ID: 1077059518

View in Genome Browser
Species Human (GRCh38)
Location 11:611733-611755
Sequence GGCGGCTCCTCCCCGGCCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 428}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077059518_1077059537 28 Left 1077059518 11:611733-611755 CCAGAGGCCGGGGAGGAGCCGCC 0: 1
1: 1
2: 1
3: 35
4: 428
Right 1077059537 11:611784-611806 GCAATCACGGGCTATGCCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 26
1077059518_1077059524 -6 Left 1077059518 11:611733-611755 CCAGAGGCCGGGGAGGAGCCGCC 0: 1
1: 1
2: 1
3: 35
4: 428
Right 1077059524 11:611750-611772 GCCGCCCACGCAGGGGGCCGAGG 0: 1
1: 0
2: 0
3: 12
4: 234
1077059518_1077059526 -5 Left 1077059518 11:611733-611755 CCAGAGGCCGGGGAGGAGCCGCC 0: 1
1: 1
2: 1
3: 35
4: 428
Right 1077059526 11:611751-611773 CCGCCCACGCAGGGGGCCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 120
1077059518_1077059533 16 Left 1077059518 11:611733-611755 CCAGAGGCCGGGGAGGAGCCGCC 0: 1
1: 1
2: 1
3: 35
4: 428
Right 1077059533 11:611772-611794 GGCTGAGGCCAGGCAATCACGGG 0: 1
1: 0
2: 5
3: 173
4: 2200
1077059518_1077059536 27 Left 1077059518 11:611733-611755 CCAGAGGCCGGGGAGGAGCCGCC 0: 1
1: 1
2: 1
3: 35
4: 428
Right 1077059536 11:611783-611805 GGCAATCACGGGCTATGCCCGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1077059518_1077059530 6 Left 1077059518 11:611733-611755 CCAGAGGCCGGGGAGGAGCCGCC 0: 1
1: 1
2: 1
3: 35
4: 428
Right 1077059530 11:611762-611784 GGGGGCCGAGGGCTGAGGCCAGG 0: 1
1: 2
2: 10
3: 115
4: 967
1077059518_1077059529 1 Left 1077059518 11:611733-611755 CCAGAGGCCGGGGAGGAGCCGCC 0: 1
1: 1
2: 1
3: 35
4: 428
Right 1077059529 11:611757-611779 ACGCAGGGGGCCGAGGGCTGAGG 0: 1
1: 0
2: 4
3: 41
4: 513
1077059518_1077059532 15 Left 1077059518 11:611733-611755 CCAGAGGCCGGGGAGGAGCCGCC 0: 1
1: 1
2: 1
3: 35
4: 428
Right 1077059532 11:611771-611793 GGGCTGAGGCCAGGCAATCACGG 0: 1
1: 0
2: 3
3: 26
4: 338
1077059518_1077059535 26 Left 1077059518 11:611733-611755 CCAGAGGCCGGGGAGGAGCCGCC 0: 1
1: 1
2: 1
3: 35
4: 428
Right 1077059535 11:611782-611804 AGGCAATCACGGGCTATGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077059518 Original CRISPR GGCGGCTCCTCCCCGGCCTC TGG (reversed) Exonic