ID: 1077065033

View in Genome Browser
Species Human (GRCh38)
Location 11:637287-637309
Sequence CGCCCGCCCGGGCGCGCCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077065021_1077065033 29 Left 1077065021 11:637235-637257 CCGAGGGGAGGGACTCCCCGGCT 0: 1
1: 0
2: 1
3: 9
4: 158
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065020_1077065033 30 Left 1077065020 11:637234-637256 CCCGAGGGGAGGGACTCCCCGGC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065023_1077065033 14 Left 1077065023 11:637250-637272 CCCCGGCTTGCGACCCGGCGTTG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065029_1077065033 -10 Left 1077065029 11:637274-637296 CCGCGGTGCTCAGCGCCCGCCCG 0: 1
1: 1
2: 0
3: 13
4: 178
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065024_1077065033 13 Left 1077065024 11:637251-637273 CCCGGCTTGCGACCCGGCGTTGT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065027_1077065033 1 Left 1077065027 11:637263-637285 CCCGGCGTTGTCCGCGGTGCTCA 0: 1
1: 0
2: 3
3: 10
4: 54
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065025_1077065033 12 Left 1077065025 11:637252-637274 CCGGCTTGCGACCCGGCGTTGTC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95
1077065028_1077065033 0 Left 1077065028 11:637264-637286 CCGGCGTTGTCCGCGGTGCTCAG 0: 1
1: 0
2: 2
3: 7
4: 57
Right 1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077065033 Original CRISPR CGCCCGCCCGGGCGCGCCAT GGG Exonic