ID: 1077059526

View in Genome Browser
Species Human (GRCh38)
Location 11:611751-611773
Sequence CCGCCCACGCAGGGGGCCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077059518_1077059526 -5 Left 1077059518 11:611733-611755 CCAGAGGCCGGGGAGGAGCCGCC 0: 1
1: 1
2: 1
3: 35
4: 428
Right 1077059526 11:611751-611773 CCGCCCACGCAGGGGGCCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077059526 Original CRISPR CCGCCCACGCAGGGGGCCGA GGG Exonic