ID: 1077065033

View in Genome Browser
Species Human (GRCh38)
Location 11:637287-637309
Sequence CGCCCGCCCGGGCGCGCCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077065020_1077065033 30 Left 1077065020 11:637234-637256 CCCGAGGGGAGGGACTCCCCGGC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065029_1077065033 -10 Left 1077065029 11:637274-637296 CCGCGGTGCTCAGCGCCCGCCCG 0: 1
1: 1
2: 0
3: 13
4: 178
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065023_1077065033 14 Left 1077065023 11:637250-637272 CCCCGGCTTGCGACCCGGCGTTG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065027_1077065033 1 Left 1077065027 11:637263-637285 CCCGGCGTTGTCCGCGGTGCTCA 0: 1
1: 0
2: 3
3: 10
4: 54
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065028_1077065033 0 Left 1077065028 11:637264-637286 CCGGCGTTGTCCGCGGTGCTCAG 0: 1
1: 0
2: 2
3: 7
4: 57
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065024_1077065033 13 Left 1077065024 11:637251-637273 CCCGGCTTGCGACCCGGCGTTGT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065021_1077065033 29 Left 1077065021 11:637235-637257 CCGAGGGGAGGGACTCCCCGGCT 0: 1
1: 0
2: 1
3: 9
4: 158
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065025_1077065033 12 Left 1077065025 11:637252-637274 CCGGCTTGCGACCCGGCGTTGTC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077065033 Original CRISPR CGCCCGCCCGGGCGCGCCAT GGG Exonic
900549628 1:3247752-3247774 CGCCCGTCCTGGTGCGCCCTGGG + Intronic
903366178 1:22806699-22806721 GGGCCGCCCAGGCGCGCCCTCGG - Intronic
904160436 1:28518643-28518665 CGGCCGCCCGGGCGGGGGATGGG + Intronic
905449209 1:38046359-38046381 GGCCCACGCGGGCGCGGCATGGG - Exonic
906214384 1:44030528-44030550 CGGCCGCCCGGCCCCGCCCTAGG + Intronic
911498854 1:98661774-98661796 CTCCCGGCCGGGGGCGCCAACGG + Exonic
913323343 1:117605962-117605984 CGCCCTCCCGGGGGAGCCAGGGG - Exonic
922196487 1:223364220-223364242 CGCCCGCTCGGGGGCGCCTGGGG - Intergenic
1073241963 10:102065197-102065219 CGCCCGCCCGGGCACGCTCTCGG - Intergenic
1076554357 10:131311956-131311978 AGCCCAGCCGGGCGCGCCCTCGG - Intergenic
1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG + Exonic
1079023247 11:16925619-16925641 CGCGAGCCCGGGCGGGCCACCGG + Intronic
1083667933 11:64285525-64285547 CGCCCGGCCGGGGGCGGCAACGG - Intronic
1083890305 11:65592537-65592559 CGCCGGCCCGGCCGTGCCGTCGG - Exonic
1095949405 12:47773637-47773659 TGCCCGCCCGGGCGCCACCTGGG + Intronic
1100830972 12:98516222-98516244 CTCCCTCCCGGGCGCCCCCTCGG + Intronic
1102278278 12:111599160-111599182 CGCCAGCCCGGGCGCCCCTCCGG - Exonic
1108541660 13:51452262-51452284 CGCCCGCCCGCCCGCGCGGTGGG + Intronic
1113985692 13:114314264-114314286 CGCGCGCCCGGGCGCGGCTCCGG - Intergenic
1119519724 14:75277170-75277192 CGCGCGGCCGGGCGCGCCGTCGG - Intergenic
1122130984 14:99604413-99604435 CGCCCTCCCGGCCGGGCGATTGG + Intergenic
1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG + Intronic
1122714317 14:103685031-103685053 CGCCCGCTCGGACTCACCATGGG - Exonic
1122917388 14:104865379-104865401 CGCCCGCCCGGCCGAGCGCTGGG - Exonic
1123008493 14:105335828-105335850 CGGCCGCCCGGGCGAGCCTTGGG + Intronic
1123676511 15:22714867-22714889 CGGCCGCCCGGGCGCCACAGCGG + Intergenic
1125717358 15:41826964-41826986 CACCCGCCCTGCTGCGCCATAGG + Exonic
1126295721 15:47133344-47133366 CGCCCGGCCGGCCGCCCCGTCGG + Intergenic
1129589889 15:76905472-76905494 CGCACGCCCGTTCGCGCCGTTGG + Intergenic
1129589897 15:76905488-76905510 CTCCCGCCTGGGCGCCCCAACGG - Intergenic
1132055753 15:98649304-98649326 AGCCCGCCCCGGCGCGCCTCGGG + Exonic
1132460826 16:53780-53802 CACCCCCCCCGGCGCGCCAGTGG + Intronic
1132604632 16:788558-788580 TGCCCGGCGGCGCGCGCCATTGG - Intergenic
1134024190 16:10942052-10942074 CGGCCGCCCGGGCGCCGCAGCGG - Exonic
1135382820 16:22008413-22008435 CGCCCGGCCCGGCGCGCCAGCGG - Intronic
1136551583 16:30985112-30985134 CGGCCGCCAGGGGGCGCCTTGGG + Exonic
1137475961 16:48810682-48810704 CGCGCACCCGGGCGTGCCAGGGG - Intergenic
1142216772 16:88833972-88833994 GGCCCCCCCGGGCTCCCCATGGG + Intronic
1144910027 17:18672933-18672955 CGCCCGCCCGGCCGCGGCTGGGG + Intronic
1146052888 17:29567064-29567086 CGCCCGCGCGGGAGGGCCCTGGG - Exonic
1148081106 17:44968110-44968132 GGGCCGCCCGGCCGCGCCGTCGG + Intergenic
1148664202 17:49362264-49362286 CGCGCGCCCGCGCGCGCCCGCGG + Intronic
1149997401 17:61412234-61412256 CACCCTCCCGGGAGCGCCTTCGG + Exonic
1151780240 17:76240536-76240558 CTCCCGCCCCGCCTCGCCATTGG - Intergenic
1152649907 17:81488036-81488058 GGCGCCCCCGGGCGCGCCGTGGG + Intergenic
1152861454 17:82698740-82698762 TCCCCGCCCGGCCCCGCCATTGG + Intergenic
1158436504 18:57438270-57438292 CGCCCACCCTGGCTTGCCATAGG - Intronic
1160853637 19:1206286-1206308 CGCCGGCCCGGGCGAGCGTTCGG - Intronic
1160919801 19:1514013-1514035 CGCCCGCCAGGGGGCGCCGTGGG - Intergenic
1162345123 19:10114284-10114306 GGCCCGCCCGAGGGCGCCGTAGG - Exonic
1163681165 19:18683496-18683518 CGCGCGCCCAGGCGCGCGCTCGG - Intergenic
1163807056 19:19405833-19405855 CGCCCGCCCGCCCGCGCCGCCGG - Intronic
1164256584 19:23533440-23533462 CGCCCGGCCAGCCGCCCCATCGG - Intronic
941111049 2:161418797-161418819 CGCCGGCCCGGGCGCGCAGCCGG + Intronic
1170598836 20:17825393-17825415 CTCCTGCCCGGGCCCCCCATTGG + Intergenic
1172277305 20:33686560-33686582 CGCGCGCCCCGCCCCGCCATTGG - Intergenic
1173279873 20:41618437-41618459 CGCCTTCCCTGTCGCGCCATTGG + Exonic
1175847305 20:62065553-62065575 CGCCGCTCCGGGCGCGCCCTCGG + Exonic
1176061296 20:63174040-63174062 AGCCCGCCCAGGCGCACAATAGG - Intergenic
1176548979 21:8213461-8213483 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1176556872 21:8257673-8257695 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1176567908 21:8396491-8396513 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1176575812 21:8440710-8440732 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1179511943 21:41879172-41879194 CGCGAGCCCCGGCGCGCCCTGGG - Intronic
1180014613 21:45074277-45074299 CGCCCGCCCGAGCGCGGCTGAGG - Intronic
1181017561 22:20080095-20080117 CTCCCGCGCGGCCGCGCTATTGG + Intergenic
1181283326 22:21735502-21735524 CGCCCGCCCGGACGCCCAACAGG + Intronic
1183545950 22:38455033-38455055 CGCCCGCCGGATCGCGCCTTGGG - Exonic
1184663425 22:45976003-45976025 CGCCCGCCGGGCCGCGCCAGGGG + Intronic
1185289166 22:50015363-50015385 CGCCCGCCCCGGCGCGCCCCGGG + Intronic
1203253863 22_KI270733v1_random:129768-129790 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1203261919 22_KI270733v1_random:174847-174869 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
950417232 3:12875628-12875650 CGCCCACCCGGGGGGGCCAGCGG + Intergenic
950729724 3:14947396-14947418 CGCCCGCCCGGCCGCGGCCAAGG + Intergenic
951717337 3:25664104-25664126 CCCCCGAACGGGCGCTCCATAGG - Intronic
953924659 3:46976516-46976538 CGCCCGCGCATGCGCGCCCTCGG + Intronic
965558296 3:170038732-170038754 CCCCCGCCCGCGCCCGCCACTGG + Intronic
967924132 3:194633211-194633233 CGCGCGCCCAGCCGCGCCATGGG - Exonic
972533060 4:39977583-39977605 CGCCCGCCCGGGAGCGGCGCTGG + Exonic
973907377 4:55546080-55546102 TGGCCGCCCCGGCGCCCCATTGG + Intronic
977176766 4:93828626-93828648 CGCCTGCCCGCGCCCTCCATTGG + Intergenic
985545859 5:508650-508672 CTCCATCCCGGGCGCGCTATGGG - Intronic
990880257 5:60530572-60530594 CGCCCGCCCGCCCCTGCCATGGG + Intergenic
993386508 5:87268400-87268422 TGCCCGCCCGGGAGCCCCAGGGG - Exonic
997930863 5:138070611-138070633 CGCCCGGCCAGCCGCCCCATCGG + Intergenic
1002185941 5:177454858-177454880 CGCGCGCCCGCCGGCGCCATGGG + Exonic
1017873079 6:158502707-158502729 CACCCCCCCGGGCCCGCCCTTGG - Exonic
1019149141 6:169992868-169992890 CACCCGGCCAGGCGGGCCATGGG + Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019395705 7:816695-816717 CGCCCGCCCCGGGGTGCCCTTGG - Intronic
1020260234 7:6526833-6526855 CGCCCGCGAGGACGCGCCTTCGG - Intronic
1020281794 7:6653592-6653614 CGCGCGTTCGGGCCCGCCATCGG + Exonic
1022230539 7:28409150-28409172 CACCCGCCCGGGAGCGGCAGCGG - Intronic
1033200057 7:139360385-139360407 CGCGCGCCCAGGTGCGCCCTCGG - Intronic
1041673718 8:60517261-60517283 CACCCGCCCGGCCGCGCCCGGGG - Intronic
1043471325 8:80566033-80566055 CGCCCGCCCCCGCGCGCCTGGGG - Intergenic
1044115310 8:88327742-88327764 CGCGCGCGCGCGCGCGCCAAGGG - Intronic
1049224782 8:141444989-141445011 CGCCCTCCAGGGAGCGGCATGGG - Intergenic
1049554732 8:143276137-143276159 AGCCCGCTCGGGCGCACCCTCGG - Exonic
1057294648 9:93828058-93828080 CGCCCGCCCTGGGCCGCCAGCGG - Intergenic
1057773192 9:97984545-97984567 CGCCAGCCGGGGCGCGCCACAGG + Intronic
1061365867 9:130172303-130172325 CGCCCGCACCCGCGCGCCAGGGG - Intergenic
1203470263 Un_GL000220v1:112912-112934 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1203478084 Un_GL000220v1:156884-156906 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1192503531 X:71667881-71667903 CGCCAGCCCGGGAGCCCCACGGG + Intergenic