ID: 1077062084

View in Genome Browser
Species Human (GRCh38)
Location 11:621938-621960
Sequence GGTGCACCTCACAACGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077062084_1077062099 26 Left 1077062084 11:621938-621960 CCCTCCCCGTTGTGAGGTGCACC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1077062099 11:621987-622009 GAGTGAGGTGCACCCCTCAACGG 0: 3
1: 0
2: 2
3: 9
4: 76
1077062084_1077062093 11 Left 1077062084 11:621938-621960 CCCTCCCCGTTGTGAGGTGCACC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1077062093 11:621972-621994 ATCCGTCCCCACCGTGAGTGAGG 0: 1
1: 0
2: 2
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077062084 Original CRISPR GGTGCACCTCACAACGGGGA GGG (reversed) Intronic
901439475 1:9268851-9268873 GGTGGAACTCACGACAGGGAGGG + Exonic
920969846 1:210733785-210733807 GGTGCACAACAAAATGGGGAAGG + Intronic
1076575257 10:131461588-131461610 TGTGCACCCCACAACAGGGCTGG - Intergenic
1077062084 11:621938-621960 GGTGCACCTCACAACGGGGAGGG - Intronic
1077200980 11:1307434-1307456 GGTGCCCCTCAGAACAGGAAGGG + Intronic
1113907690 13:113827594-113827616 GGTGCCCCTCACAACACCGAAGG + Intronic
1113907707 13:113827652-113827674 GGTGCCCCTCACAACACTGAAGG + Intronic
1114317505 14:21522373-21522395 GGTGCACCTACCAAAGGGAAAGG + Exonic
1129884350 15:79028183-79028205 GGTGCAGCTCAGCACTGGGAAGG + Intronic
1132479852 16:161630-161652 GTTGCACCTGTCAGCGGGGATGG + Intronic
1133960923 16:10492775-10492797 GGTTCAGCTGACAATGGGGAGGG - Intergenic
1143970563 17:10792242-10792264 GGTGCCCCTCACACAGGGCAGGG - Intergenic
1144686041 17:17227032-17227054 GGAGCACCTCAGACCTGGGAAGG - Intronic
1146599873 17:34205035-34205057 GTTGCACATCATAACGTGGATGG - Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1149550385 17:57535231-57535253 AGTGACCCTCACAATGGGGAGGG - Intronic
1149675080 17:58452720-58452742 GGTGCTCCTCACATCGCAGATGG - Intronic
1151341134 17:73471701-73471723 GGTCCACCTCACACCTGGGAAGG - Intronic
1153954337 18:10083392-10083414 GCTGCTCCTCCCAACGGGGGTGG + Intergenic
1154281450 18:13006893-13006915 TGAACACCTGACAACGGGGAGGG - Intronic
1154484219 18:14860289-14860311 GGTGCTCCTCACAACCCAGACGG + Intergenic
1162361213 19:10221601-10221623 GGTGCAGCTCACCTTGGGGAAGG - Intronic
925132831 2:1505433-1505455 GGTGCACCTGACATGGGGGTGGG - Intronic
925458518 2:4040367-4040389 GGTGCACCTCGCTTGGGGGAGGG - Intergenic
929501066 2:42492649-42492671 GGTGCCCCGGACAACGGGGTAGG + Intronic
934658646 2:96131605-96131627 GTAGCACCTCACAAAGGGGGAGG - Intronic
937382822 2:121396232-121396254 AGTACACCTCACAATGGGAAAGG + Intronic
938036775 2:128041275-128041297 GGTTCAGCTGACAATGGGGAGGG - Intergenic
946425759 2:219595424-219595446 AGTGGGCCTCACAAGGGGGAGGG + Intergenic
1170943373 20:20867631-20867653 GGTGCACCCCACATTGTGGAAGG + Intergenic
1172338053 20:34132951-34132973 GGTGCCCCTCACCACCCGGACGG - Intergenic
1179228489 21:39478315-39478337 GCTGCACCTCAGAACCGGGAAGG + Intronic
1179271131 21:39851826-39851848 GGTGCAGCTCACAGAGAGGATGG + Intergenic
1179367900 21:40775463-40775485 GGTGCACCTGACAACATGGAAGG - Intronic
1183135679 22:35884875-35884897 GTTTCATCTTACAACGGGGAAGG - Intronic
1183401843 22:37609267-37609289 GTTGCATCTCACACCCGGGAGGG + Intronic
1184029573 22:41883995-41884017 TGTGCACCTCTCATAGGGGAGGG + Intronic
1185136865 22:49078285-49078307 CATCCACCTCACAGCGGGGAGGG + Intergenic
949242628 3:1890215-1890237 GGTGCTCCTAACAACTGAGACGG + Intergenic
949609883 3:5693122-5693144 GGTTCAGCTGACAATGGGGAGGG + Intergenic
950949047 3:16980051-16980073 GGTGCCCCTCACCTCCGGGACGG + Intronic
954749082 3:52803733-52803755 GGGGGACCCCACAATGGGGAAGG + Intronic
961592548 3:127991514-127991536 GGTGAAGCTCACACCGTGGAAGG + Intergenic
969571512 4:8011519-8011541 TGTGATCCTCACAACGTGGAGGG - Intronic
978546369 4:109875876-109875898 GGTGCACCTCACCATGGATAGGG - Intergenic
987033634 5:13998246-13998268 GCTGCACCTCACATAGTGGAAGG + Intergenic
989794324 5:45447785-45447807 GGTTCACCTCAAAAAGGGGGAGG + Intronic
997693576 5:135844189-135844211 AGTGCACCTCAGCACGGGGCTGG + Intronic
1006946374 6:37787119-37787141 GGTCCACCTCAGATCTGGGATGG - Intergenic
1007270886 6:40636153-40636175 GGTGCACATCCCTACAGGGAGGG + Intergenic
1012433870 6:99193917-99193939 TGTGCACTTCACATCTGGGATGG + Intergenic
1012990573 6:105921853-105921875 GGTGCACATCCCAAGTGGGATGG + Intergenic
1017194911 6:151689606-151689628 GGTGCATCTCAAAACTGGCATGG - Intronic
1018215078 6:161518648-161518670 GGTTCACCTCACTAGGGGGCTGG - Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019120493 6:169800258-169800280 GGTGCACCTCCCAGCAGGAAAGG + Intergenic
1029521267 7:101064179-101064201 GGTGAACCGCATAACTGGGAAGG - Intergenic
1035565073 8:635804-635826 GCTGCACCCCACAGCAGGGACGG + Intronic
1040551053 8:48437881-48437903 GCTCCATCTCTCAACGGGGAGGG - Intergenic
1040644448 8:49382094-49382116 GGTGCACCTGGCCACGGGGAGGG - Intergenic
1042592184 8:70406529-70406551 GGTGCAGATCATAAAGGGGAAGG + Intergenic
1049481554 8:142826887-142826909 GGTACACCTCCCAGAGGGGATGG + Intergenic
1050167138 9:2777065-2777087 GGGACACCTCACACCAGGGAGGG + Intronic
1050989952 9:12137878-12137900 GGGACAACTCAAAACGGGGAAGG - Intergenic
1061143200 9:128780558-128780580 GGTGCCCCTCACCTCCGGGACGG - Intergenic
1062150834 9:135018319-135018341 GGTGCACGTGGCAAGGGGGAGGG - Intergenic
1062150930 9:135018670-135018692 GGTGCACCTGGCACAGGGGAGGG - Intergenic
1062150945 9:135018720-135018742 GGTGCACCTGGCACAGGGGAGGG - Intergenic
1185456925 X:315366-315388 GGTGCATCCCACAAAGGGTATGG - Intronic
1188214331 X:27458645-27458667 GGTGCTCCTCACATCCCGGACGG - Intergenic
1190950191 X:55135976-55135998 AGAGCAACTCACAACAGGGATGG - Intronic
1195659082 X:107360858-107360880 GGTGCACCTCCCAACTGGTCAGG + Intergenic