ID: 1077059553

View in Genome Browser
Species Human (GRCh38)
Location 11:611834-611856
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 119}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077059553_1077059566 15 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059566 11:611872-611894 GCCATGCCCGGGGAGCTGTCGGG 0: 2
1: 1
2: 1
3: 15
4: 135
1077059553_1077059568 20 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059568 11:611877-611899 GCCCGGGGAGCTGTCGGGAGTGG 0: 3
1: 0
2: 4
3: 14
4: 260
1077059553_1077059565 14 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059565 11:611871-611893 GGCCATGCCCGGGGAGCTGTCGG 0: 2
1: 1
2: 1
3: 17
4: 225
1077059553_1077059559 -9 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059559 11:611848-611870 CTGTCGGGAGTGGCGGGAATCGG 0: 2
1: 1
2: 1
3: 14
4: 176
1077059553_1077059573 30 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059573 11:611887-611909 CTGTCGGGAGTGGCGGGAAATGG 0: 1
1: 2
2: 4
3: 37
4: 367
1077059553_1077059563 4 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059563 11:611861-611883 CGGGAATCGGGGCCATGCCCGGG 0: 2
1: 0
2: 0
3: 4
4: 124
1077059553_1077059560 -8 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059560 11:611849-611871 TGTCGGGAGTGGCGGGAATCGGG 0: 2
1: 0
2: 1
3: 9
4: 89
1077059553_1077059571 23 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059571 11:611880-611902 CGGGGAGCTGTCGGGAGTGGCGG 0: 3
1: 0
2: 0
3: 38
4: 425
1077059553_1077059572 24 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059572 11:611881-611903 GGGGAGCTGTCGGGAGTGGCGGG 0: 3
1: 0
2: 1
3: 38
4: 393
1077059553_1077059562 3 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059562 11:611860-611882 GCGGGAATCGGGGCCATGCCCGG 0: 2
1: 0
2: 2
3: 6
4: 149
1077059553_1077059564 5 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059564 11:611862-611884 GGGAATCGGGGCCATGCCCGGGG 0: 2
1: 0
2: 0
3: 8
4: 86
1077059553_1077059561 -7 Left 1077059553 11:611834-611856 CCATGCCCGGGGAGCTGTCGGGA 0: 2
1: 0
2: 1
3: 8
4: 119
Right 1077059561 11:611850-611872 GTCGGGAGTGGCGGGAATCGGGG 0: 2
1: 0
2: 1
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077059553 Original CRISPR TCCCGACAGCTCCCCGGGCA TGG (reversed) Exonic
900117496 1:1034797-1034819 TCCCGGCAGCTTCCCGGGGATGG + Intronic
900436493 1:2633552-2633574 TTCTGCCAGCTCCCCGGCCAGGG - Intergenic
900866908 1:5275408-5275430 TGCCTCCACCTCCCCGGGCAGGG - Intergenic
903987757 1:27241279-27241301 TCTGGAGAGCTCCCTGGGCAAGG - Intronic
904466577 1:30711678-30711700 GCCCGCCAGCTCCCAGGCCATGG + Exonic
905370391 1:37479862-37479884 TCCCGGCAGCTCGCCGGGTGGGG + Intronic
912701456 1:111881414-111881436 TCCCAACAGCTGCCCGCACAGGG + Intronic
923212943 1:231822292-231822314 TCCTGACAGCTCACTGGGCCAGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1065102661 10:22345885-22345907 CCCCAAGAGCTCCACGGGCAGGG - Intronic
1070295129 10:75154054-75154076 TTACTACAGCTCACCGGGCATGG - Intronic
1073046718 10:100643517-100643539 TCCCAACAGCTCCCCAGGGTAGG + Intergenic
1074571593 10:114629350-114629372 TCCTGACAGCTCCACAGGGAAGG + Intronic
1075274107 10:121078149-121078171 ACCAGCCTGCTCCCCGGGCAGGG + Intergenic
1075782398 10:125026038-125026060 TCCCCCCAGGTCCCCAGGCAGGG + Intronic
1076721898 10:132396683-132396705 TCCCGGCAGCGCCCCGCGCTGGG - Intergenic
1077059553 11:611834-611856 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077059567 11:611873-611895 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077514193 11:2992026-2992048 TCCCGCCAGCGCCCCAGGCCCGG + Intronic
1079697154 11:23496083-23496105 TCCTGACAACTCCCAGTGCAGGG - Intergenic
1081845437 11:46237806-46237828 TCCCGACAGCTCCACGCGGTTGG - Intergenic
1084517205 11:69643388-69643410 TCCCGCCCGCTCCCCGGACAGGG - Intronic
1085415229 11:76315274-76315296 TCCCCACACCTCCCTGGGCAGGG + Intergenic
1085811911 11:79690822-79690844 TTCCTACACCTCCCCTGGCAGGG - Intergenic
1089696985 11:120221995-120222017 TCCCAACAGATTCCTGGGCAAGG + Intronic
1090837263 11:130462533-130462555 GCCCGGCAGATCCTCGGGCAGGG - Exonic
1091335536 11:134762972-134762994 TCACGACCGCTCTCCGGGCCAGG + Intergenic
1091401707 12:185203-185225 TCCGGACAGCTGGCCGGGTAAGG + Intergenic
1097278228 12:57827481-57827503 CCCTGCCAGCTCCACGGGCAGGG - Intronic
1100442995 12:94634695-94634717 TCCCTACTGCTCCCCAGGTAGGG + Intronic
1101180973 12:102217785-102217807 TCCCCACACCTGGCCGGGCACGG + Intergenic
1102306894 12:111811762-111811784 TCCCTACAGTTGGCCGGGCACGG - Intergenic
1103988301 12:124781478-124781500 GCCCGTCACCTCCCCTGGCAAGG + Intronic
1105642841 13:22284220-22284242 TCCCCACCGCTCCCCGGCCCTGG + Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1109992887 13:70082141-70082163 TCCTGAGAGCTCCCTGGCCATGG + Intronic
1112225206 13:97533010-97533032 TCCTGACATCTCCCCAGCCATGG - Intergenic
1113847629 13:113401635-113401657 TCCCCACAGCTCCCCCGACAGGG - Intergenic
1114637452 14:24195791-24195813 TCGCGACGGCTTCCCGGGGAGGG + Intronic
1119614838 14:76092135-76092157 TCCCGGCACCTGCCCCGGCAAGG - Intergenic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1122692818 14:103539193-103539215 TCCCACCAGCTTCCCGCGCAGGG + Intergenic
1128942836 15:71802448-71802470 TGCCCACAGGGCCCCGGGCAGGG + Intronic
1129208862 15:74054019-74054041 TCCAGCCAACTCCCCAGGCAGGG + Intergenic
1129772496 15:78211748-78211770 TCCCATCAGCTCCTCTGGCAAGG - Intronic
1130040068 15:80398987-80399009 TCCCTACTCCTCCCCGAGCATGG - Intronic
1132676760 16:1124274-1124296 TCCCTAAAGCTCCCAGGCCAAGG + Intergenic
1139761297 16:69186878-69186900 TCACGGGAGCTGCCCGGGCACGG - Intronic
1142077435 16:88128249-88128271 TCCTGACAGCCCCCCGAGAAAGG - Intergenic
1142743493 17:1943447-1943469 TCCCCGCAGCCCCCTGGGCAGGG + Intronic
1142808765 17:2385629-2385651 GCTCTGCAGCTCCCCGGGCAGGG + Exonic
1143090799 17:4448211-4448233 TCTCGGCAGCTCCCCGGGGTGGG - Exonic
1145259324 17:21345338-21345360 GCCCGGCACCTCCCCTGGCAGGG + Intergenic
1145285911 17:21505980-21506002 TCACGACAGGTCCACGGGGAAGG - Intergenic
1147585292 17:41651093-41651115 TCCAGCCAGCTCCCCTGGCCTGG - Intergenic
1148789929 17:50167359-50167381 TCCCCACAGTTCTCCTGGCAGGG + Exonic
1149470822 17:56913950-56913972 GCACGACAGCTCCTCGGCCAGGG + Exonic
1149992177 17:61389414-61389436 TCCTAACAGTTCCCAGGGCAAGG - Intronic
1150286946 17:63960102-63960124 CCCTGAAAGCTCCCTGGGCACGG + Intronic
1154356784 18:13627705-13627727 TCCAGTCATCTCCCCAGGCAAGG + Intronic
1156008593 18:32471005-32471027 TCGCGTCAGCTCCCCGGCCGGGG + Intergenic
1159088510 18:63820845-63820867 TCCAGACAGTTCCCAGTGCAAGG + Intergenic
1160462046 18:79046716-79046738 TCCCTCCAGCTCACAGGGCAAGG - Intergenic
1161108766 19:2456902-2456924 TCCCGACGGCGGCCCGGGCTCGG + Exonic
1162794302 19:13078668-13078690 TCAGGGCAGCTCCCCGCGCATGG + Exonic
1163829537 19:19541123-19541145 GGCCCACAGCTCCCCGAGCAGGG - Exonic
1165172728 19:33905655-33905677 CCCCGACAGCTCCGCGGGGTGGG - Intergenic
1165814970 19:38636281-38636303 TCCCGTCTACTCCCCCGGCAGGG - Intronic
1166302896 19:41922205-41922227 TCCCGACAGAGCCCGGGGCTTGG + Intronic
1167534655 19:50041965-50041987 TCCCCCCAGCTCCCAGGACAAGG - Intronic
1168098676 19:54129319-54129341 CCGCGACCGCTCCTCGGGCACGG + Exonic
926724194 2:15984623-15984645 TCCACACGGCTCCCTGGGCATGG + Intergenic
928212212 2:29331673-29331695 CCCCGTCAGCTCCCCAGGCAAGG - Intronic
928219811 2:29394478-29394500 TCCCCACAGCTCCCTGGTGAGGG - Intronic
931711171 2:64989786-64989808 GCCCGCCAGCACCCCGGACACGG - Exonic
932007189 2:67938908-67938930 TCCCTACTGCTCCCTGAGCATGG + Intergenic
932144211 2:69304825-69304847 TCCCGACATCCCCCCGTGCGCGG + Intergenic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
945066257 2:205949858-205949880 TCACGACTGCTCCCTGGGCCAGG - Intergenic
947641698 2:231710666-231710688 TCCCGACAGCACCTCGGGGGTGG - Intronic
947725809 2:232399626-232399648 TCCTGCCAGCTCCCCAGGGATGG + Intergenic
1171388447 20:24786108-24786130 ACCAGACAGCACCCGGGGCATGG - Intergenic
1173572310 20:44085358-44085380 TCAGCACAGCTCCCAGGGCAGGG + Intergenic
1173843391 20:46173630-46173652 TCCCTACATCTCCCAGGGGAGGG - Intergenic
1174452719 20:50629711-50629733 TCCCGACAGCCCCGTGAGCAGGG + Intronic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1183259241 22:36783620-36783642 TCCTGACAGCTCCGTGGGAAAGG - Intergenic
1183466606 22:37983328-37983350 ACCCGACCGCCCCCCGGGCTCGG - Intronic
1185037572 22:48487881-48487903 TCCCGTCAGAGCCCCTGGCAAGG + Intergenic
1185041747 22:48507782-48507804 TCCCGACAGCTCCCAGGCAGGGG - Intronic
952385198 3:32836111-32836133 CCCCGACAGCTCCCCCAGCAAGG + Intronic
975166924 4:71187409-71187431 TCCCGGCAGCTGCCGGGGCCGGG - Intronic
980486291 4:133461588-133461610 TCCCAACACCTCCCCGGGGGAGG - Intergenic
980937786 4:139242641-139242663 TCCCAGCAGCTCTCCTGGCAGGG + Intergenic
991960015 5:72035053-72035075 TGCAGACAGCTCCCCAGGCCTGG + Intergenic
991967674 5:72108296-72108318 TCCCAGCATCTCCCCGGGGAGGG - Intronic
999461067 5:151758164-151758186 TCAGGCCAGCTCCGCGGGCAGGG + Intronic
1001329056 5:170749425-170749447 TCCAGAGAGCTCCCCAGGGAGGG + Intergenic
1001591565 5:172869080-172869102 TCCCTCCAGCTCCCCACGCAAGG - Intronic
1003126178 6:3357756-3357778 TCTCGGCATCTCCCCTGGCATGG - Intronic
1007264042 6:40584136-40584158 TCCTGGCAGCTCCCTGGACAGGG + Intronic
1013457307 6:110342277-110342299 TCCCAACAGCTCCCCAGGCATGG - Intronic
1019339608 7:502683-502705 TGCCTGCAGCTCCCCGGGGAAGG - Intronic
1019710859 7:2517607-2517629 TCCCCACAGTTCCCAGGCCAGGG - Intronic
1019729415 7:2622207-2622229 TTCCCACAGCTCTCAGGGCAAGG - Intergenic
1020014394 7:4822345-4822367 CCCCGCCAGCACCCCAGGCAGGG - Intronic
1023220543 7:37916846-37916868 TCCCGACACCTCCCCTGACGTGG + Exonic
1025854081 7:65263324-65263346 GCTGGACTGCTCCCCGGGCAAGG + Intergenic
1030113073 7:106042765-106042787 TCCTGCCAGCCCCCCAGGCAGGG - Intergenic
1033570137 7:142619348-142619370 TACCGACAGGACCCAGGGCAAGG + Intergenic
1035056940 7:156041914-156041936 TCCCCACAGCTCTGCCGGCAAGG - Intergenic
1036912205 8:12766695-12766717 TTCAGAGAGCTCCCTGGGCAGGG + Intergenic
1037951252 8:23019790-23019812 TTCCGACAGCTCTCGGGGAATGG - Intronic
1043385901 8:79747650-79747672 TCCAGACATCTTCCTGGGCAAGG - Intergenic
1049381996 8:142320760-142320782 CCCAGACAGCTCCCCTGGGAGGG + Intronic
1049411749 8:142476687-142476709 TCCCGCCAGCTCACCGGTCTGGG - Exonic
1052436773 9:28439686-28439708 TCCTGAGGGCTCCCCAGGCATGG + Intronic
1057490625 9:95517002-95517024 TCGCGGGAGCTCGCCGGGCAGGG - Intronic
1059434924 9:114270467-114270489 TACCGACAGCTCCCTCTGCAGGG - Intronic
1060237735 9:121877881-121877903 GCCTGACAGCTCCCCGTGTATGG - Intronic
1060608644 9:124940885-124940907 TCCCCACAGCGGCCCGGTCAGGG - Intronic
1060825034 9:126683057-126683079 TCCCGACAGCGCCCCTGGCGCGG + Intronic
1061646620 9:132007942-132007964 TCCCCACAACTTCCAGGGCATGG + Intronic
1061856034 9:133442510-133442532 GCCCCACAGCTCACCGAGCAGGG - Exonic
1203771914 EBV:53881-53903 TCCCGGCCGCTGCCCGGGCCAGG + Intergenic
1186393751 X:9186802-9186824 TCCCTAAAGCTCCCTGTGCAAGG - Intergenic
1192157749 X:68759069-68759091 CCCAGACAGCTCCCCAGGCTGGG + Intergenic
1198312424 X:135435496-135435518 GCCCGCCAGCTCCCCAGTCAGGG - Intergenic
1200077147 X:153556834-153556856 CCCCCATAGCTCCCTGGGCAGGG + Intronic
1200330656 X:155293142-155293164 TTCGGACAGCTCCTCTGGCAAGG + Intronic