ID: 1077065031

View in Genome Browser
Species Human (GRCh38)
Location 11:637276-637298
Sequence GCGGTGCTCAGCGCCCGCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077065020_1077065031 19 Left 1077065020 11:637234-637256 CCCGAGGGGAGGGACTCCCCGGC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG 0: 1
1: 0
2: 2
3: 18
4: 152
1077065017_1077065031 29 Left 1077065017 11:637224-637246 CCGGGGCGTGCCCGAGGGGAGGG 0: 1
1: 0
2: 1
3: 22
4: 252
Right 1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG 0: 1
1: 0
2: 2
3: 18
4: 152
1077065021_1077065031 18 Left 1077065021 11:637235-637257 CCGAGGGGAGGGACTCCCCGGCT 0: 1
1: 0
2: 1
3: 9
4: 158
Right 1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG 0: 1
1: 0
2: 2
3: 18
4: 152
1077065027_1077065031 -10 Left 1077065027 11:637263-637285 CCCGGCGTTGTCCGCGGTGCTCA 0: 1
1: 0
2: 3
3: 10
4: 54
Right 1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG 0: 1
1: 0
2: 2
3: 18
4: 152
1077065025_1077065031 1 Left 1077065025 11:637252-637274 CCGGCTTGCGACCCGGCGTTGTC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG 0: 1
1: 0
2: 2
3: 18
4: 152
1077065023_1077065031 3 Left 1077065023 11:637250-637272 CCCCGGCTTGCGACCCGGCGTTG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG 0: 1
1: 0
2: 2
3: 18
4: 152
1077065024_1077065031 2 Left 1077065024 11:637251-637273 CCCGGCTTGCGACCCGGCGTTGT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG 0: 1
1: 0
2: 2
3: 18
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077065031 Original CRISPR GCGGTGCTCAGCGCCCGCCC GGG Exonic
900173485 1:1281735-1281757 GGGGTGCTCTGCCCCCGGCCAGG + Intronic
900265708 1:1756032-1756054 GGGGTGGCCAGCGCCCGCCTGGG - Intronic
900301550 1:1980527-1980549 CCGGTCCTCAGCGCCTGCGCAGG - Intronic
901361300 1:8703208-8703230 GCGGTGCCCTGCGGCCGCTCAGG - Intronic
903658962 1:24965478-24965500 GCGGGGCTCCTAGCCCGCCCAGG - Intergenic
904130563 1:28272533-28272555 GAGCTGCTCAGTGCCTGCCCTGG - Intronic
905011329 1:34748948-34748970 GAGGTGCTCAGAGCCCTGCCTGG - Intronic
906528700 1:46511194-46511216 GGGGTCCTCAGCCCCTGCCCTGG - Exonic
907472101 1:54680548-54680570 GCGGTGCTGAGTGCCTGCTCAGG + Intronic
910655005 1:89610193-89610215 GCTGTGCTCAGCACCCGCCTCGG + Intergenic
912459992 1:109824098-109824120 GAGGTCCTCAGCACCCGGCCCGG + Intergenic
913186428 1:116373772-116373794 GGGGCGCGCAGCCCCCGCCCAGG - Intronic
913972468 1:143424816-143424838 GCGGTGCCCCCGGCCCGCCCGGG - Intergenic
915213374 1:154325672-154325694 TCAGCGCTCGGCGCCCGCCCCGG - Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
1063200853 10:3784733-3784755 GCTGCGATCAGCGTCCGCCCAGG - Intronic
1063395674 10:5685082-5685104 GCCGTGCTCTGCGTCCTCCCGGG - Exonic
1072067789 10:91887326-91887348 GCGGAGCTCAGGGCCGGCCCGGG + Intergenic
1074826177 10:117216984-117217006 GCGGTGCGAAGTGCCCGTCCCGG - Intergenic
1076450977 10:130556775-130556797 GCGGTGCAGAGCGCTGGCCCTGG - Intergenic
1076737638 10:132465895-132465917 GTGGTGCTCAGCGCCATACCTGG - Intergenic
1077065031 11:637276-637298 GCGGTGCTCAGCGCCCGCCCGGG + Exonic
1081981464 11:47269720-47269742 GCGGTGCTCGGCGTCCGAGCAGG - Exonic
1084546523 11:69817724-69817746 GCGGCGCTCGGCTCCGGCCCCGG - Intronic
1088231582 11:107678514-107678536 GCCCTGGTCAGCGCCAGCCCAGG - Intergenic
1090616832 11:128522468-128522490 GCGGTGCTCGGCCCCGCCCCCGG - Intronic
1090873627 11:130769604-130769626 TCGGTGCTCAGTGCCCTGCCGGG - Intergenic
1094441701 12:30485333-30485355 GCAGTGCTCAGCAGCCGGCCAGG - Intergenic
1096521405 12:52186746-52186768 GCTGGGCTCAGAGCCCTCCCAGG - Intronic
1096523962 12:52199752-52199774 GCAGTGCTCAGCGCCACCCTGGG - Intergenic
1102197117 12:111033886-111033908 GGGGAGCTCGGCGCCCGCCCGGG - Intergenic
1106539079 13:30674188-30674210 GAGGTGCCCAGCGGCCGCCGCGG + Intergenic
1113655794 13:112067279-112067301 GCGGTGCGCTGGGCCCGGCCCGG - Intergenic
1113958255 13:114110913-114110935 GCGTGGCTCAGCCCCCGACCGGG - Intronic
1115906694 14:38209478-38209500 GCCGTCCGCAGCGCCGGCCCCGG - Exonic
1116887049 14:50231661-50231683 CCGCTGCTCACCGCCCGCCGCGG - Intergenic
1118641751 14:67798902-67798924 GCGGAGCTCAGCGCCCTCCCCGG - Intronic
1119182707 14:72615202-72615224 GTGGTCCTCAGGGCCCGCCCTGG + Intergenic
1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG + Exonic
1124629571 15:31328623-31328645 TGGAGGCTCAGCGCCCGCCCTGG - Intronic
1129038663 15:72665943-72665965 GGGGTGCTCAGCTCCCACCCTGG - Intronic
1129211228 15:74071287-74071309 GGGGTGCTCAGCTCCCACCCTGG + Intronic
1129220281 15:74128386-74128408 GCGGGAGTCAGCTCCCGCCCAGG + Exonic
1129399175 15:75269800-75269822 GGGGTGCTCAGCTCCCACCCTGG - Intronic
1129402782 15:75294076-75294098 GGGGTGCTCAGCTCCCACCCTGG - Intronic
1130108227 15:80944925-80944947 TGGGTGCCCAGCGCCAGCCCAGG - Intronic
1131272807 15:90957196-90957218 GCGGTGCTGCGCGCCGGGCCGGG + Exonic
1131508274 15:93034711-93034733 TCGGAGCTCAGCGCCTGTCCTGG - Intergenic
1132522573 16:398235-398257 GCGGAGCTCAGCGCTGACCCTGG + Intronic
1133156607 16:3880560-3880582 CCGGCCCTCGGCGCCCGCCCCGG - Exonic
1133513563 16:6483952-6483974 ACTGTGCTCAGGGCTCGCCCTGG + Intronic
1136071055 16:27787386-27787408 CTGGTTCTCAGCCCCCGCCCAGG + Intergenic
1140512234 16:75516897-75516919 GCGGTGGTCCGCGCCCTGCCTGG - Intergenic
1141608652 16:85169461-85169483 GCCGCCCTCAGCTCCCGCCCAGG - Intergenic
1141749518 16:85948707-85948729 TCGGTCCTCAGTGCCCTCCCAGG - Intergenic
1141858559 16:86701246-86701268 GTGGTTCTCAGCGCCCTCCGAGG + Intergenic
1142130804 16:88430709-88430731 GCGGTCCTCAGCTCCGGGCCGGG - Intronic
1142509642 17:385762-385784 GCGTTTCCCAGCGCCCGCCCCGG - Intronic
1142586717 17:979038-979060 GTGCTGCGCTGCGCCCGCCCTGG - Intronic
1142597497 17:1036631-1036653 GGGGTGCCCAGCGCCCACACAGG + Intronic
1142764021 17:2055952-2055974 GCTGTGCGCCGTGCCCGCCCGGG + Intronic
1147123684 17:38351880-38351902 GCGGAGCCCAGCGCGAGCCCAGG - Intergenic
1147934653 17:44004796-44004818 GCGGTGCTGAGCCGGCGCCCCGG - Exonic
1148491274 17:48025317-48025339 GCAGTGCTCAGCGCACTCCAGGG + Intergenic
1148577024 17:48719439-48719461 GCGGGGCTCGGCAGCCGCCCTGG + Intergenic
1152048921 17:77958152-77958174 GCGGCGCCCGGCGCCCGCACCGG - Intergenic
1152102958 17:78313748-78313770 GCGGTGCTTAGGGCCCTGCCTGG - Intergenic
1152727738 17:81955934-81955956 GCAGAGCTCAGCACCCTCCCAGG + Intronic
1152786090 17:82248838-82248860 CCGAGGCCCAGCGCCCGCCCGGG + Intronic
1154377947 18:13824184-13824206 GCGGCGCTCAGAGCCAGCCCCGG - Intronic
1154445349 18:14431252-14431274 GCGCTGCACTGCGCCGGCCCTGG - Intergenic
1157248271 18:46072107-46072129 GCGGGGCTCAGGACCCGGCCCGG - Intronic
1160014841 18:75132772-75132794 GCGGTCCCCAGGGCCAGCCCGGG - Intergenic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
1160747532 19:719103-719125 GCTGGGCTCGGCGCCTGCCCGGG + Intronic
1160775471 19:853222-853244 GCGGGGCTCAGGGGCGGCCCCGG - Intronic
1161108414 19:2455769-2455791 GCGGTGGGCAGGGCCTGCCCAGG + Intronic
1161270784 19:3388151-3388173 GCGGTGGGCAGAGCCCGGCCCGG + Intronic
1161575843 19:5053829-5053851 GCAGCGCTCAGCACCAGCCCAGG + Intronic
1162445106 19:10718137-10718159 CCGTTGCTCCCCGCCCGCCCGGG - Exonic
1163695691 19:18762199-18762221 CAGGTCCCCAGCGCCCGCCCGGG + Intronic
1163945187 19:20529749-20529771 GGGGGGCTCAGCCCCCGGCCCGG - Intergenic
1165129128 19:33621529-33621551 GCTGTGGTCAAGGCCCGCCCCGG + Intergenic
1166084695 19:40467104-40467126 GCCGCGCTCAGCGCGCCCCCGGG - Intronic
1166809686 19:45507809-45507831 GCGGGGCGCGGAGCCCGCCCGGG - Intronic
1168572634 19:57483368-57483390 GGGGGGGTCAGCCCCCGCCCCGG + Intergenic
927882340 2:26697620-26697642 GCTGTGCCCAGCACCCGCCATGG + Intronic
927938037 2:27086333-27086355 GCGGTGGGCGGCGCCCGCGCGGG - Exonic
928096884 2:28410316-28410338 GCGCTCCTCACCACCCGCCCCGG + Intronic
929539851 2:42811061-42811083 GCGGTGCTTGGGCCCCGCCCGGG - Intergenic
934177136 2:89585607-89585629 GCGGTGCACAGCGCGGGCGCAGG - Intergenic
934177168 2:89585783-89585805 GCGGTGCCCCTGGCCCGCCCGGG - Intergenic
934287443 2:91659966-91659988 GCGGTGCACAGCGCGGGCGCAGG - Intergenic
934287470 2:91660096-91660118 GCGGTGCCCCTGGCCCGCCCGGG - Intergenic
937221786 2:120346201-120346223 GCGGCCCCCAGCGCCCGACCGGG - Exonic
941701212 2:168606073-168606095 GCAGTGCTCACTGCCAGCCCTGG + Intronic
942046252 2:172101045-172101067 GCGGTGGGCAGCGAGCGCCCTGG + Intronic
948574837 2:238943051-238943073 GGGGTGCTCCACGCCCACCCTGG - Intergenic
948720693 2:239898325-239898347 GAGGTGCTCAGCCTGCGCCCGGG + Intronic
948836642 2:240629190-240629212 GTGCTGCTCAGGGGCCGCCCAGG - Intronic
1170473484 20:16691149-16691171 GGGGTGCTGAGCACCCACCCAGG + Intergenic
1171892500 20:30728821-30728843 GCGGTGCTAGGCGCCTGCGCAGG - Intergenic
1172389720 20:34558746-34558768 GCCGTGCTCAGCGCGAGCCCCGG + Intronic
1174204245 20:48827757-48827779 GCGGCGCCCAGCTCCGGCCCCGG - Exonic
1175448540 20:59043001-59043023 GCGCAGCACAGCGCCCGCGCCGG - Intergenic
1175767496 20:61601501-61601523 GCGGTGCTCCTCGTCAGCCCCGG + Intronic
1175773350 20:61637362-61637384 TGGGTGCTCAGTGCCCACCCTGG + Intronic
1176450635 21:6858610-6858632 GCGCTGCCCTGCGCCGGCCCTGG + Intergenic
1176828805 21:13723628-13723650 GCGCTGCCCTGCGCCGGCCCTGG + Intergenic
1178075828 21:29012167-29012189 GGGGTGGTCAGCCCCCCCCCGGG + Intronic
1178485871 21:33020004-33020026 GGGCTGCGCAGCGCGCGCCCGGG - Intergenic
1179260169 21:39750905-39750927 GCACTGCTCAGCTCCCGCCCTGG - Intronic
1180019130 21:45109559-45109581 ACGGGGCTCTGCGCCCCCCCAGG + Intronic
1180074582 21:45456121-45456143 GTGGTGCCCAGGGCCTGCCCAGG - Exonic
1180109767 21:45642557-45642579 GCGGCGCTGAGCGCCCGCCCCGG - Intergenic
1182294800 22:29306682-29306704 GCCGTGCTGTGCGCCAGCCCGGG + Intronic
1182380424 22:29883268-29883290 GCGCTGCCCAGCGCCGGCCCTGG + Exonic
1183172282 22:36197263-36197285 GCTCTGCTCAGGGGCCGCCCTGG - Intronic
1184367702 22:44063002-44063024 CTGGTGCTCAGCCCCCACCCAGG + Intronic
1184694853 22:46133555-46133577 GCAGCGCTCAGCTCCCTCCCCGG + Intergenic
1185054863 22:48574347-48574369 GCGGTGCCCAGCAGCCGGCCAGG - Intronic
954301996 3:49705107-49705129 GAGGTGCTCAGAGGCCGCCGTGG - Exonic
954419814 3:50412891-50412913 GGGGTGCCCAGCACCCCCCCAGG - Intronic
954692009 3:52400659-52400681 GAGATGCCCAGCGCCCTCCCAGG + Intergenic
954717414 3:52533578-52533600 CCCGCGCTCCGCGCCCGCCCAGG - Exonic
961739178 3:129022018-129022040 GCAGAGCTCTGCGCCTGCCCCGG - Intronic
968478972 4:825706-825728 GCAGTGGACAGCGCCCGCCCCGG + Intronic
968661491 4:1800572-1800594 ACGGTGCTGAGCTCCCTCCCAGG - Intronic
969671872 4:8594136-8594158 GCTGTGCTCAGCACCTGCCAGGG - Intronic
974335931 4:60544327-60544349 GCCGTGCTCAGTGGCAGCCCAGG - Intergenic
982207186 4:153005612-153005634 GGTCTACTCAGCGCCCGCCCTGG + Intergenic
985638836 5:1053671-1053693 CCGCTGCTGAACGCCCGCCCTGG - Intronic
985671503 5:1209183-1209205 GCGGCGCTCAGCGAGAGCCCAGG + Intronic
985676129 5:1232186-1232208 GGGGTGGTCAGCACCTGCCCAGG - Intronic
985757587 5:1728267-1728289 GCAGTGCTCTGCGCTAGCCCAGG + Intergenic
1001637026 5:173217796-173217818 GAGGAGCTCAGGGCCCACCCTGG - Intergenic
1005882372 6:30071285-30071307 GCGGTGTTGAGCCCCCGCCGCGG - Exonic
1006105020 6:31711248-31711270 CCTGTGCTCAGCTCCCACCCGGG + Intronic
1006393173 6:33770814-33770836 CAGGTGCTCAGCACCAGCCCTGG - Intergenic
1007622943 6:43225955-43225977 GCGGTGCTCAGAGCCCACCAGGG + Intronic
1019045057 6:169139482-169139504 GAGCTGCTCAGCACCGGCCCTGG - Intergenic
1019794969 7:3042885-3042907 GCGGTGCTCAGAGCCCCCGAGGG + Intronic
1023435123 7:40134456-40134478 GCCGTGGTCCGCCCCCGCCCGGG + Exonic
1028171405 7:87600920-87600942 GCTGTGCTCAGCCCACGCCCCGG + Exonic
1034306623 7:150048921-150048943 GCGGGGCGCAGCGCCCGCGAGGG - Intergenic
1034964313 7:155382290-155382312 GCGGTGCCCAGCGCGCGCCAGGG - Exonic
1035265983 7:157690563-157690585 CCGGCGCCCAGCGCCCGCGCGGG + Intronic
1035388411 7:158489662-158489684 GCCGTGCGCAGCGCCCAGCCTGG - Intronic
1037262709 8:17026849-17026871 GCTGGGCTCAGCGCCCGTCTGGG - Intergenic
1037928637 8:22864827-22864849 GCGGTGCCCAGCGGCCCCCGTGG - Intronic
1039531826 8:38269255-38269277 GCGGTGCCCAGTTCCCGGCCCGG - Intronic
1041174114 8:55176258-55176280 GCAGTGCTCAGCCCCAACCCTGG - Intronic
1044819411 8:96145576-96145598 CCGGTGCTCTTCGGCCGCCCCGG + Intronic
1049354415 8:142180392-142180414 GCCCTGCCCACCGCCCGCCCAGG - Intergenic
1049380742 8:142314575-142314597 GCAGAGCTCAGCCCCGGCCCCGG - Intronic
1049380758 8:142314647-142314669 GCAGAGCTCAGCCCCGGCCCTGG - Intronic
1049707775 8:144050791-144050813 GAGGTGCTCAGCGCGGTCCCTGG - Intergenic
1049805281 8:144536079-144536101 GCAGTGCCCATCGCCAGCCCAGG + Intronic
1049845508 8:144798978-144799000 GCGGTCCTCCGAGCCCGGCCTGG + Intronic
1049867885 8:144950656-144950678 GCGCGGCTCCGCCCCCGCCCGGG + Intronic
1056078245 9:83062907-83062929 GCGGGGCGCAGGGCCCTCCCTGG + Exonic
1060722640 9:125989115-125989137 GGGGTGCTCAGGGACCGCCCAGG + Intergenic
1061839146 9:133347693-133347715 GCGGTGCTCAGGGAGGGCCCGGG + Exonic
1062289489 9:135788172-135788194 GCGGTGGTCGGCACCCGCCAGGG - Intronic
1203518547 Un_GL000213v1:25907-25929 GCGCTGCCCTGCGCCGGCCCTGG - Intergenic
1186466304 X:9786544-9786566 GCGGGGCTCGGCGCCCTCCATGG - Exonic
1186660780 X:11665600-11665622 GCGGCGCTCAGCGCTCTCCGTGG + Exonic
1190339614 X:49286311-49286333 GCGCTGTTCAGGGCCCGCTCAGG - Exonic
1191129676 X:56994885-56994907 GCCGTGGCCAGCGCCCGTCCTGG + Exonic
1195200856 X:102548456-102548478 CCTGTGCCCGGCGCCCGCCCGGG + Intergenic
1196735038 X:118975459-118975481 GTGGTGCTCAGCGGCCTCCTCGG + Exonic
1200104746 X:153706078-153706100 GCCCTGCTCAGCCCCAGCCCAGG + Intronic
1200154612 X:153968922-153968944 GTGGTGCCCCGCGCCAGCCCAGG - Intronic