ID: 1077059526

View in Genome Browser
Species Human (GRCh38)
Location 11:611751-611773
Sequence CCGCCCACGCAGGGGGCCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077059518_1077059526 -5 Left 1077059518 11:611733-611755 CCAGAGGCCGGGGAGGAGCCGCC 0: 1
1: 1
2: 1
3: 35
4: 428
Right 1077059526 11:611751-611773 CCGCCCACGCAGGGGGCCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077059526 Original CRISPR CCGCCCACGCAGGGGGCCGA GGG Exonic
900246767 1:1639934-1639956 CCGCCCACGCAGGGGTCAAGTGG + Intronic
900257989 1:1707066-1707088 CCGCCCACGCAGGGGTCAAGTGG + Intronic
900990589 1:6096558-6096580 CCCCACGTGCAGGGGGCCGATGG - Intronic
901136508 1:7000241-7000263 CTCCCCACGCAGGGGGCTGCAGG - Intronic
904331573 1:29761344-29761366 CAGCACACCCAGGGGGCCCAAGG - Intergenic
905548536 1:38818279-38818301 CCGCCCACCCAGGGTCCGGAGGG - Intergenic
907010635 1:50959899-50959921 CCGCCGCCGCCGGGCGCCGAGGG + Exonic
915012422 1:152699663-152699685 CAGCCCAGGCAGGGGCCTGAAGG + Intergenic
922593903 1:226799055-226799077 TCACCCACGCAGGATGCCGAGGG - Intergenic
923545063 1:234917997-234918019 CCTCCCACTGAGGGGGCCGAAGG + Intergenic
1064329887 10:14383591-14383613 CCGCCAACAGAGTGGGCCGATGG - Intronic
1064372137 10:14761881-14761903 CCGCCACCGCACCGGGCCGATGG + Intronic
1070724375 10:78778280-78778302 CAGCTCACCCAGGGGGCCCAGGG + Intergenic
1074827217 10:117223325-117223347 CCGCCCACCCTGGGGGCTGTTGG + Intergenic
1075753423 10:124791994-124792016 CCGCCGGCGCAGGGAGCCGGGGG - Intergenic
1076373597 10:129969406-129969428 CCGGCCCCGCAGCGGGGCGACGG + Intergenic
1077059526 11:611751-611773 CCGCCCACGCAGGGGGCCGAGGG + Exonic
1081968210 11:47182373-47182395 AGGCCCTCGCAGGGGGCAGAGGG - Intronic
1086888222 11:92226688-92226710 CCGCCCACGCTCCGGGCCGCAGG - Intergenic
1089846725 11:121464615-121464637 CAGGGCACGCAGGGGGCTGAGGG + Intronic
1091601755 12:1922203-1922225 CCGGCCACGCAGGGGGAAGCAGG - Intergenic
1091764116 12:3107169-3107191 CTCCCCACGGAGGGGGCCGCCGG - Intronic
1092259668 12:6946195-6946217 CCACCCACCCAGGGCGCTGAGGG - Intergenic
1094844077 12:34353859-34353881 CCGCTCACGCATGGGGCCCACGG - Intergenic
1094846706 12:34364537-34364559 ACGTGCACGCAGGGGGCCCAGGG - Intergenic
1094847069 12:34366004-34366026 CCGCGCATGCACGGGGCCCAGGG - Intergenic
1094847344 12:34367120-34367142 CCGCGCATGCATGGGGCCCATGG - Intergenic
1094855072 12:34399242-34399264 TCGCGCATGCATGGGGCCGAGGG + Intergenic
1094855658 12:34401735-34401757 CCGCCCATGCGTGGGGCCCAGGG + Intergenic
1097938520 12:65278976-65278998 CTGTCCCCGCAGGTGGCCGAGGG - Intronic
1099443859 12:82729011-82729033 CGGGCCACGCAGGAGGCCGCAGG - Intronic
1102331584 12:112036731-112036753 CCACCTACTCAGGAGGCCGAGGG + Intronic
1104895946 12:132163653-132163675 CAGCCCACGCAGGGTGGCAAGGG - Intergenic
1108524315 13:51272823-51272845 CTGCCCAGGCAGGAGGCTGAGGG + Intronic
1115786770 14:36835478-36835500 CAGCCCAGGCAGGGGCCCTAGGG - Intronic
1119023360 14:71133657-71133679 CAGCTCACGCAGATGGCCGATGG - Intergenic
1122164040 14:99807712-99807734 CAGCCCACGCAGGGGAGAGAGGG + Intronic
1122357592 14:101132814-101132836 AAGCCCACCCAAGGGGCCGAGGG + Intergenic
1124971757 15:34495833-34495855 GCGACCACGCAGGGGTCCTAAGG + Intergenic
1127426651 15:58865021-58865043 CCGCTGAAGCAGGAGGCCGAGGG + Intergenic
1128765780 15:70250359-70250381 CAGCCCAGGCAGGGGCGCGACGG - Intergenic
1130764995 15:86860941-86860963 CAGCCCAGGCAGGGGGCAGCAGG + Intronic
1132107203 15:99071525-99071547 CCGCACATGCATGGGGCAGATGG - Intergenic
1132567797 16:631226-631248 CCGCCGAGCCAGGGGGCCGGGGG - Exonic
1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG + Intronic
1133227862 16:4351116-4351138 CCGGGCACGCAGGGGGCGCACGG + Intronic
1136392435 16:29974069-29974091 CCTCTCACGCCGGGGTCCGAGGG - Exonic
1136418668 16:30118559-30118581 CCCCCCAGGCAGGGGGCAGTGGG + Intronic
1136580666 16:31149196-31149218 CCCCCCACGATGCGGGCCGAGGG + Exonic
1140481229 16:75263965-75263987 CCAGCCACGTAGGGGGCAGATGG + Intronic
1141126913 16:81407517-81407539 CAGCCCATCCTGGGGGCCGAGGG + Intergenic
1141830976 16:86509964-86509986 CCACCAACGCGGGGGCCCGAGGG + Intergenic
1142246118 16:88970831-88970853 CAGCCGACGCTGGGGGCCGGGGG + Intronic
1142728301 17:1832245-1832267 CCACCCAGGCAGTGGGCAGAGGG - Intronic
1144710018 17:17395406-17395428 CCTCCCAGGCAGGGGGCCAGAGG + Intergenic
1145765665 17:27456795-27456817 CAGCCCGCGCAGGCTGCCGATGG - Intronic
1148085278 17:44990206-44990228 CATCCCACTCAGGGGGCTGAGGG - Intergenic
1148562420 17:48613629-48613651 CCGCCCCCGCACGGGGTAGAAGG - Intronic
1148864133 17:50619791-50619813 CCTCCCAGGCTGGGGGCAGAAGG - Exonic
1150219942 17:63490473-63490495 CCCCCCTCGCCGGGGGCCCACGG - Intronic
1152050149 17:77968145-77968167 CCGCCTACTCAGGAGGCTGAGGG - Intergenic
1152282770 17:79395276-79395298 CCTCCCAGGCAGGGAGCCAAAGG - Intronic
1152571640 17:81123708-81123730 CCGCACCAGCAGGGGGCTGAGGG + Intronic
1152640782 17:81448360-81448382 CCGCCCACCCAGGGGCCCCAAGG + Intronic
1152736637 17:82000461-82000483 CCGCACACGCAGAGGGCCCGGGG + Intronic
1160344755 18:78123787-78123809 CCGCCCAGGGCTGGGGCCGAAGG + Intergenic
1160752019 19:738833-738855 CTGCCCACGATGGGGACCGATGG + Intronic
1160754186 19:749155-749177 CCTCCCACTCAGGGCTCCGAAGG - Intergenic
1161138805 19:2636204-2636226 CCTCCCACTCAGGGGGTGGATGG + Intronic
1165349789 19:35269311-35269333 CCGCCGAGGCCGGGGGCCGGGGG - Intronic
1165830290 19:38727298-38727320 ACGCACAGGCAGGGGGCCGGAGG + Intronic
1166507575 19:43380792-43380814 CCCCGCAAGCAGGGGGCTGAGGG - Intergenic
1166811614 19:45517845-45517867 CAGCCCACAGAGGGGGCCGGCGG - Intronic
1168247049 19:55117610-55117632 CCGCCCGCCCCGGGGGCCGCCGG + Intergenic
925152396 2:1624196-1624218 CCACCCTCTCAGGGGTCCGAGGG - Intergenic
927939806 2:27096329-27096351 CAGCCCAGGCAGGGGGTCGCGGG + Intronic
934716972 2:96550097-96550119 CCGCCCTCGCAGGGACTCGAAGG - Intronic
937244293 2:120482598-120482620 CAGGCCATGCAGGAGGCCGAAGG + Intergenic
942459105 2:176157416-176157438 CCGCGCCCGCCGGGGGCCGGGGG - Intronic
942505457 2:176637671-176637693 CCGCCCACGCACGAGGCCCCCGG - Intergenic
948921997 2:241070209-241070231 CCGCCCACGCGCAGGGCCCACGG - Intronic
949022672 2:241750302-241750324 CCCCCCACACAGGGGGCAGCTGG + Intronic
1168795980 20:610364-610386 CCGCCCCGGCCGGGGGCGGAGGG + Exonic
1173706201 20:45111991-45112013 GCACCCAGGCAGGGGGCTGAGGG - Intronic
1175877692 20:62238315-62238337 CCGCCCACGCAGCGGAGTGACGG - Intronic
1176042360 20:63072309-63072331 CCGCCCTCCCAGGGGGCCGCGGG + Intergenic
1178020010 21:28396795-28396817 CAGCCCAAGCTGGGGACCGAGGG - Intergenic
1178914947 21:36700939-36700961 CCGCCCACGCCGGTTGCCGCTGG + Intronic
1181514425 22:23402872-23402894 CGGCCCCTGCAGGAGGCCGAGGG + Intergenic
1181766055 22:25092901-25092923 CCTCCAGTGCAGGGGGCCGAGGG - Intronic
1182548260 22:31087807-31087829 CTGCCCACGCAGGGTCCCGGGGG - Intronic
1183469826 22:37999317-37999339 CCCCACACGCAGGCGGCCAAAGG - Intronic
1184086788 22:42270361-42270383 CCGCCCCCGGCGGAGGCCGAGGG - Intronic
1184439130 22:44498012-44498034 CCGGCCGGGCAGGGGGCCGGGGG + Intronic
1185219472 22:49622306-49622328 CAGCCCACGCCGGGGACCAAAGG + Intronic
950889972 3:16395558-16395580 CCAGCCACTCAGGAGGCCGAGGG - Intronic
951080152 3:18444056-18444078 CCGCGCAGGCAGGGAGCGGAGGG + Intronic
954464746 3:50647815-50647837 CTGCCCAGGCAGGGGGGTGATGG + Intronic
954515766 3:51175195-51175217 CCGCCCACCCAGGGACCCAAGGG - Intronic
956765500 3:72481141-72481163 CCTCCCACGCAGAAGGCAGAAGG - Intergenic
960101222 3:113745784-113745806 CCGCCCCCTCCGGGAGCCGAGGG + Intronic
960973360 3:123154718-123154740 CTGCCCAGGCTGGGGGGCGATGG - Intronic
975689257 4:76949017-76949039 CCTCCCAAGCAGGCGGCCGTTGG + Intergenic
982857240 4:160399247-160399269 CTGCCTATGCAGGGGGCCCATGG - Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
989161204 5:38393596-38393618 CAGCCCACGAAGGGGGTCAAGGG - Intronic
991063636 5:62403728-62403750 CCGCCCGCGGCGGCGGCCGATGG + Exonic
1002559511 5:180071900-180071922 CCGCCCTCGCCGAGGGCCCATGG - Exonic
1002898679 6:1393342-1393364 CTGCCCACGAAGGCGGCCGTCGG - Intronic
1006055955 6:31384719-31384741 CAGCCCCCGCAGGGTGCAGATGG + Intergenic
1018709077 6:166485052-166485074 CCGCCCAGGCAGGGGAACGTCGG + Intronic
1019499626 7:1358476-1358498 CCGCTGTCGCAGGAGGCCGACGG - Intergenic
1020100047 7:5389379-5389401 CCGCCCAGGCAGGGGTGGGAGGG - Intronic
1024222416 7:47298989-47299011 CCGCCCATGCAAGGGACCCAGGG + Intronic
1025946160 7:66106512-66106534 CCACCTACTCAGGAGGCCGAGGG - Intronic
1031195547 7:118609299-118609321 CAGCCCTCGCAAGGGGCCTAAGG - Intergenic
1032851677 7:135800678-135800700 CCGCCTACGCAGGAGACCCACGG - Intergenic
1035467870 7:159091557-159091579 CCTGCCTCGCAGGGGGCCCAGGG + Intronic
1037980033 8:23246749-23246771 CCTCCCACTCGGGGGGCAGAAGG - Exonic
1038720055 8:30027473-30027495 CTCCCCACGCAGAGAGCCGAAGG - Intergenic
1040474324 8:47763496-47763518 CTGCCCACGCAGGTGGTCCAGGG - Intergenic
1044667095 8:94641869-94641891 CCGCCCCAGCAGGGGAGCGAGGG + Intronic
1049585605 8:143431128-143431150 CCGCAAACCCAGGGGGCCGAGGG - Intergenic
1050304931 9:4298027-4298049 TCGCTCGCGCACGGGGCCGAGGG - Intronic
1060661718 9:125408555-125408577 CCGCGCACGCACACGGCCGACGG - Intergenic
1062110587 9:134780090-134780112 CCACCCGCACAGGGGGCCGATGG + Exonic
1196925546 X:120630142-120630164 CCGCCCGCGCAGGCGTCGGAAGG + Exonic