ID: 1077061394

View in Genome Browser
Species Human (GRCh38)
Location 11:619271-619293
Sequence GAACCCTGGGGGCTCACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 219}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077061378_1077061394 28 Left 1077061378 11:619220-619242 CCCCTTGCACACCTACCGCGGGA 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG 0: 1
1: 0
2: 1
3: 24
4: 219
1077061388_1077061394 -1 Left 1077061388 11:619249-619271 CCACCGAAGGGGCTTATTTGGAG 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG 0: 1
1: 0
2: 1
3: 24
4: 219
1077061380_1077061394 26 Left 1077061380 11:619222-619244 CCTTGCACACCTACCGCGGGAAA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG 0: 1
1: 0
2: 1
3: 24
4: 219
1077061383_1077061394 13 Left 1077061383 11:619235-619257 CCGCGGGAAAGGAGCCACCGAAG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG 0: 1
1: 0
2: 1
3: 24
4: 219
1077061379_1077061394 27 Left 1077061379 11:619221-619243 CCCTTGCACACCTACCGCGGGAA 0: 1
1: 0
2: 0
3: 2
4: 106
Right 1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG 0: 1
1: 0
2: 1
3: 24
4: 219
1077061389_1077061394 -4 Left 1077061389 11:619252-619274 CCGAAGGGGCTTATTTGGAGAAC 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG 0: 1
1: 0
2: 1
3: 24
4: 219
1077061382_1077061394 17 Left 1077061382 11:619231-619253 CCTACCGCGGGAAAGGAGCCACC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG 0: 1
1: 0
2: 1
3: 24
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077061394 Original CRISPR GAACCCTGGGGGCTCACCTG TGG Intronic
901332726 1:8423603-8423625 GGACCCCGGGCGCTTACCTGTGG - Intronic
902698464 1:18155814-18155836 GAGGCCTGGGCGCTGACCTGGGG + Intronic
902805258 1:18857314-18857336 GGGCCCAGGGGCCTCACCTGTGG + Exonic
903284125 1:22266598-22266620 GACCCCTGGGGCCTCTCCTAAGG - Intergenic
903770976 1:25764129-25764151 GCATCCTGGGGGCTTGCCTGTGG + Intronic
903901146 1:26646469-26646491 CAAGCCTGGCGGATCACCTGAGG + Intergenic
904378617 1:30096701-30096723 CAGCCCTGGGCACTCACCTGGGG + Intergenic
904484093 1:30813657-30813679 GAGCCTTAGGGTCTCACCTGGGG - Intergenic
906328165 1:44861757-44861779 GAAAGCTGTGGGCTCTCCTGAGG + Intronic
906730221 1:48074535-48074557 GAAGCCTGGGGGCTCCCTTTGGG + Intergenic
909834040 1:80231225-80231247 AAACCCTGGTGGCTTCCCTGTGG - Intergenic
910237238 1:85048379-85048401 GCGCCCCGCGGGCTCACCTGGGG + Exonic
913600039 1:120414127-120414149 TAAGCCTGGTGGATCACCTGAGG + Intergenic
914087023 1:144462534-144462556 TAAGCCTGGTGGATCACCTGAGG - Intergenic
914311587 1:146471667-146471689 TAAGCCTGGTGGCTCACCTGAGG + Intergenic
914449892 1:147781886-147781908 GAAACCTGGGGACTTCCCTGAGG + Intergenic
914590828 1:149104432-149104454 TAAGCCTGGTGGATCACCTGAGG - Intergenic
914745659 1:150499246-150499268 GAACCCTGGGACCTCAACTCTGG + Exonic
917843202 1:178999492-178999514 TAAGGCTGGGGGATCACCTGAGG + Intergenic
918740701 1:188127741-188127763 TAACCCCTGGAGCTCACCTGGGG + Intergenic
919855846 1:201705517-201705539 AAACCCTGGGAGCTCCCCTGGGG + Intronic
920504303 1:206505946-206505968 GGGCTCTGGGGGCTCACCAGAGG - Intergenic
921381263 1:214526857-214526879 CAACGCGGGGGGATCACCTGAGG + Intronic
923273587 1:232378588-232378610 GGAGCCTGAGGCCTCACCTGAGG + Intergenic
1062842571 10:682278-682300 GAGCACTTGGGGCTCCCCTGGGG - Intronic
1064875464 10:19989030-19989052 CAAGCCTGGTGGATCACCTGAGG - Intronic
1067292138 10:44951043-44951065 GAGCCATGGCGCCTCACCTGGGG - Intergenic
1067581972 10:47451856-47451878 GAGGCCTGGGTGCTCAGCTGAGG + Intergenic
1067726661 10:48775790-48775812 CAACCCTGGGTGCTCAGGTGAGG + Exonic
1067837121 10:49648421-49648443 GAAGCCAGGGGCCTAACCTGGGG + Intronic
1068472575 10:57483541-57483563 GAACCCAGGAGGCTGAGCTGAGG + Intergenic
1069658246 10:70106153-70106175 GAACTGTGATGGCTCACCTGGGG + Intronic
1069688596 10:70335015-70335037 GCACCCTGTGGGCTCACCCTGGG + Intronic
1070228109 10:74532811-74532833 GAACCCGGGAGGCTGACCTGAGG + Intronic
1070504298 10:77099480-77099502 GAAGGCTGGCGGATCACCTGCGG + Intronic
1070604474 10:77889138-77889160 GAAGCCTGGGAGGTTACCTGTGG - Intronic
1070725268 10:78783460-78783482 TAGGGCTGGGGGCTCACCTGAGG - Intergenic
1072610018 10:97011622-97011644 GGAAGCTGGGGGCTTACCTGAGG - Intronic
1073323908 10:102631638-102631660 GCACCCTGTGGGCACTCCTGTGG - Exonic
1075041001 10:119106573-119106595 GAACCCAGGAGGATCGCCTGAGG - Intronic
1075689839 10:124387431-124387453 GAGCCCTCTGGGATCACCTGAGG - Intergenic
1076090891 10:127684580-127684602 GAGCCCTGTGGGCTTTCCTGTGG - Intergenic
1076632171 10:131857807-131857829 GAAGCCTGGGTGCACGCCTGGGG + Intergenic
1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG + Intronic
1077065247 11:638145-638167 GAACCCTGGGGGGAAGCCTGAGG + Intronic
1077191876 11:1259082-1259104 GTGCCTCGGGGGCTCACCTGGGG - Intronic
1077191903 11:1259161-1259183 GTGCCTCGGGGGCTCACCTGGGG - Intronic
1077191946 11:1259293-1259315 GTGCCTTGGTGGCTCACCTGGGG - Intronic
1080720096 11:34840385-34840407 GATCCCTTGGAGCTCACCTTTGG + Intergenic
1081628175 11:44667953-44667975 CAAGGCTGGGGGTTCACCTGAGG + Intergenic
1081760083 11:45571051-45571073 GAACCCTGGGGGCCAGGCTGAGG + Intergenic
1082287457 11:50333268-50333290 AAACACTGGGGCTTCACCTGTGG - Intergenic
1083234216 11:61341608-61341630 GACCCCTGGGGAATAACCTGGGG - Intronic
1083310715 11:61782277-61782299 GTACCCTGGGGGCTGCGCTGGGG + Intronic
1083882395 11:65555054-65555076 GAGCCGTCGGGGCTCAGCTGTGG - Intronic
1084320952 11:68373119-68373141 GGACCCTTGAGTCTCACCTGAGG - Intronic
1084566584 11:69932091-69932113 GGACCCAGGGTGCTCACCTGGGG - Intergenic
1084571990 11:69965474-69965496 CGACGCTGGGGGATCACCTGAGG - Intergenic
1084752616 11:71214158-71214180 AAACCCTGGGGCTTCCCCTGTGG + Intronic
1084974105 11:72787298-72787320 GAACCCTGGGAGCTGCCCTCTGG + Intronic
1084978422 11:72815685-72815707 GTACCCTGGGGGCTGAGGTGGGG + Intronic
1084998338 11:73005562-73005584 GAAGCCTGGGGTCTGACTTGAGG - Intronic
1088785449 11:113177663-113177685 GAGCCAGGGGGGATCACCTGAGG - Intronic
1089464188 11:118673578-118673600 CATCCCTGCGTGCTCACCTGAGG - Intronic
1090011027 11:123046082-123046104 CAACGCTGGTGGATCACCTGAGG + Intergenic
1090445483 11:126761298-126761320 CCTCCCTGGGGGCTCACCAGAGG + Intronic
1090859470 11:130640207-130640229 GCCTCCTGGGAGCTCACCTGAGG + Intergenic
1092083830 12:5739454-5739476 GTACCCTTTGGGCTCACCAGTGG + Intronic
1092353611 12:7776499-7776521 GAGGCGTGGTGGCTCACCTGAGG - Intergenic
1096392707 12:51241686-51241708 GAAGCACGGTGGCTCACCTGAGG + Intronic
1096806948 12:54146732-54146754 CAACGCTGGGGGCTCACTCGAGG + Intergenic
1100883263 12:99041577-99041599 GATCAATGGGGGCTCACCGGGGG - Intronic
1101571139 12:105954866-105954888 GTCCCCTGGTGACTCACCTGGGG - Intergenic
1102212657 12:111138526-111138548 GAACCCTGGGGGCTGCCATGGGG - Intronic
1102258765 12:111430852-111430874 GGACCCTGGGGACCCACCTGTGG - Intronic
1106994991 13:35471008-35471030 GAGCCCCGGGGGCTCATCGGGGG + Intronic
1107062623 13:36175795-36175817 GAACTCTGGGGGCTCTGCGGGGG + Intronic
1113486041 13:110652950-110652972 CATCCCTGTGGGGTCACCTGTGG - Intronic
1113643321 13:111973744-111973766 GAACCCAGGGGGCTGAGCAGGGG + Intergenic
1113764283 13:112871103-112871125 GAAGCCTGGGGGCTTCCCTCGGG - Intronic
1118315196 14:64721787-64721809 GCACCCTAGGGGCTCTCCTGGGG - Intronic
1118901964 14:69993727-69993749 GGACCCTGGGGGGTCAGGTGAGG + Intronic
1119547454 14:75482614-75482636 GAACCTTGGTGGCTTACATGTGG - Intergenic
1122690207 14:103528713-103528735 GGCCCCTGGGGGTTCACCAGAGG - Intergenic
1125473978 15:40031956-40031978 CAAGGCTGGGGGATCACCTGAGG - Intronic
1126671991 15:51124758-51124780 GAAGCCTGGTGGGTCAACTGAGG - Intergenic
1127834946 15:62783397-62783419 CAGCCCTGGGGGGTCACCAGAGG - Intronic
1130960985 15:88658494-88658516 GTACCCTGTAGGCTCAGCTGGGG - Intergenic
1132552666 16:559915-559937 GGCCCCTGGGGGCTGTCCTGGGG - Intergenic
1132889830 16:2197973-2197995 GAAGCCAAGGGGCTCACCTGGGG + Intergenic
1138319271 16:56098175-56098197 AAACCCAGGGGACTCCCCTGTGG + Intergenic
1138436163 16:57001172-57001194 GGACCCTGGGGGAGGACCTGAGG - Intronic
1140488903 16:75317691-75317713 GAACCCTGGGAGCTCAACAGAGG + Intronic
1141811712 16:86380361-86380383 GAACACTGGGGGCCCTCCGGGGG + Intergenic
1141985781 16:87578826-87578848 GAACCCCGTGTGCTCACCTAGGG - Intergenic
1141996422 16:87639000-87639022 GAACCCAGGGCTGTCACCTGAGG - Intronic
1142355720 16:89600858-89600880 GAACCCATTGGTCTCACCTGGGG - Intergenic
1142964455 17:3572066-3572088 GGAGCTTTGGGGCTCACCTGTGG - Intronic
1143272909 17:5688978-5689000 GAAGCCTGGGGGCTCAGCGGGGG + Intergenic
1143533981 17:7524668-7524690 GAACCCTTGGGACTCCTCTGAGG - Intergenic
1144863267 17:18319005-18319027 GCACCCTGGAGGGTCCCCTGCGG + Intronic
1145252690 17:21304995-21305017 TAGCCATGGGGGCTTACCTGGGG + Intronic
1146668201 17:34718715-34718737 CAATCCTGGGGGCTCCCCAGAGG - Intergenic
1147438525 17:40432438-40432460 GAACCCAGGGGTCTGACTTGAGG + Intergenic
1148958473 17:51373217-51373239 GAAGCCTCGGGGTTCACGTGAGG + Intergenic
1151882578 17:76904167-76904189 GACCCCTGGGGGTGCACGTGCGG + Intronic
1152489235 17:80618217-80618239 CAAGCCTGGCGGATCACCTGAGG - Intronic
1153276047 18:3368787-3368809 GAGGCCGGGGGGATCACCTGAGG + Intergenic
1154214146 18:12403089-12403111 CAACGCTGGTGGATCACCTGAGG + Intergenic
1157815809 18:50728987-50729009 GAGCCTTGGGGGCTCAGCTGGGG - Intronic
1161146864 19:2684087-2684109 GAAGCCAGGTGGCTCACTTGAGG + Intronic
1161445977 19:4319342-4319364 GAATTTTGGGGGATCACCTGAGG + Intronic
1161520497 19:4721033-4721055 TAACCCAGGGGTCTCACCTGGGG + Intronic
1162737251 19:12753537-12753559 GAGACCTGGGGTGTCACCTGGGG + Intronic
1162788781 19:13052420-13052442 GAACACAGGTGGGTCACCTGAGG + Intronic
1167288382 19:48611698-48611720 CAAGGCTGGGGGATCACCTGAGG - Intronic
1167295088 19:48645233-48645255 GAACCCCAGGGGCTCACCATGGG - Intronic
1167950784 19:53025997-53026019 CAATCCTGGTGGATCACCTGAGG + Intergenic
1168287794 19:55343043-55343065 GAACCCTGGGGTCACATCCGGGG - Intronic
925175069 2:1777279-1777301 CATCTCTGGGGGCTCCCCTGTGG - Intergenic
926927991 2:18007528-18007550 GAGGCCGGGGGGATCACCTGAGG + Intronic
927188199 2:20497555-20497577 GCACACTGGGGGCTGACCAGTGG + Intergenic
927495045 2:23546474-23546496 ACAGCCTGGGGCCTCACCTGAGG - Intronic
927541705 2:23917824-23917846 CAAGCCGGGGGGATCACCTGAGG + Intronic
929552603 2:42903977-42903999 GCCCCATGGGGGCTCCCCTGGGG + Intergenic
929693054 2:44090551-44090573 GAGCCCTGGGGGATCACCTCTGG + Intergenic
934670235 2:96208073-96208095 GAACCCTGGGGCCTGCCCTGTGG - Intronic
935631520 2:105216291-105216313 GGCCCCTGGGAGCCCACCTGTGG + Intergenic
935753181 2:106256758-106256780 CAAGGCTGGGGGATCACCTGAGG + Intergenic
938214057 2:129492995-129493017 AAACCCTGGGCTCTCACCTGCGG + Intergenic
938379238 2:130827337-130827359 GGACCCTGGGGGCTCAGCTGAGG - Intergenic
942853628 2:180520459-180520481 CAACCCAGGAGGCTGACCTGTGG + Intergenic
945068701 2:205969617-205969639 CAACGCTGGTGGATCACCTGAGG - Intergenic
946334892 2:219029955-219029977 GACCCCAGGGGCCTCCCCTGGGG - Intronic
946370050 2:219275606-219275628 GAAGTCTGGAGGATCACCTGAGG - Intronic
946842890 2:223836168-223836190 GCACCCTGTGGGCCCACCGGAGG - Intronic
947719923 2:232364015-232364037 GGAGCCTGTGGGCTCTCCTGAGG - Intergenic
947724239 2:232387543-232387565 GGCCCCTGGGGCCTCAGCTGCGG + Intergenic
948514863 2:238497632-238497654 GATCCCAGGGGGCTCAACTATGG + Intergenic
948822518 2:240557371-240557393 GAGCCCTGGGGGCACATGTGCGG - Intronic
1168970442 20:1927247-1927269 GAACCCTGGAGGCTTCTCTGTGG + Intronic
1169116010 20:3066426-3066448 CAAGACTGGGGGGTCACCTGAGG - Intergenic
1170954572 20:20967143-20967165 GTACCCAGGGTGCTCATCTGGGG + Intergenic
1172552123 20:35809344-35809366 CAAGCCTGGTGGATCACCTGAGG + Intronic
1173538426 20:43833137-43833159 GTGCCCTGGGGCCTCATCTGGGG - Intergenic
1174161052 20:48550742-48550764 GAATCCTGAGGGCTCATCTCAGG + Intergenic
1174267872 20:49345027-49345049 AAACCCTGGGGTCGAACCTGGGG + Intergenic
1174488648 20:50876871-50876893 AAACCCTGTGGTCTCACATGAGG - Exonic
1174652544 20:52139923-52139945 CAACAGTGGGGGCTCACTTGGGG + Intronic
1175928945 20:62484588-62484610 GGACCCTTGGGGGCCACCTGGGG + Intergenic
1176114161 20:63423875-63423897 GAACCCTGGGGCCAGACTTGTGG + Intronic
1178311466 21:31533519-31533541 CAACCCAGGAGGCTCACTTGAGG + Intronic
1181006383 22:20015693-20015715 GCAGCCTGGGTACTCACCTGAGG + Intronic
1181804543 22:25366970-25366992 GGACCCTTGAGTCTCACCTGAGG + Intronic
1183498518 22:38164168-38164190 GACCCCTGGGGGCTCACACGGGG + Intronic
1183697704 22:39432563-39432585 GACCCCTGGCGGCTCGGCTGGGG - Intronic
1184098253 22:42328313-42328335 GCATCCTGTGGGCTCCCCTGAGG + Intronic
1184127954 22:42500912-42500934 GAACCCTGGGAGGCCACGTGCGG - Intergenic
1184136744 22:42554228-42554250 GAACCCTGGGAGGCCACGTGCGG - Intronic
1184393201 22:44217594-44217616 CTTCCCTGTGGGCTCACCTGCGG + Intronic
950775441 3:15345994-15346016 GCTGGCTGGGGGCTCACCTGGGG + Intergenic
950997922 3:17524624-17524646 CAAGCCTGGGAGATCACCTGAGG + Intronic
952159236 3:30677139-30677161 GAAAGCTGGGAGCTCACCTAGGG - Intronic
954614989 3:51964862-51964884 GACCCCAGGATGCTCACCTGAGG - Intronic
955982407 3:64540144-64540166 GAACCCTTGGGTCTTAGCTGGGG + Intronic
961031937 3:123613712-123613734 GAACCCTCTGGGCTGAGCTGTGG + Exonic
961502869 3:127350131-127350153 CTTCCCTGGGGGCTCCCCTGTGG - Intergenic
962313910 3:134346185-134346207 AAACTCTGGGGGCTGACATGAGG - Intergenic
963503810 3:146160864-146160886 GACCGCGGGGTGCTCACCTGTGG + Exonic
965913631 3:173814083-173814105 GAACCCTGCGGGCCCAGCTCAGG - Intronic
967984234 3:195083446-195083468 GATCCCTGGGGCCTCTCCTCAGG + Intronic
968513408 4:1005066-1005088 GTGCCCTGGGGGCTCCCCCGTGG - Intergenic
968545009 4:1194009-1194031 GAACCCAGGGGGGTGCCCTGTGG + Intronic
968601377 4:1511583-1511605 GGACCCTGGGCGCTGAGCTGGGG - Intergenic
976298604 4:83496603-83496625 GGAGGCTGGGGGATCACCTGAGG + Intronic
980277140 4:130667487-130667509 CAAGCCTGGCGGATCACCTGAGG - Intergenic
981159220 4:141476889-141476911 CAAGCCAGGTGGCTCACCTGAGG - Intergenic
982117732 4:152112183-152112205 AAACCCTGGGGTCTCAGATGGGG + Intergenic
985544890 5:504599-504621 GAGCCCTCTGGGCTCACCCGGGG - Intronic
985622085 5:961059-961081 GATCCCTGGGGGCCCACCGTGGG + Intergenic
986387083 5:7245108-7245130 GAGCACTGGGAGCTCTCCTGGGG + Intergenic
992426942 5:76667587-76667609 GAACCCTGTGGGCTCTGATGAGG - Intronic
1000282462 5:159793911-159793933 GAAGCCTGTGGGGGCACCTGCGG - Intergenic
1001982096 5:176044623-176044645 GAGGCCTGGGCGTTCACCTGGGG + Intergenic
1002133433 5:177094789-177094811 GAGCCCCTGGGGCTGACCTGTGG - Intronic
1002235365 5:177799434-177799456 GAGGCCTGGGCGTTCACCTGGGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002375859 5:178788772-178788794 GAAGCATGGGAGCTCACCTGCGG + Intergenic
1002400363 5:178988595-178988617 GGACCCTGGGGGTGCACGTGGGG - Intronic
1003390002 6:5705614-5705636 AAACCCAGGGGCCTCGCCTGTGG + Intronic
1005031463 6:21512790-21512812 GACCTCAGGGAGCTCACCTGGGG + Intergenic
1006132553 6:31878073-31878095 GAAGGCTGGGGACTCACCTGCGG - Intronic
1006269572 6:32953431-32953453 GAGCCCTGGGGGTTTACTTGGGG - Intronic
1007756254 6:44101626-44101648 GACCCCTGGGGGGACCCCTGGGG - Intergenic
1017678746 6:156842233-156842255 GAATCCAGGGGTCTCATCTGGGG - Intronic
1019287984 7:233162-233184 GAGCCATGGGGGCTCCCGTGAGG + Intronic
1020999961 7:15316394-15316416 GAAAACTGGGGGCCCACTTGAGG + Intronic
1022292279 7:29016116-29016138 GAAGGCTGGTGGATCACCTGAGG + Intronic
1023633370 7:42184849-42184871 GACCCCTGTGGGGTCAGCTGAGG + Intronic
1024262096 7:47580979-47581001 GAAGCCTGGGGGCTTCCCAGGGG + Intronic
1025133990 7:56395575-56395597 GAAGCCTGGGGGCCAAGCTGTGG - Intergenic
1025987465 7:66466243-66466265 GAAACCTGGGGGCAGCCCTGGGG + Intergenic
1026027530 7:66759179-66759201 GAAACCTGGGGGCAGCCCTGGGG - Intronic
1028714993 7:93955523-93955545 GAACCCTGGGGAGTCACCAGTGG + Intergenic
1029598627 7:101550885-101550907 GAAGACTGAGGGCTCAGCTGGGG + Intronic
1029814033 7:103075406-103075428 AAACCCCGGGGTCCCACCTGCGG - Exonic
1032478333 7:132227219-132227241 GACTCTTGGGGGCTAACCTGGGG + Intronic
1032549525 7:132771587-132771609 GCACCCTGGTGGCCCACCTGGGG + Intergenic
1033542217 7:142367596-142367618 CAACCCTGGGGGCTGAACTCTGG - Intergenic
1035690804 8:1558112-1558134 GCATCCTGGGGGCTCCCATGTGG + Intronic
1036794352 8:11744456-11744478 GAAGCCAGGGGGCACAGCTGTGG - Intronic
1037835914 8:22214605-22214627 GTCCCCTGGGGGCTTAGCTGAGG + Intergenic
1038700974 8:29849012-29849034 GAACCCTGGGGGGAGCCCTGGGG - Intergenic
1039160317 8:34611744-34611766 GAAATCTGGTGGCTCAGCTGTGG - Intergenic
1039858503 8:41436668-41436690 GAACCCTGAGGTGTCAGCTGGGG - Intergenic
1040318419 8:46276966-46276988 CAACCCTGTGGGCTCCTCTGGGG + Intergenic
1047747127 8:127853546-127853568 CAAAGCTGGGGGATCACCTGAGG + Intergenic
1047915621 8:129580904-129580926 GAAGCATGGGGGATCATCTGGGG + Intergenic
1048003289 8:130397371-130397393 GAAGGCTGGCGGATCACCTGAGG - Intronic
1048517701 8:135125522-135125544 GAACACTGGAGGCTCAAGTGGGG + Intergenic
1049449914 8:142655054-142655076 GAACCATGGGGGCTGCCCTCAGG + Intergenic
1049536188 8:143183551-143183573 GGCTCCTGAGGGCTCACCTGGGG + Intergenic
1049551703 8:143263028-143263050 GAACCCCGGGGCCTCCTCTGGGG - Intronic
1049578925 8:143402066-143402088 GAACCCACGTGGCACACCTGGGG - Intergenic
1049657027 8:143803555-143803577 GCCCCCGTGGGGCTCACCTGTGG + Exonic
1049709418 8:144056931-144056953 GCACCCTGGGAGCCCACCTGGGG + Exonic
1053002201 9:34583440-34583462 GAACCCTGTAGGCTCACAGGAGG + Intronic
1055356015 9:75437852-75437874 GAACCCTGGAGGCTTACATAGGG - Intergenic
1055869107 9:80852930-80852952 GAACCCTGGAGGCGGAGCTGTGG + Intergenic
1056679471 9:88704664-88704686 CAGCCCTGGGGGCCAACCTGGGG + Intergenic
1057054318 9:91949503-91949525 GGACCCTCGGGGCACATCTGCGG + Intronic
1057694002 9:97310879-97310901 TAACCCTGGATGCCCACCTGGGG - Intronic
1060343548 9:122797443-122797465 GAACCCAGAGGGTACACCTGGGG + Intergenic
1060941719 9:127546375-127546397 GAACCCAGGGTGCTCTGCTGTGG + Intronic
1061076670 9:128345544-128345566 GCCCCCTTGGGGCTCACCTGAGG - Exonic
1061465086 9:130771984-130772006 CAAGGCTGGCGGCTCACCTGAGG - Intronic
1061578807 9:131524217-131524239 GCACCTTGGGGGCTCCCCTGAGG + Exonic
1061582429 9:131546041-131546063 GAGCTCTGGGGGCGCCCCTGCGG + Intergenic
1062266265 9:135687812-135687834 GAGGCCGGTGGGCTCACCTGGGG + Intergenic
1062447997 9:136603762-136603784 GACCCCAGGAGGCTCACCTGTGG - Intergenic
1062500548 9:136850221-136850243 GAAGCCTGCGTGCTCAGCTGGGG - Intronic
1186877038 X:13827116-13827138 GAACCCGGGGTGCTCTGCTGAGG + Intronic
1187519390 X:20000405-20000427 GCTCCCTGTGGGGTCACCTGAGG - Intergenic
1197083001 X:122441077-122441099 GAGCCATGGGGGCTGGCCTGGGG + Intergenic
1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG + Exonic