27439185 CAGAGTTTCTGGGCTGAAGATGG - Intergenic
1094185262 12:27635329-27635351 CTGTTTTTATGGGCAGAATCAGG - Intronic
1095866001 12:46972736-46972758 CTGTGTCTATGAGTGGAAGCAGG - Intergenic
1100184497 12:92124788-92124810 ATGAGTTTAGGGAAGGAAGCCGG - Intronic
1100892575 12:99142117-99142139 CTGAGGGTACAGGCGGAAGCAGG + Intronic
1102251641 12:111391385-111391407 CTGGGTTTCTGGGCGGGAGTTGG - Intergenic
1102579078 12:113874599-113874621 CTGAGTTCAAGGGCTGAAGCTGG - Intronic
1103900576 12:124301719-124301741 CTGAGTGTCTGGGGGGAAGTGGG + Intronic
1119411869 14:74437027-74437049 CTGAGTTTCTGGGAGGAGGTTGG + Intergenic
1125980330 15:43995428-43995450 CTGAGTTTGTGGGGGCAGGCTGG + Intronic
1126238585 15:46415078-46415100 CTGAGTCTGTGGGAGGAAACTGG - Intergenic
1131971899 15:97901951-97901973 CTGATTTTATGAGCTCAAGCTGG - Intergenic
1133477181 16:6134769-6134791 CTGAGTTTATGGCGTGAACCCGG - Intronic
1136450716 16:30353044-30353066 CGGTGTTTATTGCCGGAAGCTGG - Exonic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141809578 16:86366092-86366114 CTGAGGTTATTTGCGGAAGGCGG - Intergenic
1146744876 17:35319636-35319658 GTGAGTTTTTGTGTGGAAGCAGG - Intergenic
1149756473 17:59190605-59190627 CTGGTTTTATGGGCTTAAGCCGG - Intronic
1150494234 17:65594848-65594870 CTGAGTTTAAGGGAGGCAGCCGG + Intronic
1154492099 18:14930336-14930358 GTGAGTTTCTGGGAGGAAGGTGG + Intergenic
1160218161 18:76952474-76952496 CTGTGCTTCTGGGAGGAAGCTGG + Intronic
1163410235 19:17149513-17149535 CTGAGGTTGTGGGTGGAGGCAGG - Intronic
1164720113 19:30425769-30425791 CTGATTTTATAGTCAGAAGCAGG + Intronic
1165278405 19:34774342-34774364 CTGAGTTGCTGGGCATAAGCTGG - Intergenic
928118161 2:28563036-28563058 CTTAGTTCATAGGCTGAAGCCGG + Exonic
928175687 2:29032931-29032953 CAGATTTTATGGCCGGAAGATGG + Exonic
929252369 2:39773021-39773043 ATGACATTATGGGAGGAAGCAGG + Intronic
931250874 2:60529601-60529623 CTGAGTTGGCGGGCGGGAGCGGG + Intronic
932746451 2:74337543-74337565 TTGAGTTTATGGGCCGAAACTGG + Intronic
932969978 2:76528794-76528816 CTGTGTGTATGGGTGGATGCAGG - Intergenic
941818017 2:169817611-169817633 ATGAGTTCATGGGATGAAGCTGG + Intronic
947935459 2:233999845-233999867 CTGAGTATACGGGCTGAACCCGG + Intronic
1181944185 22:26503018-26503040 TTGAATTTATGGGGGAAAGCAGG - Intronic
1182098924 22:27644603-27644625 CTGAGTGGATGGACGGAAGTAGG + Intergenic
953361358 3:42300200-42300222 CTGAGGTTTTGTGTGGAAGCAGG - Intergenic
955047468 3:55373618-55373640 CTTAGTTTGTGGGTGGAAGGTGG + Intergenic
959619333 3:108383077-108383099 CTGTGTTTTTGGGCAGAATCAGG + Intronic
962395026 3:135008038-135008060 CTGAGATTGTGGGAGGAGGCAGG + Intronic
968426441 4:526538-526560 CTGAGTTAATGGGAGGAGGCAGG + Intronic
969706669 4:8796120-8796142 CTGAGCTTCTGGGCAGAACCAGG - Intergenic
971456187 4:26847020-26847042 ATGGGTGTATGGGTGGAAGCTGG - Intergenic
983763230 4:171440441-171440463 CTGAGTGTAGGGGCAGAAGGGGG - Intergenic
986214818 5:5709637-5709659 CTGTGTTTATGGGCAGATGTTGG - Intergenic
990405004 5:55480449-55480471 CTGGGTTTCTTGGTGGAAGCAGG - Intronic
991620921 5:68544869-68544891 ATGAATTTGTGGGTGGAAGCGGG + Intergenic
991957993 5:72014857-72014879 CTGAGTTGATGGGAAGAGGCAGG - Intergenic
992029477 5:72707381-72707403 CTGAGTCTAGGGGCTGGAGCTGG - Intergenic
998512866 5:142728281-142728303 CTGAGTTTATATGGAGAAGCGGG - Intergenic
999475504 5:151894548-151894570 GTGAGTTTATGGGGGGTAGTGGG - Intronic
1006876684 6:37303676-37303698 TTGAGTTTAAGGGGCGAAGCAGG - Intronic
1007428823 6:41764541-41764563 CTGAGTTAATGGGTGGGGGCAGG - Intergenic
1011798181 6:90980618-90980640 CTGAGTTTATGTTTGGTAGCAGG - Intergenic
1013697640 6:112722971-112722993 CTGAGTTTAGGAGTGGAGGCAGG - Intergenic
1014805506 6:125824922-125824944 CTAATTTTATAGGCAGAAGCAGG + Intronic
1027883107 7:83868186-83868208 CTCAGTTGATGGGAGCAAGCTGG - Intergenic
1028257788 7:88621827-88621849 CAGAGTTAATGGGCAAAAGCTGG + Intergenic
1033048337 7:137982233-137982255 CTGAGTTTATGGCCTCAAGAGGG - Intronic
1033826704 7:145199871-145199893 CTGAGTTGAGGGGATGAAGCTGG - Intergenic
1036567229 8:9947992-9948014 CTGAGTCTGTGGGTGGAACCCGG + Intergenic
1040825384 8:51614478-51614500 CAGAGTTTATGGGCGAAAAAGGG - Intronic
1046649772 8:116824970-116824992 CTGAGTTGAGGGGATGAAGCTGG - Intronic
1052850973 9:33378263-33378285 CTCAGTTTTTGGGCGGAGGAAGG - Intergenic
1054910614 9:70451970-70451992 CTGAGCTTAAGTGTGGAAGCTGG + Intergenic
1055955162 9:81766379-81766401 TTGAGCTGATGGGCTGAAGCTGG + Intergenic
1058061432 9:100501000-100501022 CTGAGTTTATACGCGGAAACTGG + Intronic
1060300674 9:122372959-122372981 CGGAGCTCATGGGAGGAAGCAGG + Intronic
1185894497 X:3845371-3845393 CTGGGTTTTTGGGGGGCAGCAGG - Intergenic
1185899615 X:3883795-3883817 CTGGGTTTTTGGGGGGCAGCAGG - Intergenic
1185904731 X:3922224-3922246 CTGGGTTTTTGGGGGGCAGCAGG - Intergenic
1187357597 X:18591778-18591800 CTGAGTCTAGGGGAGGAAGGAGG - Intronic
1189897647 X:45672787-45672809 CTCAGTTGCTGGGCTGAAGCAGG + Intergenic
1196871936 X:120120784-120120806 CTGAGTTTATGGGCTGGAGGAGG - Intergenic