ID: 1077062646

View in Genome Browser
Species Human (GRCh38)
Location 11:624640-624662
Sequence CCACGTCCCGGAGGGCCAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077062646_1077062652 -9 Left 1077062646 11:624640-624662 CCTCCTGGCCCTCCGGGACGTGG 0: 1
1: 0
2: 4
3: 10
4: 184
Right 1077062652 11:624654-624676 GGGACGTGGATGTCCACCAGCGG 0: 1
1: 0
2: 0
3: 9
4: 84
1077062646_1077062653 -4 Left 1077062646 11:624640-624662 CCTCCTGGCCCTCCGGGACGTGG 0: 1
1: 0
2: 4
3: 10
4: 184
Right 1077062653 11:624659-624681 GTGGATGTCCACCAGCGGCTCGG 0: 1
1: 0
2: 0
3: 4
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077062646 Original CRISPR CCACGTCCCGGAGGGCCAGG AGG (reversed) Exonic
900578393 1:3395416-3395438 CCAGGTCTCGCAGGGGCAGGTGG + Intronic
905409935 1:37761669-37761691 CCACGTCCTGAAAGGCCAGGTGG + Exonic
905735690 1:40324278-40324300 CCACATCCCTCAGGGACAGGGGG + Intergenic
907644891 1:56232544-56232566 CATCGTTCCTGAGGGCCAGGTGG - Intergenic
909649718 1:77960407-77960429 CCAGGCCCTGGAGGCCCAGGAGG + Exonic
914667523 1:149843307-149843329 TCACGTCCCGGAGATCCAGACGG + Intronic
914668244 1:149850483-149850505 TCACGTCCCGGAGATCCAGACGG - Intronic
914908940 1:151769253-151769275 CCACCTCCCGGAGGGGGCGGTGG + Intronic
917969275 1:180196830-180196852 CGACATCCCTGAGGGCCAGCTGG + Exonic
920305387 1:205015184-205015206 CCACGTCCAGGAAGGACTGGGGG + Intronic
920669728 1:207993965-207993987 CCACAGCTAGGAGGGCCAGGAGG + Intergenic
921814166 1:219546062-219546084 CCACGTCCGGGAGGGAGATGGGG + Intergenic
922945179 1:229508148-229508170 CCACGCCCCGGACGGCTAGCAGG - Exonic
1063097410 10:2920721-2920743 TCCACTCCCGGAGGGCCAGGAGG + Intergenic
1065435388 10:25699830-25699852 CCACCTTCTGGAGGGCCAAGCGG + Intergenic
1066653803 10:37681674-37681696 CCAAGCCTCAGAGGGCCAGGAGG + Intergenic
1069521394 10:69124316-69124338 CCTCGTCCCGGAGCGCGCGGCGG + Intronic
1069535258 10:69248324-69248346 CCCAGTCCCGGAGGGCCCTGCGG - Intronic
1069625872 10:69867348-69867370 GCACGTCAGGGAGGGCCAGCAGG - Intronic
1070696969 10:78570766-78570788 CCAGGCCCCGGAGGGCCTGCGGG - Intergenic
1071224501 10:83512615-83512637 CCACCTCAGGCAGGGCCAGGGGG + Intergenic
1076182446 10:128420802-128420824 CCAAGTCTCTGACGGCCAGGTGG + Intergenic
1076494232 10:130886324-130886346 CCACGGCCCACAGGCCCAGGAGG - Intergenic
1076529133 10:131132926-131132948 CCACGTGCTGTGGGGCCAGGCGG + Intronic
1076657655 10:132035722-132035744 CCACGTCCATCAGGGCCAGCTGG - Intergenic
1076706788 10:132306870-132306892 ACACCTCCCGGGGTGCCAGGGGG - Intronic
1076875059 10:133211708-133211730 CCACCTCCAGGAGGCCCAGCAGG - Exonic
1077062646 11:624640-624662 CCACGTCCCGGAGGGCCAGGAGG - Exonic
1077311075 11:1889382-1889404 CCACATCCTGGAGGTCCGGGAGG + Exonic
1077334875 11:1998765-1998787 CCACATCCCAGAGGGCCTGCTGG - Intergenic
1083583738 11:63841253-63841275 CCAGGTGACAGAGGGCCAGGGGG - Intronic
1083662037 11:64255918-64255940 CCGGGTCCTGGAGCGCCAGGGGG + Intronic
1084657052 11:70525780-70525802 CCACATCCCTGGGGGCTAGGAGG - Intronic
1084749308 11:71193734-71193756 CCACGCCCCCGGAGGCCAGGAGG + Intronic
1085457647 11:76674242-76674264 CCACCTCCTGGAGGGGCAGGAGG + Intergenic
1089580890 11:119481519-119481541 CCACGCCGCGGTCGGCCAGGAGG + Intergenic
1202817858 11_KI270721v1_random:53947-53969 CCACATCCCAGAGGGCCTGCTGG - Intergenic
1096575893 12:52552726-52552748 CCACGTTGAGGGGGGCCAGGAGG + Exonic
1096585676 12:52618167-52618189 CCACGTTCAGGGGTGCCAGGAGG + Exonic
1097237664 12:57550778-57550800 CCACCTCCCGGAAGGTAAGGCGG + Intronic
1100079721 12:90833478-90833500 CCATGTTCCTCAGGGCCAGGAGG - Intergenic
1102475461 12:113185638-113185660 CCACGCTCCTGAGGCCCAGGAGG - Exonic
1103479121 12:121239586-121239608 CCAGTTTCTGGAGGGCCAGGTGG - Exonic
1104975091 12:132548675-132548697 TCAGGCCCCGGAGGGCGAGGAGG + Intronic
1106144138 13:27036678-27036700 CCATGTCCTGGAGGTCCAGAGGG + Intergenic
1110596598 13:77326802-77326824 CCTCGTCCCCGCGGGCCGGGCGG + Intronic
1112597415 13:100821100-100821122 CCTTGACCCAGAGGGCCAGGTGG + Intergenic
1113083015 13:106536343-106536365 CACCTTCCCGGGGGGCCAGGAGG - Intergenic
1113423281 13:110186456-110186478 CCATATCCTGGAGGCCCAGGGGG + Exonic
1113801072 13:113086451-113086473 CCACGTCCCAGAGAGCCCAGTGG - Intronic
1113933152 13:113979133-113979155 ACACGTTCCACAGGGCCAGGTGG + Exonic
1121573845 14:94967298-94967320 CAGCGTCCCAGAGGGCCAGGGGG - Intergenic
1122055581 14:99096095-99096117 CCGCGTCCAGGAGAGCCAGCAGG + Intergenic
1122262042 14:100529257-100529279 CCATGTCCAGGACTGCCAGGAGG - Intronic
1123494812 15:20814735-20814757 CCAAATCCCGGACGTCCAGGAGG + Intergenic
1123551307 15:21383828-21383850 CCAAATCCCGGACGTCCAGGAGG + Intergenic
1124596638 15:31096866-31096888 CACAGTCCCTGAGGGCCAGGAGG - Intronic
1128866020 15:71115668-71115690 CCGCGTCCCGGAGCGACCGGCGG - Intronic
1129153534 15:73703672-73703694 CCAGGTCCCTGAGGACCCGGTGG + Exonic
1129674198 15:77623520-77623542 CCACCTCCCCATGGGCCAGGAGG - Intronic
1130060524 15:80566573-80566595 ACACGTCTGGCAGGGCCAGGTGG - Intronic
1132209343 15:100008507-100008529 CCAGGGCCCGGGGGCCCAGGAGG + Intronic
1202959648 15_KI270727v1_random:111071-111093 CCAAATCCCGGACGTCCAGGAGG + Intergenic
1136373953 16:29853995-29854017 CCACGTCCCTGTAGGCCAAGGGG + Intergenic
1136578951 16:31140603-31140625 TCAGCTCCAGGAGGGCCAGGGGG + Exonic
1141990159 16:87604704-87604726 CCACATCCAGGAGTGGCAGGGGG + Intronic
1142237157 16:88927722-88927744 CCAGGCCCCGGAGGCCCAGCTGG + Intronic
1142613714 17:1123423-1123445 CGAAGCCCCGGAGCGCCAGGCGG + Intronic
1143011655 17:3869440-3869462 CCTTGTCCTGGAGGGCCTGGGGG - Intronic
1143309168 17:5974017-5974039 CCAAGTCTTGGAGAGCCAGGCGG + Intronic
1143796591 17:9342041-9342063 CCACGGCCTGGAGGGGAAGGGGG + Intronic
1144788160 17:17843222-17843244 CCAGGTCCCAGATGGGCAGGAGG - Intergenic
1146821443 17:35986144-35986166 CCATGTCCTTGAGGGCAAGGGGG + Intronic
1148793175 17:50184959-50184981 CCAGGTCCCCCAGGGCCTGGGGG + Exonic
1148794236 17:50189504-50189526 GCAGGACCAGGAGGGCCAGGGGG + Exonic
1151712207 17:75813283-75813305 CCTCCTCCCGGAGAGCCAGTGGG - Intronic
1152185485 17:78854044-78854066 CCAGGTCCCGGTGGGCATGGGGG + Exonic
1152690729 17:81716610-81716632 CCTCCTCCCTGAGGGCCGGGCGG + Intronic
1152699621 17:81812485-81812507 CCACCTGCAGGAGGGTCAGGTGG + Intronic
1153040877 18:812210-812232 CCTCGTCCCGGGGCGCCCGGCGG + Intronic
1154198162 18:12281011-12281033 TCAAGTCCCAGTGGGCCAGGAGG + Intergenic
1156344323 18:36241989-36242011 TCACGGCCCGGAGGCCTAGGAGG - Intronic
1157496535 18:48161206-48161228 CCAAGACCCAGAGGGCCTGGGGG + Intronic
1157753079 18:50195195-50195217 CCCCGGCCCGGAGGCCCAGGTGG - Intergenic
1158327265 18:56325396-56325418 CCACATCCAGGAGGGCCTGAGGG + Intergenic
1160174409 18:76580690-76580712 CCACCCCCCAGAGGCCCAGGTGG - Intergenic
1160370170 18:78365545-78365567 CCACTGCCCTGAGGACCAGGTGG - Intergenic
1160756057 19:757657-757679 CCACGTGCCCGTTGGCCAGGTGG - Exonic
1160779427 19:871299-871321 GCACGTCCCGGGTGGCCGGGCGG - Intronic
1160958576 19:1706760-1706782 CCAGGGCCCGGGAGGCCAGGTGG - Intergenic
1161992216 19:7690402-7690424 CCACAGCCCGGAGGAGCAGGTGG - Exonic
1162410467 19:10502557-10502579 CCAGGACTCGGAGGGCCAGGAGG - Intronic
1162856631 19:13473656-13473678 CAAGTTCCAGGAGGGCCAGGAGG + Intronic
1162992877 19:14314724-14314746 CCTCATCCCGGAGACCCAGGGGG - Intergenic
1163035021 19:14565092-14565114 GCAGGTCCCGCAGGGCCATGTGG - Exonic
1165376986 19:35449789-35449811 CAAAGGCCCGCAGGGCCAGGAGG - Exonic
1166873582 19:45884601-45884623 CCCCGAGCCGGAGGGCGAGGCGG - Exonic
1166996791 19:46723246-46723268 CCACGTCCTGGAGGGCCACGGGG - Exonic
1168197830 19:54788551-54788573 CCACGACTTGGAGGCCCAGGTGG + Intronic
925287920 2:2727770-2727792 CCACGTCCCTGAGAGCCATGGGG - Intergenic
926130715 2:10302174-10302196 CCCCCTCCCCGAGAGCCAGGAGG + Intergenic
927143121 2:20143048-20143070 CCACATCCCCTAGGGCGAGGTGG + Intergenic
929516186 2:42606076-42606098 CCCCGTCCGGGAGGGAGAGGGGG - Intronic
929756350 2:44768669-44768691 CCGCGTCCCGGAGCCCCGGGCGG - Intronic
929777684 2:44938953-44938975 CCAGGACCCGGTGGGGCAGGTGG - Intergenic
931851220 2:66252221-66252243 GCCCCTCCCGGAGAGCCAGGAGG + Intergenic
933751170 2:85602740-85602762 CCACGTCCCGGCGGGCGGCGCGG - Intronic
935340076 2:102051860-102051882 GCACGTGCTGGAGGGCCTGGTGG + Intergenic
936107159 2:109634417-109634439 TCACATCACTGAGGGCCAGGAGG + Intergenic
937067265 2:119026802-119026824 CCAAGTCCCAGAGGTCCAGCTGG - Intergenic
938199077 2:129358279-129358301 GCACGTCCTGGAGGTTCAGGAGG - Intergenic
942491199 2:176490924-176490946 CCTCCACTCGGAGGGCCAGGAGG + Intergenic
946177422 2:217930039-217930061 CCAGGTCCCGAAGGGCCTGATGG - Intronic
946421364 2:219566974-219566996 TAACGAGCCGGAGGGCCAGGTGG - Exonic
947148346 2:227088753-227088775 GGAAGTCCTGGAGGGCCAGGGGG + Exonic
947992371 2:234497377-234497399 CTGCGGCCCGGAGGGGCAGGGGG - Intergenic
948061354 2:235045084-235045106 CCAGGTTCTGGAGAGCCAGGAGG - Intronic
948479058 2:238239318-238239340 CCGCGTCCCCGCGGGCCGGGTGG - Intronic
1168896620 20:1328215-1328237 CCAGATCCTGGAGGGCCTGGAGG + Intronic
1170572617 20:17641043-17641065 ACCAGTCCCAGAGGGCCAGGGGG + Intronic
1171249559 20:23637811-23637833 CCACGGCCAGGATGGCCAGCAGG + Exonic
1178922480 21:36747771-36747793 CCCCGTCCCGGGCGGCCTGGCGG - Exonic
1179610316 21:42545902-42545924 CAACATGCCGTAGGGCCAGGTGG - Intronic
1179804033 21:43826000-43826022 CCCCATCCCGGAGGGCAGGGCGG - Intergenic
1179928345 21:44550665-44550687 CCATGTCCCCCAGGGCCAGCCGG - Exonic
1179937112 21:44612917-44612939 GCACGTCCCCCAGGGCCAGCCGG + Exonic
1180079906 21:45481966-45481988 TCTCTTCCCGGAGGGCCTGGGGG - Exonic
1180962221 22:19767095-19767117 CCCCGGCCCCGAGGGCCAAGGGG + Exonic
1181546492 22:23605450-23605472 CCACCTCCCCGAGCACCAGGTGG - Intergenic
1182006988 22:26969140-26969162 CCACAACCGGAAGGGCCAGGAGG + Intergenic
1184188441 22:42879447-42879469 CCACCTCCCAGAGGACCAGCGGG + Intronic
1184487963 22:44792522-44792544 CCACGCCCTGGAGGAGCAGGAGG - Intronic
1184679226 22:46061471-46061493 TCGCGCCCCGGAGGCCCAGGCGG - Intronic
1184743244 22:46441357-46441379 CCACGCTCCGGACGGCCAGTGGG + Intronic
1184991241 22:48171437-48171459 CCTCTTCCAGGAGGGTCAGGAGG - Intergenic
1185365522 22:50434890-50434912 CCACGACCCAGAGAGCCAAGTGG - Intronic
953137082 3:40190354-40190376 CCACAGACCGGCGGGCCAGGAGG + Exonic
953931711 3:47009061-47009083 CCACGTGCTGGTGGGCCTGGAGG + Exonic
961163654 3:124750027-124750049 CCCCGTCCCGGAGGGAGGGGGGG - Intergenic
962346563 3:134623367-134623389 CCACTTCACGGCAGGCCAGGTGG + Intronic
968085723 3:195873101-195873123 CCACCTCCCGGAAGGCCTGCGGG + Intronic
968909838 4:3472134-3472156 CCACAGCCCGCAGAGCCAGGGGG - Intronic
969300272 4:6293318-6293340 CCCTGTCCCTGAGGGCCTGGCGG - Intronic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
976602387 4:86949938-86949960 GCAGGTCCCGCAGGGCCATGTGG + Intronic
987122849 5:14784011-14784033 CCAGGGCCCTGAGGGCAAGGTGG - Intronic
989655771 5:43745842-43745864 CCACTTCCCAGAGGGGCAGCTGG + Intergenic
997598841 5:135125887-135125909 CCATGTCCAGGAATGCCAGGTGG + Intronic
998385819 5:141756582-141756604 GCAGGTCCCTGAGGGCCTGGAGG - Intergenic
1001445621 5:171780390-171780412 CCAGTTCTCTGAGGGCCAGGTGG + Intergenic
1002180091 5:177426812-177426834 GCGCGGCCCGGCGGGCCAGGCGG + Intronic
1002897680 6:1389150-1389172 ACTCGGCCCGGCGGGCCAGGAGG + Intergenic
1006295988 6:33170354-33170376 CGAGGTCCTGGGGGGCCAGGTGG + Exonic
1007115474 6:39340124-39340146 CCAGGTCCCAAAGGGCCAGCAGG - Intronic
1010030431 6:71266482-71266504 TCACCTCCCGGACGGGCAGGTGG + Intergenic
1012499580 6:99874225-99874247 CACCATCCCTGAGGGCCAGGAGG - Intergenic
1017282260 6:152637276-152637298 CCACCTCCCGGGGGTCGAGGTGG + Exonic
1018669419 6:166167100-166167122 CCACATCCCGCGGGGACAGGCGG + Intronic
1019156962 6:170045696-170045718 CCACGACCCTGAGGGCCTGCTGG + Intergenic
1019210122 6:170398004-170398026 CCACCTTCCTGAGGCCCAGGGGG - Intronic
1019257622 7:62049-62071 CCCCTTCCCTGAGGGACAGGAGG + Intergenic
1019358240 7:592070-592092 CCACCTCACGGAGGCCCTGGTGG - Intronic
1019373593 7:676820-676842 CTACCTCCCCGAGGGCAAGGAGG + Intronic
1019373615 7:676878-676900 CCACCTCCCGGAGGGCAAGGAGG + Intronic
1019373636 7:676936-676958 CCACCTCCCGGAGGGCAAGGAGG + Intronic
1019373657 7:676994-677016 CCACCTCCCGGAGGGCAAGGAGG + Intronic
1019373712 7:677168-677190 CCACCTCCCGGAGGCCGAGGAGG + Intronic
1020006365 7:4785509-4785531 CCATGTCCCGCAGTGCCTGGTGG + Exonic
1024472158 7:49775407-49775429 CCACGTCCCGGCGGGCGGGCGGG - Exonic
1025859541 7:65313669-65313691 CCAAGTCCAGGAGGGACAGAAGG - Intergenic
1026036397 7:66833149-66833171 CACCATCCTGGAGGGCCAGGGGG - Intergenic
1028755372 7:94427639-94427661 GGAGGTCCAGGAGGGCCAGGGGG - Exonic
1029113014 7:98223106-98223128 ACACGTCCCTGAGGGCGATGGGG + Exonic
1030649633 7:112103411-112103433 CCATGTTCCTGAGAGCCAGGGGG + Intronic
1034349759 7:150408178-150408200 CCACGGGCCCGAGGGCCAGGCGG + Intronic
1035469835 7:159102705-159102727 ACACCTCCAGGAGGGGCAGGCGG + Intronic
1035764903 8:2098314-2098336 CAGCGTCCCTGAGGGCCCGGTGG + Intronic
1036429311 8:8675080-8675102 CCAGGTTCTGGAGGGCCATGGGG + Intergenic
1037817705 8:22120654-22120676 CCAAGGCCCCGAGGGGCAGGTGG + Intronic
1037837267 8:22221568-22221590 CAATGTCCAGGAGGGGCAGGCGG + Exonic
1038822461 8:30965430-30965452 CCACCTCCCTGAGAGCCAAGAGG + Intergenic
1045299978 8:100902554-100902576 GCATGTCCCAGAGGTCCAGGCGG + Intergenic
1045318273 8:101061916-101061938 CCACGTCCCAGAGTTCCAGGAGG + Intergenic
1047194875 8:122712451-122712473 CCTCCTCCCAGAGGCCCAGGAGG + Intergenic
1047724236 8:127670424-127670446 CCACGTCACGTAGGGCCTGGTGG - Intergenic
1049776620 8:144408972-144408994 CCACGTCGCGGACAGCCGGGAGG + Intronic
1051368611 9:16339384-16339406 CCAGATCCCTGAGGGTCAGGAGG - Intergenic
1051499254 9:17759130-17759152 TCACCTCCCTGTGGGCCAGGTGG + Intronic
1056763932 9:89433321-89433343 TCACTTCCAGGGGGGCCAGGCGG + Intronic
1060945792 9:127568862-127568884 GCACGTCCCCCATGGCCAGGAGG + Exonic
1061207637 9:129173994-129174016 CCACGTCGAGGAGGGGCACGTGG - Intergenic
1189322835 X:40096940-40096962 GCGCCTCCCGGTGGGCCAGGAGG - Intronic
1190745694 X:53320781-53320803 CCACGTCCCGGGCCGCCTGGTGG + Exonic
1193397679 X:81004136-81004158 CCAGGGGCCGGAGGGCCTGGAGG + Intergenic
1194976600 X:100402760-100402782 CCACATCCCGGGGTACCAGGCGG + Exonic
1195790894 X:108584505-108584527 ACAAGTCCAGGAGGTCCAGGTGG - Exonic
1199606876 X:149585242-149585264 CCACCTCCCGGAGACCCGGGAGG + Intronic
1199632247 X:149784126-149784148 CCACCTCCCGGAGACCCGGGAGG - Intronic
1200125707 X:153813424-153813446 CCACCACCAGGAGGACCAGGAGG + Intronic