ID: 1077065668

View in Genome Browser
Species Human (GRCh38)
Location 11:640041-640063
Sequence CCCCGCGCCCGGCCTTCCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 1, 2: 6, 3: 95, 4: 686}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077065662_1077065668 -10 Left 1077065662 11:640028-640050 CCGACTGTGCGCCCCCCGCGCCC 0: 2
1: 1
2: 1
3: 13
4: 227
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065648_1077065668 18 Left 1077065648 11:640000-640022 CCCCGCCTCCCCCAGGACCCCTG 0: 1
1: 1
2: 8
3: 81
4: 868
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065657_1077065668 1 Left 1077065657 11:640017-640039 CCCCTGCGGCCCCGACTGTGCGC 0: 2
1: 0
2: 0
3: 9
4: 85
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065652_1077065668 13 Left 1077065652 11:640005-640027 CCTCCCCCAGGACCCCTGCGGCC 0: 2
1: 0
2: 8
3: 66
4: 686
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065659_1077065668 -1 Left 1077065659 11:640019-640041 CCTGCGGCCCCGACTGTGCGCCC 0: 3
1: 0
2: 0
3: 17
4: 148
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065653_1077065668 10 Left 1077065653 11:640008-640030 CCCCCAGGACCCCTGCGGCCCCG 0: 2
1: 1
2: 5
3: 41
4: 333
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065649_1077065668 17 Left 1077065649 11:640001-640023 CCCGCCTCCCCCAGGACCCCTGC 0: 2
1: 1
2: 11
3: 164
4: 1071
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065644_1077065668 27 Left 1077065644 11:639991-640013 CCACCCGCGCCCCGCCTCCCCCA 0: 1
1: 4
2: 29
3: 262
4: 2133
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065650_1077065668 16 Left 1077065650 11:640002-640024 CCGCCTCCCCCAGGACCCCTGCG 0: 1
1: 0
2: 7
3: 76
4: 731
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065646_1077065668 24 Left 1077065646 11:639994-640016 CCCGCGCCCCGCCTCCCCCAGGA 0: 1
1: 1
2: 10
3: 64
4: 619
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065660_1077065668 -8 Left 1077065660 11:640026-640048 CCCCGACTGTGCGCCCCCCGCGC 0: 2
1: 1
2: 1
3: 6
4: 88
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065658_1077065668 0 Left 1077065658 11:640018-640040 CCCTGCGGCCCCGACTGTGCGCC 0: 3
1: 0
2: 0
3: 6
4: 77
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065654_1077065668 9 Left 1077065654 11:640009-640031 CCCCAGGACCCCTGCGGCCCCGA 0: 2
1: 0
2: 0
3: 19
4: 224
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065656_1077065668 7 Left 1077065656 11:640011-640033 CCAGGACCCCTGCGGCCCCGACT 0: 2
1: 0
2: 2
3: 20
4: 211
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065647_1077065668 23 Left 1077065647 11:639995-640017 CCGCGCCCCGCCTCCCCCAGGAC 0: 1
1: 2
2: 13
3: 120
4: 1048
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065661_1077065668 -9 Left 1077065661 11:640027-640049 CCCGACTGTGCGCCCCCCGCGCC 0: 2
1: 1
2: 0
3: 11
4: 145
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686
1077065655_1077065668 8 Left 1077065655 11:640010-640032 CCCAGGACCCCTGCGGCCCCGAC 0: 2
1: 0
2: 0
3: 19
4: 245
Right 1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG 0: 1
1: 1
2: 6
3: 95
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077065668 Original CRISPR CCCCGCGCCCGGCCTTCCCC GGG Exonic
900109842 1:1000719-1000741 CCCGGCCGCCGACCTTCCCCCGG - Intergenic
900226522 1:1535835-1535857 CCCCCGGCCTGGCCTTCCCCCGG + Intronic
900320785 1:2082687-2082709 CCCCCCGCCCAACCCTCCCCTGG + Intronic
900372247 1:2337181-2337203 CCCCGGTCCCGGCCCTACCCTGG - Intronic
900418620 1:2546200-2546222 CCCCGCCCCCGGCCTCCAGCAGG - Intergenic
900438404 1:2642001-2642023 CCCAGGGCCCCGCCATCCCCAGG - Intronic
900505358 1:3027615-3027637 CCCCCCCCCCCGCCTGCCCCTGG - Intergenic
900585678 1:3431256-3431278 CCCCTGGCCCAGCCTTGCCCTGG - Intronic
900635808 1:3664402-3664424 CCCTCAGCCCAGCCTTCCCCAGG - Intronic
900810553 1:4798509-4798531 CTCAACCCCCGGCCTTCCCCAGG + Intergenic
901041861 1:6368776-6368798 CCCTGTGCCCTGCATTCCCCGGG - Intronic
901063787 1:6485547-6485569 TTCCGGGCCCGGCCCTCCCCGGG - Intronic
901179007 1:7327126-7327148 CACTGCGCCCGGCCTCCTCCTGG - Intronic
901183664 1:7358541-7358563 CCCCGCGCCACCCCTGCCCCGGG + Intronic
901378316 1:8855562-8855584 CCCCGCCCCATCCCTTCCCCAGG - Intergenic
901381777 1:8878994-8879016 CGCCGCCCCGGGCCATCCCCCGG - Intronic
901497189 1:9628974-9628996 CCCCTCGCCCTGCCTGCCCCAGG - Intergenic
901538039 1:9895914-9895936 CACCACGCCCGACCTTCCCAAGG + Intronic
901647719 1:10725665-10725687 CCCCAAGCCTGGCCTCCCCCAGG - Intronic
901660697 1:10796271-10796293 CCGCGCGCCGGGCATTCCCCTGG + Intronic
901808051 1:11750202-11750224 CGCTGCGCCCGGCCCTGCCCCGG + Exonic
902783174 1:18717223-18717245 CCGCGCGCCTGGCCGCCCCCCGG + Intronic
903668588 1:25022486-25022508 CCCAGCTCCCGGCCTGCCTCCGG + Intergenic
903834684 1:26195788-26195810 CACCGCGCCCGGCCTATGCCAGG + Intronic
903931642 1:26865467-26865489 CCCCGCGGCCGGCCCGGCCCAGG - Intergenic
903998285 1:27322097-27322119 CGCCCCGCTTGGCCTTCCCCCGG - Intergenic
904511107 1:31008883-31008905 CACCGCGCCCGGCCTTGCAGGGG - Intronic
905168240 1:36096143-36096165 CCTCGCGCTCGGCCCTCGCCAGG - Exonic
905886900 1:41496534-41496556 ACCCGCGCCTCGCCTTCCCCTGG + Intergenic
906147352 1:43567889-43567911 CCCAGCTCCCCGCCTTCCCCAGG + Intronic
906678494 1:47709658-47709680 CCCCTCCCCCGGCCTGACCCTGG + Intergenic
906988059 1:50708094-50708116 CACAGCGCCCGGCCCGCCCCTGG + Intronic
907259945 1:53210517-53210539 CCCCGCCCCCGAGTTTCCCCTGG + Exonic
907767317 1:57424026-57424048 GCGCTCGCCCGGGCTTCCCCGGG - Exonic
908703850 1:66930112-66930134 CCCCGCGGCCAGCCCTCCCCGGG - Intronic
908857584 1:68447571-68447593 CACCGCGCCCGGCCCTACCTGGG - Intronic
908951692 1:69568725-69568747 CCCCGCCCCCGGCCGGCCTCTGG - Intronic
909657270 1:78045892-78045914 CCGCCCGCCCAGCCTCCCCCGGG - Exonic
910128361 1:83871605-83871627 CACCGCGCCCGGCCTATCCCTGG - Intronic
911078856 1:93908986-93909008 CCCCGCCCGAGGCCTGCCCCGGG + Intronic
912829540 1:112939885-112939907 CCCCGCCCCTGCCCATCCCCTGG + Intronic
914900182 1:151707478-151707500 TCCCTTGCCCGGCCTTGCCCAGG + Intronic
915310855 1:155005181-155005203 CCCCTCCCCCACCCTTCCCCAGG - Intronic
915393498 1:155564203-155564225 CACCGCGCCCGGCCTTGCATGGG - Intergenic
915944135 1:160137352-160137374 CCCCTCCCCTGGCCTTCCGCAGG + Intronic
915949284 1:160177434-160177456 CCCAGCCCCCAGCCCTCCCCTGG + Intronic
917415469 1:174804599-174804621 CACCGTGCCCGGCCTCCCTCGGG + Intronic
917846658 1:179025930-179025952 CCCCCGGCCCGGCCATTCCCAGG - Exonic
918070158 1:181128683-181128705 CCCCCTGCCCGGCCTGCCCTGGG - Intergenic
918629491 1:186699257-186699279 CACCGCGCCCGGCCGGGCCCAGG - Intergenic
918870652 1:189969447-189969469 CACCGCGCCCGGCCATCCCCAGG + Intergenic
919914979 1:202133671-202133693 CCCAGCTCCCGCCCCTCCCCAGG - Exonic
919915090 1:202134165-202134187 CCCCGCCCCTGGCTTTTCCCCGG - Exonic
920243719 1:204572612-204572634 CCCCTCCCCCGGCCCTCACCAGG - Intergenic
920674928 1:208032047-208032069 CCCCGGGTCCGGGCTTCCCATGG + Intronic
921201418 1:212810219-212810241 CACCGCGCCCTGCCTTCACTCGG - Intronic
922440683 1:225653142-225653164 CCGCGCGCCCCGCCTCCTCCCGG - Exonic
922603043 1:226871154-226871176 CCCCGCGCGCCTCCTTCCCGGGG - Intronic
922866457 1:228865064-228865086 CACCGCGCCCGGCCCACCCCTGG - Intergenic
923602851 1:235418916-235418938 CACCACGCCCGGCCCTCCCCAGG - Intronic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
923716756 1:236431631-236431653 CACCGCGCCCGGCCCTGCCTGGG - Intronic
924415219 1:243850468-243850490 CCCCGCGCCGGGCGCGCCCCGGG - Intronic
1063668193 10:8078819-8078841 CACCGCGCCCGGCCTCCATCTGG - Intergenic
1064752398 10:18544390-18544412 CCCCCCGCCCCGCCCTCCACAGG - Intergenic
1065531597 10:26675703-26675725 CACCGCGCCCGGCCTTAACTAGG - Intergenic
1065593228 10:27286984-27287006 CACTGCGCCCGGCCTGTCCCAGG - Intergenic
1067713926 10:48672181-48672203 CCCCGCGCAGGGCCTCTCCCAGG + Intergenic
1068171509 10:53401108-53401130 CACCGCGCCTGGCGTTCACCTGG - Intergenic
1069533821 10:69238662-69238684 CACCGCGCCCGGCCTACACCAGG + Intronic
1069544565 10:69319094-69319116 TCCGGCGCCCGGCCTTCTCCGGG + Intronic
1069730607 10:70609451-70609473 CACCGTGCCCGGCCTGCCTCAGG + Intergenic
1070162555 10:73874665-73874687 CCCGGCCCCCGGCCCGCCCCCGG + Intergenic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070333010 10:75431427-75431449 GCCCGCGCCCCTCCCTCCCCCGG - Intergenic
1070528103 10:77312335-77312357 CACCGCGGCCGGCCATCTCCTGG - Intronic
1071955929 10:90759365-90759387 CACCGCGCCCGGCCTTTCCCTGG - Intronic
1073065676 10:100757822-100757844 CCCTGTGCCCAGCCTTCCTCAGG - Intronic
1073111822 10:101067123-101067145 CCCCCTCCCCTGCCTTCCCCCGG - Intronic
1073115591 10:101089858-101089880 CCATGCCCCCCGCCTTCCCCAGG + Exonic
1073139131 10:101236287-101236309 CCCCATGCCCGGCCTGCGCCCGG - Intergenic
1073385824 10:103127842-103127864 CACCGCGCCCGGCCTACACCTGG + Intronic
1074165793 10:110872452-110872474 CCCCGCCCCCTGCCCTCCCTGGG + Intronic
1074829993 10:117241334-117241356 CCCTGCGCCCCGGCTGCCCCGGG - Intronic
1075375401 10:121974761-121974783 CGCCGCGCCGGGCCTCCGCCCGG + Intronic
1075631440 10:124003096-124003118 CCCAGGGCTCGGCCTTGCCCAGG - Intergenic
1076372444 10:129964187-129964209 CGCCGCGCCCCGCCTGCGCCCGG - Intergenic
1076683290 10:132186168-132186190 CCCCACGCCCGGCGTCCTCCGGG - Intergenic
1076807806 10:132867870-132867892 CTCCCCGCTCGGCCTTCCCACGG + Intronic
1076932595 10:133543111-133543133 CACCGCGCCCGGCCTACTACTGG + Intronic
1077065645 11:639993-640015 ACCCGCGCCCCGCCTCCCCCAGG + Exonic
1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG + Exonic
1077065686 11:640089-640111 CGCCGCGCCCAGCCTCCCCCAGG + Exonic
1077065706 11:640137-640159 CCCCGCGCCCGGCCTCCCCCCGG + Exonic
1077075075 11:696789-696811 TACTGCGCCTGGCCTTCCCCGGG - Intronic
1077085418 11:747627-747649 CCCGGCGCCCCGATTTCCCCGGG + Intronic
1077098571 11:810503-810525 CACCGCGCCCGACCTCCGCCCGG - Intronic
1077210972 11:1370821-1370843 CCCCGAGACCTGCCGTCCCCAGG + Intergenic
1077330957 11:1983612-1983634 CCCAGCCCCAGCCCTTCCCCAGG + Intronic
1077886259 11:6390306-6390328 CCCTGCCCCCGCCCTGCCCCGGG - Intergenic
1078095163 11:8292147-8292169 CCACGACCCCGGCCTGCCCCAGG - Intergenic
1078110038 11:8385004-8385026 GCCCAGGCCTGGCCTTCCCCAGG + Intergenic
1078771759 11:14358621-14358643 CCCCGCGCCCTCCCGCCCCCTGG + Intronic
1079407061 11:20156629-20156651 CCCCGCCCCCGTGCGTCCCCCGG - Intronic
1080690799 11:34556034-34556056 CACCGTGCCCGGCCGGCCCCAGG + Intergenic
1081518059 11:43853048-43853070 CACCGCGCCCGGCCGTCTCTGGG - Intronic
1081918161 11:46747769-46747791 CACCACGCCTGGCCTCCCCCTGG - Intronic
1082068701 11:47921250-47921272 CACCACGCCCGGCCTGCCACTGG + Intergenic
1083284109 11:61646803-61646825 CACCGCGCCTGGCCCTTCCCAGG + Intergenic
1083329658 11:61891609-61891631 CCCCGCCCCCGGCCAGGCCCCGG + Intronic
1083572660 11:63768644-63768666 CCCCGCGCCCCGCCGCCCCGGGG - Exonic
1083657186 11:64235113-64235135 CCCCGCCCCCGGCGGTGCCCAGG - Intronic
1083822629 11:65181683-65181705 CCCCGCGCTGGCCCCTCCCCGGG + Exonic
1083869038 11:65475847-65475869 CACCGCGCCCGGCCCACGCCCGG + Intergenic
1083951802 11:65960692-65960714 CACCGCGCCCGGCCTGCACTGGG + Intergenic
1083967020 11:66049233-66049255 CCCCGCCCCTCGCCTTCCTCCGG - Intergenic
1084130391 11:67129444-67129466 CACCGCGCCCGGCCTATGCCCGG - Intronic
1084271142 11:68029820-68029842 CACCACGCCGGGCCTTTCCCCGG - Intergenic
1084325414 11:68397192-68397214 CTCCCAGCCAGGCCTTCCCCTGG - Intronic
1084336605 11:68461201-68461223 CCCCCCGCCCGGCCCGCGCCCGG + Intronic
1084385707 11:68841693-68841715 CCCCGCGCCCCGCCCGTCCCCGG + Intronic
1084722547 11:70916654-70916676 CCCCTCGCCCTCCCTTCGCCTGG + Intronic
1085054919 11:73397913-73397935 CCCTGCGCCCACCCCTCCCCTGG - Intergenic
1085055115 11:73398782-73398804 CCCACAGCCCAGCCTTCCCCTGG - Intergenic
1085647098 11:78231634-78231656 CACTGTGCCCGGCCTTCCCTTGG + Intronic
1086474642 11:87158750-87158772 CACCGCGCCCGGCCTAACCTTGG + Intronic
1087556387 11:99727016-99727038 CACCGCGCCCGGCCATGCCCTGG - Intronic
1088333651 11:108679143-108679165 CACTGTGCCCAGCCTTCCCCTGG + Intronic
1088893139 11:114059924-114059946 CCGCGCGCCGGGGCTTCCCGGGG + Intronic
1089139761 11:116276117-116276139 CCCAGGGCCCTGTCTTCCCCAGG - Intergenic
1089227155 11:116934789-116934811 CACCGCGCCCGGCCTATGCCTGG - Intronic
1089299996 11:117492784-117492806 CTCCGCCCCCAGCCTTTCCCAGG - Intronic
1089499859 11:118925645-118925667 CCCAGCGCCCGGCATTCCCGCGG - Intronic
1089557196 11:119321035-119321057 CCCCGCCCCCTGCCTCCGCCGGG - Intronic
1089564345 11:119363242-119363264 CCTCGGCCCCGGCATTCCCCTGG + Intronic
1090199902 11:124846467-124846489 CCCCGAGCCCAGCCTCCCCGGGG + Intergenic
1090326117 11:125887771-125887793 CTCCGCTTCCGGCCTTCGCCCGG - Intronic
1090364731 11:126196472-126196494 CACTGTGCCCGGCCTTTCCCAGG - Intergenic
1090709541 11:129373294-129373316 CTCCCCGCCCGGCATTGCCCCGG + Intergenic
1090813354 11:130267773-130267795 CACTGCGCCCGGCCTTCACGAGG - Intronic
1091219102 11:133920045-133920067 GCCCGTGCCCGGCCTCGCCCGGG - Exonic
1202813937 11_KI270721v1_random:38791-38813 CCCAGCCCCAGCCCTTCCCCAGG + Intergenic
1091489910 12:924119-924141 CCCCGCGCCCGGCCTTTGTTAGG - Intronic
1091616109 12:2052652-2052674 CCGCGCGCCCCGGCCTCCCCGGG + Intronic
1091712706 12:2753146-2753168 GCCTGCGCCCTGCCTGCCCCTGG + Intergenic
1091718534 12:2795886-2795908 CCCCGCGCCCGGCCTCCCCGGGG - Intronic
1091872813 12:3909196-3909218 CACCGCGCCCGGCCTTCTTCAGG - Intergenic
1092046232 12:5433220-5433242 ACCCGGGCCCGGCCATCCCAGGG + Intronic
1092120221 12:6038429-6038451 CCCCCAGCCCGGCCTGCCCAAGG - Intronic
1092133560 12:6130035-6130057 CACCGCGCCCGGCCTTGTTCTGG - Intergenic
1092230619 12:6773709-6773731 TGCCGCCCCCGGCCATCCCCTGG + Exonic
1092238834 12:6825462-6825484 GCCCGCTCCCACCCTTCCCCAGG + Exonic
1092254463 12:6918691-6918713 CACCGCGCCCGGCCTTCCAGTGG - Intronic
1092743212 12:11649786-11649808 CCCCGCCCCCCGCCCTCCCGCGG - Intergenic
1092810973 12:12271266-12271288 CACCGCGCCCGGCCTCCACCTGG - Intergenic
1094618411 12:32057178-32057200 CACCGCGCCCGGCCAATCCCAGG + Intergenic
1095800738 12:46268485-46268507 CCGCTCGCCCAGCCCTCCCCGGG + Intronic
1096078383 12:48818566-48818588 CCCCTCTCCCGGCCTGGCCCGGG + Intronic
1096220875 12:49827785-49827807 CGCCTCTCCCCGCCTTCCCCAGG + Intronic
1096365735 12:51026886-51026908 CACCGCGCCCGGCCTTTGCTTGG - Intronic
1096769811 12:53927889-53927911 CAGCGCTCCCCGCCTTCCCCAGG - Intergenic
1096771741 12:53939682-53939704 CTCCCCGCCCTGCCTGCCCCGGG + Intronic
1097010477 12:55950259-55950281 CATCGCGCCCGGCCTACACCTGG + Intronic
1097990266 12:65825603-65825625 CCCCACCTCCCGCCTTCCCCGGG - Intronic
1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG + Intronic
1100225258 12:92549913-92549935 CACCGCGCCCAGCCTCCACCTGG - Intergenic
1101754759 12:107612894-107612916 CCCCTCGGCCGGCAGTCCCCAGG + Intronic
1103756970 12:123215947-123215969 CACCGCGCCCGGCCTTCTCTTGG - Intronic
1103785661 12:123430985-123431007 CACCGCGCCCGGCCTACGCCTGG + Intronic
1103856286 12:123973009-123973031 CCCCGCGCCCCCCCCTCCCTCGG - Intronic
1103883287 12:124182919-124182941 CCCCACCCCCGCCCCTCCCCCGG + Intronic
1104806764 12:131594392-131594414 CACCACGCCCGGCCCTCCTCTGG - Intergenic
1105005354 12:132717876-132717898 CCACGTGCCCGGCCGTCCCACGG + Intronic
1105012028 12:132762127-132762149 CCCCGCGCCCGGCCCCGCCCTGG - Intergenic
1105518822 13:21113682-21113704 CACCATGCCCGGCCTTGCCCTGG + Intergenic
1105705255 13:22964381-22964403 CCCCTCTCCAGCCCTTCCCCAGG + Intergenic
1105858170 13:24389397-24389419 CCCCTCTCCAGCCCTTCCCCAGG + Intergenic
1108648507 13:52453243-52453265 CACCACGCCCAGCCATCCCCAGG + Intergenic
1108689739 13:52849902-52849924 CGCAGCGCCCGGCCAGCCCCAGG - Intergenic
1111030291 13:82588928-82588950 CACCGCGCCTGGCCTTCTTCTGG + Intergenic
1111120933 13:83847974-83847996 CACCGCGCCAGGCCTTGACCGGG - Intergenic
1111845760 13:93506750-93506772 CACCACGCCCGGCCTACTCCGGG - Intronic
1111951628 13:94712933-94712955 AGCCGCGTCCGGCCGTCCCCTGG + Intergenic
1112313946 13:98344440-98344462 CCCCGGGCATGGTCTTCCCCAGG - Intronic
1112927141 13:104690018-104690040 CACCACACCCGGCCTACCCCAGG + Intergenic
1113289195 13:108886273-108886295 CACCGCGCCCGGCCCTCCTTTGG + Intronic
1113484829 13:110646148-110646170 CCCCACACCAGTCCTTCCCCAGG + Intronic
1113664489 13:112131816-112131838 CACCGCGCCTGGCACTCCCCGGG + Intergenic
1113793839 13:113045384-113045406 CCCTGCGCCCGGCCCCTCCCTGG + Intronic
1114280213 14:21187268-21187290 CACCGCGCCCAGCCCTCCCCTGG - Intergenic
1114324776 14:21577718-21577740 CACCGCGCCCGGCCTCCCTCGGG - Intergenic
1116261720 14:42636788-42636810 CACCGCACCCGGCCTACACCTGG + Intergenic
1116607449 14:47019553-47019575 TACCGCGCCCGGCCTACACCAGG - Intronic
1116833147 14:49742379-49742401 CACCACGCCCAGCCCTCCCCGGG - Intronic
1118266813 14:64302473-64302495 CACCGCGCCCGGCCTCACCTGGG + Intronic
1118675844 14:68183803-68183825 CACTACGCCCGGCCTTACCCAGG - Intronic
1119383019 14:74240504-74240526 CCCCGAGCCCGCGCGTCCCCGGG - Intronic
1119740947 14:77013418-77013440 CACCGCGCCCGGCCTACCACAGG - Intergenic
1119875320 14:78054413-78054435 CACCGCGCCCGGCCTGTTCCAGG + Intergenic
1121050372 14:90816089-90816111 CCCCGCGCCCGGCCGCGCCTCGG + Intronic
1121415050 14:93773671-93773693 CCCTGCGCCCTGCCTGCCACTGG - Intronic
1121720378 14:96104938-96104960 CCCCGCCCACAGCCTTTCCCTGG + Intergenic
1122055440 14:99095067-99095089 CCAAGCGCCCGGCCCTGCCCAGG + Intergenic
1122183405 14:99971735-99971757 CCCCCCGCCCCCCCATCCCCCGG + Intronic
1122397417 14:101443250-101443272 CACCACGCCGGGCCTTCCCTAGG - Intergenic
1122502843 14:102212676-102212698 CCCCTCCCCAGGCCCTCCCCAGG - Intronic
1122645231 14:103189455-103189477 CCCCTCGCCCCTCATTCCCCGGG - Intergenic
1122776107 14:104117625-104117647 CGCCGCGCCCCGCAGTCCCCAGG + Intergenic
1122904552 14:104795769-104795791 CCCCGCGCCCGCCCCGCGCCCGG + Intergenic
1123008533 14:105335968-105335990 GCCCACGCCCTGCCATCCCCAGG - Intronic
1123063437 14:105604816-105604838 CCCAGCCCCCTGCCTTCTCCAGG + Intergenic
1123087499 14:105723602-105723624 CCCAGCCCCCTGCCTTCTCCAGG + Intergenic
1202858338 14_GL000225v1_random:64887-64909 CCCCGTCCCCGGACTTCCGCGGG + Intergenic
1202868357 14_GL000225v1_random:137017-137039 CCCCGTCCCCGGGCTTCCGCGGG + Intergenic
1123719953 15:23050690-23050712 CACCGCGCCCGGCCGTATCCTGG + Intergenic
1123737136 15:23196220-23196242 CACCGCGCCCGGCCTGCACAGGG + Intergenic
1123781774 15:23635566-23635588 CACCGCGCCCGGCCTCCCTTGGG - Intergenic
1124288352 15:28424885-28424907 CACCGCGCCCGGCCTGCACAGGG + Intergenic
1124294872 15:28492429-28492451 CACCGCGCCCGGCCTGCACAGGG - Intergenic
1125445021 15:39745097-39745119 CCCCCCACCCCGCCATCCCCAGG + Intronic
1126228146 15:46295396-46295418 CCCCGCACCCCACCTTCCCCAGG + Intergenic
1126848833 15:52785510-52785532 GCCTGCGCGCCGCCTTCCCCTGG + Intronic
1127149366 15:56057637-56057659 CACCGCGCCCGGCCTAACACAGG - Intergenic
1128087093 15:64894058-64894080 CCCCCCGCCCTGCCTTCCGCAGG + Intronic
1128327116 15:66731148-66731170 CACCGCGCCCGGCCTCACCAAGG - Intronic
1128328293 15:66739375-66739397 CACCGTGCCTGGCCTTACCCAGG + Intronic
1128547836 15:68579507-68579529 CTCCGCGCCCGGCCCAACCCCGG + Intronic
1128710265 15:69866470-69866492 CACTGCGCCCGGCCCTCACCAGG + Intergenic
1129116625 15:73368485-73368507 CCCCGCGCCCAGCCGGGCCCGGG - Exonic
1129144244 15:73633090-73633112 ACCCCCGCCCGGCCCGCCCCCGG + Intronic
1129161999 15:73752490-73752512 GCCCACGCCCGGCATTCCCCGGG + Exonic
1129349714 15:74948382-74948404 CACCGCGCCCGGCCTCCTCTGGG - Intergenic
1129442731 15:75593569-75593591 CACCGCGCCTGGCCTCCACCTGG + Intergenic
1130341914 15:83006674-83006696 CCCCGCGCCCCGCCCCTCCCCGG - Intronic
1130551790 15:84894081-84894103 CACCGCGCCCGGCCTCTCCCTGG - Intronic
1130945333 15:88546609-88546631 CCCCGCCCCCGCCATGCCCCAGG + Exonic
1131059311 15:89394898-89394920 CCCACCGCCCCTCCTTCCCCAGG + Intergenic
1131133900 15:89918431-89918453 CCCCACACCCGGCCTCCCCATGG - Intergenic
1131144369 15:90001746-90001768 GCCTGCGCGCGGCCGTCCCCAGG - Intronic
1131225813 15:90623717-90623739 CCCCGCGTCCAGCCTTCCACTGG + Intronic
1132604573 16:788409-788431 CCCCCCCCCCGGCCCGCCCCCGG + Intergenic
1132683419 16:1152928-1152950 CCCGGCGCCCCGCCCCCCCCCGG - Intergenic
1132683444 16:1153015-1153037 CCCCCCGCCCGCCCCGCCCCCGG + Intergenic
1132683452 16:1153026-1153048 CCCCGCCCCCGGCCCCGCCCCGG + Intergenic
1132683849 16:1154146-1154168 CCGCGCGCCCGGCCCACGCCAGG - Intronic
1132765994 16:1534439-1534461 CCCAGGGCTCGGCCCTCCCCGGG - Exonic
1132851443 16:2026746-2026768 CTCCGCGCCCGGCCAGCCCGAGG - Intronic
1132887828 16:2190221-2190243 CCCGGCACCCTGCCCTCCCCCGG + Intronic
1132915727 16:2342084-2342106 CCCCGCGCCCAGCCAGCCGCCGG + Intergenic
1132925726 16:2428410-2428432 CCCAGGCCCCTGCCTTCCCCAGG + Intergenic
1133208289 16:4247389-4247411 CACCACGCCCGGCCTGCTCCTGG - Intergenic
1133214455 16:4283154-4283176 CACCGTGCCCGGCCTCCACCAGG + Intergenic
1133238741 16:4402589-4402611 CCCAGCGCCCAGCCCTGCCCAGG - Intronic
1133262063 16:4557256-4557278 CACTGCGCCCAGCCTTCTCCTGG + Intronic
1133668250 16:7992228-7992250 CACCGTGCCCGGCCTTTGCCTGG + Intergenic
1133927596 16:10205709-10205731 CACCGCGCCCGGCCTTTAACCGG + Intergenic
1134093978 16:11406718-11406740 CACCGTGCCCGGCCTTCCCCCGG + Intronic
1134111430 16:11517717-11517739 CCTCCCGCCTGCCCTTCCCCTGG + Intronic
1134272748 16:12747704-12747726 CACCGCGCCCGGCCTTAACGAGG + Intronic
1135302210 16:21340373-21340395 CACCGCGCCCGGCCTCGACCTGG - Intergenic
1135768514 16:25198538-25198560 CACCGCGGCCGGCCTAGCCCTGG - Intergenic
1136054375 16:27677466-27677488 CCCCCCACCCCACCTTCCCCCGG + Intronic
1136141665 16:28292611-28292633 CCCGGCCCCCGGCCTGGCCCGGG - Exonic
1136187870 16:28598731-28598753 CACCGTGCCAGGCCTTCTCCAGG - Intergenic
1136190342 16:28611725-28611747 CACCGTGCCAGGCCTTCTCCAGG - Intronic
1136342290 16:29652566-29652588 CACCGCGCCCGGCATGCACCTGG - Intergenic
1136455661 16:30378406-30378428 CGCCCCGCCCGGCCTTACCTCGG - Exonic
1136507504 16:30714350-30714372 CACCGCGCCCGGCCTACGCCCGG + Intronic
1136627800 16:31472458-31472480 CCCCGCGCCCGGGCGCCCGCGGG - Intronic
1136723564 16:32341120-32341142 CCCTGGGCCCGGCCCTGCCCTGG - Intergenic
1136779010 16:32885618-32885640 CCCCCGGCCCGGCCGCCCCCCGG - Intergenic
1136891608 16:33975900-33975922 CCCCCGGCCCGGCCGCCCCCCGG + Intergenic
1137290834 16:47050890-47050912 GCCCGCTCCTGGCCTTCTCCTGG - Intergenic
1137555043 16:49465121-49465143 CCCCGCGCTCAGGCTGCCCCGGG - Intergenic
1137617020 16:49854727-49854749 GCCGGCGCGCGGCCTTTCCCCGG + Intronic
1137655412 16:50154157-50154179 CCCCGCGGCCCGCCCTCCGCTGG - Exonic
1137988776 16:53131432-53131454 CCCCCTGCCCGGCCTCCCCGCGG - Intronic
1138460775 16:57146474-57146496 CGCCGTGCCAGGCCTTGCCCCGG + Intronic
1139356377 16:66369201-66369223 CCACCAGCCCGGCCTGCCCCTGG - Intronic
1139476153 16:67203475-67203497 CCCCGCTCCCTTGCTTCCCCAGG + Exonic
1140932433 16:79640236-79640258 CACCGCGCCCGGCCAGCCTCCGG - Intergenic
1141069396 16:80939590-80939612 CACCGCGCCCAGCCGGCCCCTGG + Intergenic
1142206614 16:88785774-88785796 CACCGCGCGCGGCTTTGCCCGGG + Intergenic
1142307288 16:89292893-89292915 CCCGGGGGCCGGCCCTCCCCAGG + Intronic
1142361858 16:89631157-89631179 CCCCCCGGCCTGCCTTCTCCCGG + Intronic
1142378756 16:89720604-89720626 CCCCGCCCCCGTCCTCGCCCGGG + Intronic
1203002868 16_KI270728v1_random:176645-176667 CCCTGGGCCCGGCCCTGCCCTGG + Intergenic
1203081421 16_KI270728v1_random:1147707-1147729 CCCCCGGCCCGGCCGCCCCCCGG - Intergenic
1203134473 16_KI270728v1_random:1713051-1713073 CCCTGGGCCCGGCCCTGCCCTGG + Intergenic
1142746905 17:1964012-1964034 CACCGCGCCGGGCCTGCCCTTGG + Intronic
1142812602 17:2402137-2402159 CCCCGCGCCCCGCCCACCGCCGG - Intergenic
1143105739 17:4529912-4529934 GCCCGCGTCCAGCCCTCCCCCGG - Intronic
1143521248 17:7445480-7445502 CCCCGCCCCCAGCCTGTCCCTGG - Intronic
1143661476 17:8327097-8327119 CCCCGCGCCCGCCCCTCCCGCGG + Intergenic
1144099835 17:11933666-11933688 CACCGCGCCCGGCCTTCTTCAGG + Intronic
1144208235 17:12994135-12994157 CCCCAGCCCCCGCCTTCCCCTGG + Intronic
1144547906 17:16215165-16215187 CGCCGCGCCCGGCTCTCTCCTGG + Intronic
1144777167 17:17790791-17790813 GCCCGCTCCCTGCCCTCCCCAGG - Intronic
1144959703 17:19038299-19038321 CCCAGCGCCTGGCCTTCCGGAGG + Intronic
1144975457 17:19136225-19136247 CCCAGCGCCTGGCCTTCCGGAGG - Intronic
1145077352 17:19867294-19867316 CCCGGGGCCCGGCCTCGCCCCGG + Intronic
1146115276 17:30131958-30131980 CACCGCGCCTGGCCTTGCACTGG - Intronic
1146206841 17:30912164-30912186 CACCGCGCCCGGCCAAGCCCAGG + Intronic
1146716185 17:35089037-35089059 CCCCCTTCCCGTCCTTCCCCAGG + Intronic
1147145338 17:38481433-38481455 CACCGCGCCCGGCCCACGCCCGG + Intronic
1147192756 17:38747414-38747436 CCCAGCGCCCGGGCTTCCCCAGG + Intronic
1147429447 17:40362716-40362738 CCCCCAGCCCGGCCTGCCCCAGG + Intronic
1147792235 17:43021164-43021186 CCCCGCCCCAGGCATTCCCAAGG + Intronic
1148206496 17:45783444-45783466 ATGCGCGCCCGGCTTTCCCCTGG + Intergenic
1148559141 17:48596177-48596199 CCGCGCGCCCTTCCTTCCCGAGG - Exonic
1148734738 17:49858984-49859006 CCCCACCCCCGGCCTTCAGCTGG - Intergenic
1148777482 17:50103872-50103894 CCCCACGCACAGCCTCCCCCAGG - Intronic
1148802598 17:50240797-50240819 CACCGCACCTGGCCTCCCCCTGG + Intergenic
1148818226 17:50345998-50346020 CCCCGCCCCCGGCCCCGCCCCGG + Intergenic
1148827188 17:50402495-50402517 CACCGCGCCCAGCCTTACCTAGG + Intergenic
1148852452 17:50561542-50561564 CCCCGGCCCCGGCCGGCCCCCGG - Exonic
1148867250 17:50635042-50635064 CCCCGCCGCCTGCCTTCCCGCGG + Intronic
1149156255 17:53633137-53633159 CACCGCGCCCGGCCTACCAGTGG + Intergenic
1149454969 17:56780420-56780442 CCCCGCGCCCGCCCTCGCTCCGG + Intergenic
1149614437 17:57987270-57987292 CACCGCTCCCCGCCTGCCCCGGG + Intronic
1149886719 17:60347639-60347661 CACCGCGCCCGGCCTACACCTGG + Intronic
1150255740 17:63742639-63742661 CACCGCGCCCGGCCTTCCAGGGG - Intronic
1150789423 17:68189610-68189632 CACCGCGCCCGGCCTTGTCCTGG + Intergenic
1151453560 17:74213505-74213527 CCCCGTGCCCGCCCCGCCCCCGG - Exonic
1151570513 17:74923318-74923340 AGCCGCCCCCGGTCTTCCCCTGG + Intergenic
1151658081 17:75504897-75504919 CCCTGCGCCCAGGCTTCTCCCGG - Exonic
1151736062 17:75941048-75941070 CCTCGCGCCCGCCTTTCCGCGGG - Intronic
1151925120 17:77189914-77189936 CACCGCGCCCGGCCTTAACAGGG + Intronic
1152024418 17:77799394-77799416 CACCGCGCCCGGCCTTTGCGGGG - Intergenic
1152394018 17:80020962-80020984 CACCGTGCCCGGCCCTGCCCAGG - Intronic
1152396356 17:80035905-80035927 CCCGGCCCCCGGCCCGCCCCCGG + Intergenic
1152556528 17:81055852-81055874 CACCGCGCCCGGCCGTCTGCAGG + Intronic
1152626203 17:81388932-81388954 TCCCGGGCCCAGACTTCCCCAGG - Intergenic
1152689766 17:81712604-81712626 CCCCGGGCGCGGCGATCCCCGGG - Intronic
1152695949 17:81795567-81795589 CACCGCACCCGGCCTTTCCTAGG - Intergenic
1152729085 17:81961124-81961146 CTCCGCGCCCGGCCGTCCGAGGG + Exonic
1152932968 17:83119917-83119939 CCCCGCCCCAGCCCCTCCCCAGG - Intergenic
1153202911 18:2664001-2664023 CACCGCGCCCGGCCTATTCCAGG + Intronic
1153285015 18:3449375-3449397 GCGCGCGCCCGGCCGTCCCCGGG + Intronic
1155910338 18:31498155-31498177 CCCTGGCCCCGGCCTCCCCCCGG - Exonic
1155937811 18:31772373-31772395 CCCCCTTCCCAGCCTTCCCCCGG - Intergenic
1156448496 18:37253740-37253762 CCCCGCGCCCCGGCCGCCCCCGG + Intronic
1156448593 18:37254055-37254077 CCCCGCCCCCGGCCCCGCCCCGG + Intronic
1157293910 18:46428120-46428142 CACTGCGCCCGGCCTCCCCTTGG - Intronic
1157847099 18:51014074-51014096 CACTGCGCCCGGCCTGCACCAGG + Intronic
1158136633 18:54215026-54215048 CACCGCGCCCGGCCTCCACAAGG + Intronic
1158301521 18:56058050-56058072 CACCGCGCCCGGCCTCCTCTGGG + Intergenic
1158457524 18:57621491-57621513 CCCCGAGTCCGTCGTTCCCCCGG - Intronic
1158954061 18:62523290-62523312 CCCCGGCCCCGGCCCTCCCCCGG + Exonic
1158976359 18:62715227-62715249 CTCCGCCTCCGGCCATCCCCTGG + Intergenic
1159102297 18:63970412-63970434 CCCGGCCCTCGGCCTTCGCCGGG - Intronic
1159244644 18:65789939-65789961 CACCGCGCCCAGCCTCCCTCAGG - Intronic
1159520130 18:69509347-69509369 CACCGCGCCCGGCCATATCCTGG - Intronic
1159922617 18:74239483-74239505 CCCCCCTCCCAACCTTCCCCCGG - Intergenic
1160313456 18:77819361-77819383 GCCAGAGCCCAGCCTTCCCCAGG - Intergenic
1160453547 18:78980491-78980513 CCCCGCGCCAGGCCGGCCGCGGG + Intronic
1160453548 18:78980492-78980514 CCCCGCGGCCGGCCTGGCGCGGG - Intronic
1160464249 18:79062897-79062919 CGCCTTGCCCGGCCTTCCCTTGG - Intergenic
1160558068 18:79739018-79739040 CCCAGTGCACCGCCTTCCCCAGG - Intronic
1160700773 19:506315-506337 CACCGCGCCCGGCCTACCACAGG + Intergenic
1160731410 19:643213-643235 CCCCGACCCCCGCCTCCCCCAGG + Exonic
1160745624 19:709631-709653 CCCCACCCCCGCCCTTCCCAAGG + Intronic
1160758427 19:770551-770573 CACCGCGCCCGGCCCTGTCCAGG - Intergenic
1160809675 19:1007982-1008004 CCCGGCGCCCCGCCTCGCCCAGG - Intronic
1160826421 19:1082449-1082471 CCCCAGTCCCGCCCTTCCCCGGG - Intronic
1160842597 19:1152862-1152884 CACCGCGCCCGGCCCTGCCTGGG - Intronic
1160847850 19:1174178-1174200 CTCCGCGCCCGGCCGGACCCGGG - Exonic
1160914691 19:1491010-1491032 CGCCGCGCCCCGCCCTCTCCCGG + Exonic
1161045116 19:2130439-2130461 CGCTGCGCCCTGCCTTTCCCCGG - Exonic
1161062599 19:2222610-2222632 CACCGCGCCCGGTCTCCCTCTGG - Intronic
1161203698 19:3029371-3029393 CCCCGCGCCCGCGCCCCCCCCGG + Intronic
1161365263 19:3875575-3875597 CACCGCGCCCGGCCTCTCCTTGG + Intergenic
1161545485 19:4877954-4877976 CCCCGGGCCAGGCCTCCACCTGG + Intergenic
1161596405 19:5153185-5153207 CCCCGACCCCGGCCCTCTCCAGG - Exonic
1162126534 19:8502466-8502488 CCCCCCGCCCGCCCCTCCACAGG + Intronic
1162235954 19:9309724-9309746 CGCCCCGCCCTGCCTGCCCCGGG - Intronic
1162414757 19:10528799-10528821 CACCGCGCCCGGCCTACACCTGG + Intergenic
1162553652 19:11373113-11373135 CACCGCGCCCGGCCAACACCTGG + Intergenic
1162555939 19:11385601-11385623 CACCGCGCCCGGCCTACGCCTGG - Intronic
1162706762 19:12560891-12560913 CACCGCGCCCGGCCTTCTGTAGG + Intronic
1163390487 19:17027199-17027221 CCCCGGGCCCGCCCCTCACCAGG + Intergenic
1163441512 19:17324498-17324520 CCCCGTGCCTGACCCTCCCCAGG - Intronic
1163607146 19:18281589-18281611 CGCAGCGCCCGGCCCTCCACTGG + Exonic
1163771109 19:19192004-19192026 CTCCGCGCCCGGCCTTTGTCAGG + Intronic
1165173155 19:33907096-33907118 CTCCGCGCACGGCCTTCCCAGGG + Intergenic
1165236848 19:34428567-34428589 GCGCGCGCCCGGCCCTCACCAGG - Exonic
1165307458 19:35011300-35011322 TCCTGCGCCCGGCCCTGCCCTGG - Intronic
1165387599 19:35520078-35520100 CACCGCGCCTGGCCATCACCCGG - Intergenic
1165460072 19:35939252-35939274 CACCGCGCCTGGCCTTCCTCTGG + Intronic
1165994237 19:39833266-39833288 CCCCGCGCCAGCCCTGACCCGGG - Exonic
1166119392 19:40676472-40676494 CACCGCGCCTGGCCTTCTCAGGG - Intronic
1166677479 19:44748628-44748650 CCCCGCCCCCGGCCCCCCCGGGG - Exonic
1167328781 19:48841209-48841231 TCCCTCGCCCGACCTCCCCCCGG - Exonic
1167440793 19:49507685-49507707 CACCGCGCCCGGCCTTGCCAGGG + Intronic
1167633768 19:50641455-50641477 CACCGCGCCCGGCCTAGCCCAGG + Intronic
1167747503 19:51361071-51361093 CACCGCGCCCGGCCCACGCCTGG + Intronic
1168148049 19:54430471-54430493 CCCAGTGCCCGGCCTTCCCCCGG + Intronic
1168229135 19:55017780-55017802 CACCGCGCCCGGCATATCCCAGG - Intronic
1168246930 19:55117193-55117215 CCCCCCGCCCGGCGTCTCCCGGG - Intronic
1168354036 19:55691305-55691327 CCCTGCTCCATGCCTTCCCCTGG - Intronic
1168459173 19:56539146-56539168 CCTTGAGCGCGGCCTTCCCCGGG - Exonic
1168536404 19:57174027-57174049 CACCGCGCCCGGCCCACCTCAGG + Intergenic
1168536441 19:57174171-57174193 CACCGCGCCCGGCCCACCTCAGG + Intergenic
1168554906 19:57329798-57329820 CACCGCGCCCGGCCATCTCAGGG + Exonic
925609478 2:5691884-5691906 AGCCGCGCCCGGCCTGCCCCGGG - Intergenic
925942892 2:8837310-8837332 GCCCGCGCCATGCCCTCCCCGGG + Intronic
925943437 2:8840164-8840186 CACCGCGCCCGGCCCCCTCCTGG + Intergenic
927592327 2:24367107-24367129 CACCGCGCCCGGCCTCCCTGGGG + Intergenic
927637906 2:24829303-24829325 CACCGCGCCCGGCCCCCCACTGG + Intronic
927685641 2:25168680-25168702 CCCCGCGGCCCCCCTTCCCCTGG - Exonic
927698310 2:25252153-25252175 CCCCGCCCCCGGTCTCCCCGGGG + Intronic
927830552 2:26346317-26346339 CCCTGCTCCCGGCCTCGCCCAGG + Intronic
927900930 2:26817726-26817748 CACCGCGCCCGGCCTTACGGAGG + Intergenic
927976650 2:27343503-27343525 CCACGGGGCCGGCCTCCCCCAGG + Exonic
928001014 2:27523185-27523207 CACTGCGCCCGACCTTCCTCCGG + Intronic
928263285 2:29787081-29787103 CACCATGCCCGGCCTTCCCTGGG + Intronic
928363963 2:30687591-30687613 CACTGCGCCCAGCCTTCTCCTGG + Intergenic
928426677 2:31184169-31184191 CACCGCGCCCGGCCCTCCTCAGG + Intronic
928545583 2:32326576-32326598 CACCGCGCCCAGCCTACCCTTGG + Intergenic
929628902 2:43438011-43438033 CACCGCGCCTGGCCATCCCTTGG - Intronic
929742722 2:44620978-44621000 CACCGCACCCGGCCTGCTCCAGG - Intronic
929848869 2:45562518-45562540 CACCGCGCCCGGCCTGTCACTGG + Intronic
930070043 2:47358901-47358923 CACCGCACCCGGCCTACGCCTGG - Intronic
931292150 2:60882384-60882406 CACCGCGCCCGGCCTACACTTGG - Intronic
931382344 2:61765175-61765197 CACCGCGCCCGGCCCCCCTCTGG + Intergenic
931683033 2:64768387-64768409 CCCCGCGGCCCGCTTGCCCCAGG - Intergenic
931706475 2:64950711-64950733 CCCTGGGTACGGCCTTCCCCAGG - Intergenic
932407815 2:71525510-71525532 CACGGCGCCCAGGCTTCCCCAGG + Intronic
932467176 2:71931414-71931436 CACCGCGCCTGGCCTGCCACTGG + Intergenic
933207057 2:79518938-79518960 CACTGCGCCTGGGCTTCCCCAGG - Intronic
933662162 2:84936701-84936723 CACCACGCCCGGCCTAGCCCAGG - Intergenic
933886310 2:86721137-86721159 CCCCGCTCCCAGCCGGCCCCGGG + Intronic
933923869 2:87075569-87075591 CCCCGCCCCCAGCCGGCCCCGGG - Intergenic
933954396 2:87354248-87354270 CCCCGAACCTGGTCTTCCCCAGG + Intergenic
934274603 2:91566242-91566264 CCCCGAACCTGGTCTTCCCCAGG - Intergenic
934460865 2:94213233-94213255 CCCCGGCCCCGGCCCTGCCCTGG + Intergenic
934754480 2:96816092-96816114 CCACGCCCCCGGCCCGCCCCTGG + Intergenic
935112429 2:100105162-100105184 GGCCCCGCCCGGCCTTGCCCGGG + Intronic
936038177 2:109129116-109129138 CGCCGCGCCCCGGCCTCCCCGGG + Intergenic
936341619 2:111638733-111638755 CCCCTCTCCCTGCCTGCCCCTGG + Intergenic
936463761 2:112729408-112729430 CACCGCGCCTGGCCTTGGCCTGG + Intronic
936547369 2:113404267-113404289 CACCGCGCCCGGCCATTCCCAGG - Intergenic
936577671 2:113669342-113669364 CCCCGCGCCCGGCCTAGTCTGGG - Intergenic
936659069 2:114522270-114522292 CACCGCGCCCGGCCTATCCAAGG + Intronic
937158727 2:119740326-119740348 CACCGCGCCCGGCCTTCCTGTGG - Intergenic
937269516 2:120639602-120639624 CACCGCGCCCGGCCTTTTGCTGG - Intergenic
937951076 2:127388186-127388208 CCCCGCCCCCGCCCCTGCCCCGG + Intronic
938020296 2:127900931-127900953 CACCGCGCCCGGCCTGTCCAGGG + Intergenic
938410857 2:131062734-131062756 CGCCGCGTCCGGCCTACCCAAGG + Intronic
938982383 2:136539051-136539073 CCCCGCCCCCTCCCCTCCCCCGG + Intergenic
939990670 2:148875187-148875209 CCCTCCGCCCCGCCCTCCCCTGG - Intergenic
940342012 2:152591295-152591317 CACTGCGCCCGGCCTCCCTCTGG + Intronic
940830019 2:158456891-158456913 CCTCCCGCCCGGCCAGCCCCGGG - Intergenic
941955694 2:171202165-171202187 CACCGCGCCCGGCCTGAGCCGGG - Intronic
943639556 2:190343685-190343707 CGCCGCCCCCGGCTTTCCCGCGG - Exonic
943759551 2:191593199-191593221 CACCGCGCCCGGCCACCCCCTGG - Intergenic
945885769 2:215373968-215373990 CACCGCGCCTGGCCTTTCCAGGG + Intronic
946362862 2:219229479-219229501 CCCCGTGTCTGGCCTTGCCCAGG - Intronic
946702105 2:222424483-222424505 CCGCCCGCCCGGCCTCCGCCCGG + Intergenic
947122975 2:226836265-226836287 CCCCGCTCTCGGACTTGCCCCGG - Intronic
947399221 2:229714890-229714912 TCCCGCGCCCTGCCCTGCCCGGG - Intergenic
947570803 2:231232737-231232759 CACTGCGCCCGGCCTTTGCCAGG + Intronic
947686258 2:232088256-232088278 CACCGCGCCCGGCCCACGCCTGG - Intronic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
948174666 2:235933817-235933839 CACCGCGCCCGGCCTTTCTAAGG + Intronic
948208029 2:236173144-236173166 CCCCCAGCCTGGCCTTCGCCTGG - Intergenic
948468549 2:238163625-238163647 CCCTGCGCCCGGCAGGCCCCTGG + Intronic
948492270 2:238320948-238320970 CCCCGAGCCCGGCCCACACCCGG - Intronic
948586970 2:239025807-239025829 CCCCGCCCCCCGCCCCCCCCAGG + Intergenic
948637520 2:239349067-239349089 CCCCCAGCCCGGCCTGCCCAGGG + Intronic
948805484 2:240452096-240452118 CCCAGCTCCCCACCTTCCCCAGG - Intronic
1168769797 20:408018-408040 CCCCGCCCCCGGCCCCGCCCCGG + Intronic
1169171652 20:3470555-3470577 CTCCGCGCCCGGCCTATGCCAGG + Intergenic
1169244600 20:4015590-4015612 CGCGGCGCCCGCCCCTCCCCCGG - Intergenic
1169673782 20:8132435-8132457 CGCAGCGCCCGGCCATGCCCCGG - Intronic
1170879609 20:20284571-20284593 CACCGCGCCCGGCCTTCAATTGG + Intronic
1171030294 20:21670498-21670520 CACCGCGCCCGGCCTGCAGCTGG - Intergenic
1172036382 20:32013736-32013758 CACCACGCCTGGCCTTCCCCAGG + Intronic
1172061547 20:32190206-32190228 CCCGCCGCCCGGCCTTGCCCGGG - Intergenic
1172064157 20:32207599-32207621 CCCCTCTCCCCGCCGTCCCCTGG + Intronic
1172958340 20:38778449-38778471 CACCGCGCCCGGCCTGCATCAGG + Intergenic
1173471786 20:43329657-43329679 CACCGCGCCCGGCCTTTTCTTGG - Intergenic
1173556702 20:43971348-43971370 GCCCTCGCCCCGCCTTCCCTTGG - Intronic
1173727808 20:45309131-45309153 CCCCCCACCCTGCCTTCCCCAGG + Intronic
1174446877 20:50596460-50596482 CTGCCCGCCCTGCCTTCCCCAGG - Intronic
1174607394 20:51770659-51770681 CACTGCGCCCGGCCGTGCCCGGG - Intergenic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1175394736 20:58650498-58650520 CCCCGCGCCCCCCCGTGCCCCGG - Intergenic
1175800415 20:61798178-61798200 CGCCCCGCCCGGCCCTGCCCCGG + Intronic
1175867393 20:62186815-62186837 CACCGTGCCCAGCCTTCCCTGGG + Intronic
1175878738 20:62244145-62244167 CAGGGCTCCCGGCCTTCCCCAGG - Intronic
1176124971 20:63471349-63471371 CCCCCCGCCAGCCCTGCCCCAGG + Intronic
1176156943 20:63626811-63626833 CCGCGCGGCCGCCCCTCCCCCGG + Intronic
1176181658 20:63752347-63752369 CCCCGCCCCCGCCCTGCCTCGGG - Intronic
1176232274 20:64038563-64038585 CCCCGCGCCCGGCCCGGCCCGGG - Intronic
1176414393 21:6466682-6466704 CCGTGCGCGTGGCCTTCCCCAGG - Intergenic
1176591993 21:8656275-8656297 CCCTGGCCCCGGCCTTGCCCTGG + Intergenic
1176868594 21:14070527-14070549 CGACGCTCCAGGCCTTCCCCAGG - Intergenic
1178360705 21:31946900-31946922 CCACGCGCCCGGCCGTTCACTGG + Intronic
1178518986 21:33271438-33271460 CACCGCGCCTGGCCTTCACTAGG - Intronic
1179451872 21:41473553-41473575 CCCAGCGCCCGCCCCTCCCAAGG + Intronic
1179536662 21:42057243-42057265 GCCCACGCCCGCCCTTCCCCAGG + Intergenic
1179689891 21:43075004-43075026 CCGTGCGCGTGGCCTTCCCCAGG - Intronic
1179782974 21:43714345-43714367 CACCGCGCCCGGCCAGTCCCAGG + Intergenic
1179796673 21:43789087-43789109 CACCGCGCCCGGCACACCCCTGG + Intergenic
1179840911 21:44072750-44072772 CACCGCGCCCGGCCTCTCCTAGG + Intronic
1179882647 21:44299993-44300015 CCCCGCCCCGGGCCCGCCCCCGG - Intergenic
1179883516 21:44303555-44303577 CACCGTGCCCTGCCTTTCCCTGG + Intronic
1179989619 21:44940269-44940291 CCGCGACCCCGGCCTTCCCTCGG + Intronic
1180079520 21:45480403-45480425 CCCCCCGCCTGGCCTACTCCTGG - Intronic
1180224267 21:46380446-46380468 CACCGCGCCCGGCCAACCCTGGG + Intronic
1180274842 22:10633404-10633426 CCCTGGCCCCGGCCTTGCCCTGG + Intergenic
1180488556 22:15821521-15821543 CCCCCCGCCGGGCCGACCCCAGG - Intergenic
1181276629 22:21691390-21691412 CACCGCGCCTGGCCTCCTCCTGG - Intronic
1181312235 22:21951633-21951655 CACCGCGCCCGGCCTTCAGGGGG + Intronic
1181465358 22:23107923-23107945 CCCCGCAGCAGGCCTTGCCCTGG - Intronic
1181859420 22:25806520-25806542 CCCCTCCCGCTGCCTTCCCCAGG - Intronic
1182101960 22:27663734-27663756 CCCGGCCCCAGGCCTGCCCCTGG + Intergenic
1182226209 22:28800579-28800601 CGCCGCGCCCGGCCTTTCTACGG + Exonic
1182323134 22:29491313-29491335 CCCTGCCCCCAGCCTTCCCAGGG - Exonic
1182795968 22:32991952-32991974 CCCAGAGCCCTGCCTCCCCCAGG + Intronic
1183068621 22:35380968-35380990 GCCCGCGCCCAGCCCGCCCCGGG - Exonic
1183093737 22:35540441-35540463 CCCGGCGCCCCGCCTCGCCCCGG - Intergenic
1183211755 22:36455453-36455475 CCCTGGGGCCTGCCTTCCCCAGG + Intergenic
1183393865 22:37560731-37560753 GGCCGCGCCCGGCCTTCCTGTGG - Intronic
1183538957 22:38418713-38418735 CAGCGCCCCCGGCCTTCTCCCGG + Intergenic
1183941797 22:41300037-41300059 TACCGCGCCCGGCCTCCTCCTGG + Intergenic
1184092212 22:42298833-42298855 CTCCCCACCAGGCCTTCCCCAGG + Intronic
1184111075 22:42395592-42395614 CACCGCGCCTGGCCTTCCTTTGG - Intronic
1184164641 22:42720379-42720401 CCCGACGCCCAGGCTTCCCCCGG + Intronic
1184236986 22:43187680-43187702 CCGCCCTCCCGGCATTCCCCGGG - Intergenic
1184253041 22:43271726-43271748 CCCCGAGCCCAGCCACCCCCAGG + Intronic
1184680985 22:46072006-46072028 CCCCGCGCCCGCCCGTCCGGCGG + Intronic
1184787371 22:46678397-46678419 CCCAGCCCCCGCCCTGCCCCAGG + Exonic
1184943185 22:47783424-47783446 CACCACGCCCGGCCTCTCCCAGG + Intergenic
1185056546 22:48581618-48581640 CCCCGAACCCGGCCTTCTCCAGG - Intronic
1185402418 22:50625879-50625901 CCCCTGTCCTGGCCTTCCCCTGG - Intronic
949552099 3:5120017-5120039 CACCGCGCCCGGCCTATCCTAGG + Intergenic
950409132 3:12823438-12823460 CACCGCGCCCAGCCTACACCTGG - Intronic
951428259 3:22575411-22575433 CACTGCGCCCGGCCTGTCCCTGG - Intergenic
953405877 3:42659498-42659520 CCCGGCGCCGGGCGTTCTCCCGG - Exonic
954096542 3:48333046-48333068 CCCCTGCCCCGGCGTTCCCCCGG - Intergenic
954240813 3:49292093-49292115 CACCACGCCCGGCCAACCCCTGG + Intronic
954327187 3:49869943-49869965 CCCCGCCCCCAGCCCGCCCCCGG - Exonic
955400401 3:58587105-58587127 CCCTGCCCCCCTCCTTCCCCCGG - Intronic
956659334 3:71583079-71583101 CCCCGCGCCCGGGCGGCCACCGG + Intronic
957193501 3:77039732-77039754 CCTCGCCCCCGCCCCTCCCCGGG + Intronic
958915987 3:100050816-100050838 CACCGCACCCAGCCTCCCCCAGG + Intronic
959664090 3:108902301-108902323 CACCGCGCCCGGCCCTACCTTGG + Intergenic
961236881 3:125375051-125375073 CCCCTCCCCCGCCCTCCCCCGGG + Intronic
961446218 3:126983006-126983028 CCCCGCCCCCGCCCCGCCCCCGG + Intergenic
961514283 3:127423055-127423077 TCCAGCCCCGGGCCTTCCCCAGG - Intergenic
961552588 3:127677654-127677676 TCCTGAGCCCGGCCTCCCCCAGG + Exonic
961800685 3:129446501-129446523 CACCGCGCCCGGCCGACCCTAGG + Intronic
962508498 3:136073253-136073275 CACCGCACCCAGCCATCCCCAGG + Intronic
962556995 3:136563730-136563752 CACCGTGCCCGGCCTTTCTCTGG - Intronic
965596979 3:170419645-170419667 GCTCCCGCCCGGCCTCCCCCGGG + Intronic
966222605 3:177565683-177565705 CACCGCGCCCGGCCTCCTCTAGG + Intergenic
966607393 3:181834848-181834870 CACCGCGCCCGGCGGGCCCCAGG + Intergenic
966711999 3:182980677-182980699 CCCCGCGCGGGGCTTCCCCCGGG + Intronic
966842818 3:184103339-184103361 CACCGCGCCCGGCCACCACCCGG - Intronic
967684913 3:192408309-192408331 CCCCGCGACTGCCCTTTCCCTGG - Exonic
967735958 3:192952836-192952858 CACCGCGCCCGGCCTGCTGCTGG - Intergenic
967811008 3:193761120-193761142 CACCGCGCCCGGCCTGCGCCAGG - Intergenic
968479348 4:826545-826567 GCCCGGGCTCGACCTTCCCCCGG + Intergenic
968483784 4:849074-849096 CCCCGCCCTTGGCCTTGCCCTGG + Intergenic
968697850 4:2041540-2041562 GCCCTCGCCCGGCTTTTCCCTGG - Intronic
968774556 4:2532644-2532666 CACCGCGCCTGGCCTACACCTGG - Intronic
968797884 4:2721023-2721045 CACCGCGCCCGGCCCACGCCTGG - Intronic
968848613 4:3062402-3062424 CCCTGCACCCTCCCTTCCCCTGG + Intergenic
968952909 4:3703747-3703769 CCCCGCGGCCCGTCTTCCCGTGG - Intergenic
968957271 4:3725815-3725837 GCCAGCCCCCGGCCCTCCCCTGG + Intergenic
971358274 4:25914051-25914073 CCCCGCCCTCCGCCTTCCCCGGG - Intronic
971380322 4:26091290-26091312 CCCCGCTCCCACCCTTCACCCGG + Intergenic
971586817 4:28414920-28414942 CACCGCGCCCGGCCTACCAGTGG + Intergenic
972418805 4:38867871-38867893 CCCCGCGCTCGCCCGCCCCCCGG - Intronic
972643436 4:40945942-40945964 CACCACGCCCGGCCTTCCTTGGG - Intronic
972740333 4:41881661-41881683 TCCCGCGCCCCGGCTCCCCCAGG + Intergenic
974158273 4:58102701-58102723 CACTGCGCCCAGCCTTCTCCTGG + Intergenic
976704582 4:88007609-88007631 CCCCGCCCCCGACCTCCCCGCGG - Intergenic
976813590 4:89122229-89122251 CACCGCGCCCGGCCAGCCCCTGG - Intergenic
977514205 4:97999412-97999434 CACTGCGCCTGGCCTTGCCCTGG - Intronic
980314410 4:131178246-131178268 CACCGCGCCCAGCCTTTCCATGG - Intergenic
982539117 4:156645213-156645235 CACCCCGCCCGGCCTTACCCTGG + Intergenic
983229166 4:165112590-165112612 CCCCGCGCCCAGGCCTCCCCGGG + Intronic
983235252 4:165171949-165171971 CACCGCGCCCAGCCTTTCCCAGG - Intronic
983517188 4:168670443-168670465 CACCGCGCCCGGCCCGCGCCCGG - Intronic
984807989 4:183768851-183768873 AGCCGCGCCCGGCCTGCACCAGG + Intergenic
985522050 5:378539-378561 CCAAGCCTCCGGCCTTCCCCAGG + Intronic
985532590 5:442938-442960 CACCGCGTGCGCCCTTCCCCAGG - Exonic
985552759 5:541697-541719 CCCCGCCCCAGGCCCTCTCCAGG - Intergenic
985575374 5:671241-671263 CCCCACCCCCGCCCCTCCCCAGG - Intronic
985778716 5:1858561-1858583 CCCCGCGCCCCTCCTGGCCCAGG - Intergenic
986794940 5:11200965-11200987 CACCGTGCCAGGCCATCCCCAGG + Intronic
988567729 5:32333040-32333062 CACCGCGCCCAGCCTACACCTGG + Intergenic
988777518 5:34490766-34490788 CCCCGCCCCCTGCCCACCCCCGG - Intergenic
990310071 5:54529303-54529325 CCCCGCTCCAGGCCATCTCCAGG - Intronic
991967661 5:72108284-72108306 CCCCCCGCCCCCCCCTCCCCGGG + Intronic
992796099 5:80256136-80256158 CCCCGTGCCCGCCCCTTCCCGGG + Intergenic
992914525 5:81434367-81434389 CACTGCGCCCGGCCATCGCCTGG - Intronic
993716476 5:91280016-91280038 CACCGCGCCCGGCCTGTCTCAGG + Intergenic
993837691 5:92835326-92835348 CCCCGCCCCCGCCCTCCGCCAGG + Intergenic
994367007 5:98928462-98928484 CGCCGCGCCCGCCCTCCGCCCGG + Intronic
995798066 5:115962377-115962399 CCCCGCCCCCGGCCAGCGCCAGG - Intergenic
996269630 5:121587655-121587677 CACCGCGCCCGGCCTGTCACAGG - Intergenic
996302223 5:122001847-122001869 CACCGCGCCCGGCCATCCTTTGG + Intronic
997563682 5:134870929-134870951 CACCGCACCCGGCCACCCCCCGG + Intergenic
998831823 5:146167815-146167837 CACCGCGCCCGGCCTACGACCGG + Intronic
999987767 5:157021053-157021075 CCCTGTGACCAGCCTTCCCCAGG - Intergenic
1000328780 5:160191671-160191693 CACCGCGCCCGGCCGAGCCCAGG - Intronic
1001166781 5:169375713-169375735 CACCGCACCCGGCCAGCCCCAGG - Intergenic
1001525200 5:172423929-172423951 CACCGCGCCCGGCCCGCCCTGGG + Intronic
1001666150 5:173435171-173435193 CCCCTCCCCATGCCTTCCCCAGG - Intergenic
1001939420 5:175729949-175729971 CCCCGTGCCTGGGCTTCCCCTGG - Intergenic
1002088838 5:176792806-176792828 CCCCAGGCCTGGCCATCCCCAGG - Intergenic
1002093497 5:176817856-176817878 CCCCGCGCCCGGCTGCCCCGCGG - Intronic
1002190198 5:177473768-177473790 CCCCCTTCCCGGCCTGCCCCGGG + Intronic
1002382918 5:178843087-178843109 CACCGCGCCCAGCCTATCCCAGG - Intergenic
1002445688 5:179288534-179288556 CCCTGCCCCCGCCCCTCCCCCGG - Intronic
1002487616 5:179550528-179550550 CCCCGCGCCCGCCCGCCCGCTGG + Intergenic
1002898532 6:1392820-1392842 TCCCGCGGCCGGCCTTCCCTGGG + Intronic
1002928747 6:1619674-1619696 CCCCGCGCCCGGCGCTGCCGGGG + Intergenic
1003085460 6:3056630-3056652 CACCGCGCCTGGCCGTTCCCTGG + Intergenic
1003290787 6:4776653-4776675 CCCAGCGCCCGGCCGGCCGCGGG + Exonic
1003921702 6:10838630-10838652 CCGCAGGCCCCGCCTTCCCCGGG + Intronic
1004690328 6:17987653-17987675 CCGCGCGCCCGCCCCTCCCCGGG - Intergenic
1005048063 6:21660852-21660874 CACCGCGCCCGGCCGACGCCTGG + Intergenic
1005987586 6:30884275-30884297 CGCCCGGCCCGGCCTCCCCCAGG - Intronic
1006360884 6:33586449-33586471 TCCTTCGCCCTGCCTTCCCCAGG - Intergenic
1007371102 6:41427610-41427632 CCCTCCCCCCGGCCTGCCCCGGG + Intergenic
1007378807 6:41473498-41473520 CCCAGTGCCCACCCTTCCCCAGG - Intergenic
1007390259 6:41546545-41546567 CCCCGCCCCCGGCCCAGCCCTGG - Exonic
1007553592 6:42747619-42747641 CCCCGCGCCCCGCCTGCGCGGGG - Intronic
1007616012 6:43180130-43180152 CCCCTCCCCCGGCTTTCTCCTGG - Exonic
1007701781 6:43770120-43770142 CCCCGCCCCCGGCCCGCCCCGGG - Intergenic
1008013536 6:46491979-46492001 CCCTGCGCCCGGCCCAGCCCAGG + Intergenic
1008013611 6:46492690-46492712 CCCCTCGTTCAGCCTTCCCCTGG + Intergenic
1008691203 6:53981442-53981464 CCCCGGGTCAGGCCATCCCCTGG + Intronic
1009931987 6:70187499-70187521 CCCCACCCCTGGCTTTCCCCTGG - Intronic
1009932000 6:70187593-70187615 CCCCACCCCTGGCTTTCCCCTGG - Intronic
1011281129 6:85678912-85678934 CCGCGCGCCCGGCCATTTCCCGG + Intergenic
1011488371 6:87866678-87866700 CACCGCGCCCGGCCGACCGCAGG + Intergenic
1012883813 6:104822078-104822100 CACCGCGCCCGGCCCACGCCTGG - Intronic
1013120696 6:107138040-107138062 CACCACGCCCGGCCCTCACCAGG + Intergenic
1013217885 6:108046631-108046653 CACCGCGCCCGGCCTGTCTCTGG + Intronic
1014230295 6:118895010-118895032 CCCCGCCGCCCGCCTGCCCCCGG + Intronic
1014437487 6:121437078-121437100 CCCCGCGCCCGTCCGGCCCACGG - Intronic
1015402133 6:132798644-132798666 CCCCGCCCCCGGCCTCCTCCCGG - Intergenic
1015402302 6:132800104-132800126 CACCGCGCCCGGCCCTCACTGGG - Intergenic
1015525836 6:134175067-134175089 CCCTGCGCCAGGCCGTCCCCGGG - Intronic
1015786329 6:136923445-136923467 CCCCGCGCCTGGCCCGCTCCGGG + Intronic
1015896570 6:138022791-138022813 CACCGCGCCCGGCCATCAGCAGG + Intergenic
1016461852 6:144286267-144286289 GCCGGAGCCCCGCCTTCCCCGGG - Intronic
1018368816 6:163149269-163149291 CCCAGGCCCCGGCCCTCCCCAGG + Intronic
1018679107 6:166248973-166248995 CACCGTGCCCGGCCTTCACGCGG + Intergenic
1018852246 6:167649143-167649165 CACCGTGCCCGGCCTATCCCGGG - Intergenic
1019213298 6:170423341-170423363 CCCCGCGCCCGGCGAAACCCTGG + Intergenic
1019501845 7:1368725-1368747 CTCCGGCCCCGTCCTTCCCCAGG + Intergenic
1019597245 7:1863798-1863820 CACCGCGCCTGGCCTTCCTCGGG - Intronic
1019701423 7:2476477-2476499 CCCCACCCCCAGCCCTCCCCCGG - Intronic
1020005251 7:4780474-4780496 CACCGCGCCTGGCCTACGCCCGG - Intronic
1020096157 7:5370749-5370771 ACCTGCGCCAGGCCTTCCTCGGG + Exonic
1020106476 7:5424386-5424408 CCCGGCCCCCGGCCTCCCCTGGG + Intronic
1020275132 7:6619556-6619578 CACCGCGCCCGGCCATCCCTTGG + Intronic
1021259193 7:18432657-18432679 CACAGCGCCCGGCCTTCCACTGG - Intronic
1021614870 7:22492031-22492053 CACCGCGCCCGGCCTACCTATGG - Intronic
1022673028 7:32473717-32473739 CACCGCGCCCGGCCTAACCACGG + Intergenic
1022704829 7:32792514-32792536 CACCGCGCCCGGCCACCTCCAGG - Intergenic
1022810010 7:33859547-33859569 CACCGCGCCCGGCCTGAGCCTGG + Intergenic
1023187819 7:37549842-37549864 CCCTGGGCACAGCCTTCCCCAGG - Intergenic
1023363924 7:39444293-39444315 CACTGCGCCCGGCCTTCATCTGG - Intronic
1023773578 7:43582963-43582985 CCCCGCGCCCGACCCCGCCCCGG - Intronic
1024043916 7:45574798-45574820 GCCCGCGCCCGGCCTGGCCAAGG + Exonic
1024650938 7:51402961-51402983 CGCCGCACCCGGCCTTCACCTGG + Intergenic
1025055064 7:55758538-55758560 TGCCGCACCCGGCCTTCACCTGG + Intergenic
1025133136 7:56388764-56388786 CGCTGCACCCGGCCTTCACCTGG + Intergenic
1025951224 7:66147051-66147073 CACCGCGCCCGGCCCACCCCAGG - Intronic
1026360307 7:69597586-69597608 CCCCGCGCCCGGATGACCCCTGG - Intergenic
1026822152 7:73557173-73557195 GCCCGCGCCCGGCCCAGCCCGGG - Intronic
1026935765 7:74254441-74254463 CCCCGCCCCCTGGCTTCCGCCGG + Exonic
1027002177 7:74661152-74661174 CACCGCGCCTGGGCGTCCCCGGG + Intronic
1027189569 7:75989061-75989083 CCCTCCACCCAGCCTTCCCCCGG - Intronic
1029270463 7:99374403-99374425 CCCTGCGCCCGGCAGTCCCCGGG + Intronic
1029456978 7:100676319-100676341 CCCCGCACCAGGCCCTCACCCGG - Exonic
1029694694 7:102204992-102205014 CCCCATGCCCGCCCCTCCCCAGG + Intronic
1029723634 7:102387532-102387554 CACCGCGCCCGGCCTACGCCTGG - Intronic
1031895974 7:127347989-127348011 CCCTGCGCCCGGCCGCCCCCGGG - Intronic
1032030214 7:128476889-128476911 CCCCTCGCCCGGCCTGTCGCTGG + Intronic
1032274394 7:130441278-130441300 CCCCGCCCCCGGCTTTGCGCAGG - Intronic
1033165610 7:139036140-139036162 CCCCTCGCCCGGCCTCCCGCAGG - Intergenic
1034135346 7:148762856-148762878 CACCGCGCCCGGCCTAGGCCTGG - Intronic
1034147442 7:148884871-148884893 GCCCGCGCCCTCCCCTCCCCGGG - Intergenic
1034433354 7:151051691-151051713 CACCGTGCCCGGCCTCTCCCAGG + Intronic
1034450980 7:151137200-151137222 CCTGGCGCCTGCCCTTCCCCTGG + Intronic
1035021692 7:155804284-155804306 CCCCGCCCCCGCCCCTCCGCAGG - Intronic
1035190449 7:157163095-157163117 CACCGCGCCCGGCCATCTCTGGG - Intronic
1036396773 8:8377197-8377219 CCCAGCCCCCGGCCCACCCCCGG - Exonic
1036664491 8:10730086-10730108 CCGCGTGCCGGGTCTTCCCCAGG + Intronic
1037269857 8:17114829-17114851 CACCGCGCCCGGCCTCCTCTGGG - Intronic
1038326028 8:26573378-26573400 CACCGCGCCCGGCCACGCCCAGG - Intronic
1039060010 8:33565806-33565828 CTCCGCGCCCGGCTGTCCCTGGG - Intronic
1040471243 8:47737586-47737608 CCCCGCGCCCGGCCCCGCCCGGG - Exonic
1040816978 8:51519251-51519273 CACCGCACCCGGCCTTCTTCAGG - Intronic
1040951506 8:52941746-52941768 CCGCGCGCCCGGGCTACTCCGGG - Intergenic
1041244902 8:55880312-55880334 CCCCGCGCCCTGGCTCCCCCGGG - Intronic
1041648870 8:60281555-60281577 ATCCCCGCCCGCCCTTCCCCCGG + Intergenic
1041739071 8:61139545-61139567 CCCCGCCCCCGGCCTCCGCTCGG - Intronic
1042244518 8:66697314-66697336 CACCGCGCCCGGCCTTGCAGGGG - Intronic
1042591275 8:70402122-70402144 CCCCGCCCCCTTCCTTCCTCCGG + Intronic
1043671261 8:82887849-82887871 CACTGCGCCCGGCCAGCCCCTGG - Intergenic
1043969610 8:86514784-86514806 CCCCGAGCCCGGGCTCCTCCAGG - Intronic
1044266855 8:90191890-90191912 CACTGCGCCCGGCCTCCCACTGG - Intergenic
1044394942 8:91700273-91700295 CACCGCGCCCGGCCGTTTCCAGG + Intergenic
1045111893 8:98944444-98944466 CCCCGCCCGCGTCCCTCCCCAGG - Exonic
1045334392 8:101185863-101185885 CACCGCGCCCGGCCCACGCCTGG - Intronic
1045488716 8:102654456-102654478 ACCCGCTCCCGGCCCACCCCCGG + Intronic
1047287154 8:123497100-123497122 CACCGCGCCCGGCTCTCCCCCGG + Intergenic
1047739341 8:127794403-127794425 CGGCGCTCCCGGCCTTCCCCAGG - Intergenic
1047951473 8:129939400-129939422 CCGCGGCCCCGGCCTGCCCCCGG - Intronic
1048838848 8:138547012-138547034 CACCATGCCGGGCCTTCCCCAGG + Intergenic
1049220106 8:141425180-141425202 CCCCCCGCCCCACCCTCCCCCGG - Intronic
1049372725 8:142275408-142275430 CACCGAGCCCGGCTTTTCCCAGG - Intronic
1049544067 8:143221437-143221459 CCGCACCCCCGGCCCTCCCCAGG - Intergenic
1049619185 8:143590160-143590182 CCCCGTGCCCGCCCTCCCCGTGG + Intronic
1049636830 8:143693581-143693603 CACCGCGCCCGGCCTCCTCTGGG + Intronic
1049665608 8:143841290-143841312 CCCCGCCCCCGCCCGTTCCCAGG + Intergenic
1049695433 8:143982179-143982201 CACCGCGCCCGGCCTTGCACGGG - Intronic
1049715257 8:144086742-144086764 CCCCGTGCCCCGCCTGCCCCTGG - Intergenic
1049726420 8:144148448-144148470 CCCAGTGCCCGGCCCTCCCCGGG + Intronic
1049728039 8:144160055-144160077 CACCGCGCCCGGCCCACGCCTGG + Intronic
1049761125 8:144332414-144332436 CCCCGCTTCCGCCCTGCCCCGGG - Exonic
1049762655 8:144338096-144338118 CCCCGCAGGCCGCCTTCCCCGGG - Intergenic
1051936245 9:22446721-22446743 CCCCGCCCCGGGCCCTCCCCCGG + Intergenic
1052195799 9:25713472-25713494 CACCGCGCCCGGCCCTCCATGGG - Intergenic
1052362225 9:27573486-27573508 CCCCGCCCCGGGCCCGCCCCCGG + Intronic
1052971523 9:34379967-34379989 CCCGGAGCCCGACCTTCCCCAGG - Intronic
1055056229 9:72026813-72026835 CACCGCGCCCGGCTTGCCCAAGG + Intergenic
1055297606 9:74850429-74850451 CACCGCGCCCGGCCTTACGTTGG - Intronic
1056198256 9:84249589-84249611 CCACCCCCCTGGCCTTCCCCAGG - Intergenic
1057146971 9:92764946-92764968 CCCGGCGCCCGCCCGGCCCCCGG + Intergenic
1057199880 9:93134290-93134312 GCCCGCCCCCGGCCCGCCCCCGG + Intergenic
1057361198 9:94374923-94374945 CCCCGCGCCCGCGCTCACCCAGG - Exonic
1057662165 9:97013241-97013263 CCCCGCGCCCGCGCTCACCCAGG + Exonic
1058479099 9:105372660-105372682 CACCGCGCCCGGCCTACCTGTGG - Intronic
1059223022 9:112643887-112643909 CACCGCACCCGGCCTTCACATGG - Intronic
1059769746 9:117414479-117414501 GCCGGCGCCCAGCCTTACCCAGG + Exonic
1060109222 9:120894607-120894629 GCCCGCGCCCGGCCTTCTCTTGG - Intronic
1060209181 9:121699701-121699723 CTTCGCGCCCGGCCTCGCCCGGG - Intronic
1060514643 9:124258129-124258151 CCCGGCCCCCGCCCTTCTCCGGG - Intronic
1061139121 9:128753648-128753670 CCCGGCCCCAGGCCTTGCCCTGG + Intronic
1061347990 9:130042595-130042617 GCCCGGTCCCGGCCCTCCCCGGG + Intronic
1061400872 9:130367651-130367673 CACCGCGACCAGCCTCCCCCTGG - Intronic
1061415447 9:130444841-130444863 CCCCGGGCCCGGCCCCCGCCTGG - Intergenic
1061429285 9:130520992-130521014 CCCCGCTCCCAGCCCTCCCATGG - Intergenic
1061671148 9:132188835-132188857 CCCAGCCCCCGGCCCTCCTCAGG - Intronic
1061674428 9:132207813-132207835 CACCGTGCCTGGCCTTGCCCTGG - Intronic
1061823082 9:133239289-133239311 TCCAGCGCCCGCCCTTACCCCGG + Intergenic
1062168795 9:135122706-135122728 CCCCGCTCTCTGCCTTCCCCAGG + Intergenic
1062393124 9:136341937-136341959 CACCGTGCCCAGCCATCCCCTGG + Intronic
1062574690 9:137200682-137200704 CCCCGAGCCCGGCCGCCCCAGGG + Exonic
1062645998 9:137548459-137548481 CACTGCGCCCGGCCCTTCCCTGG - Intronic
1203736421 Un_GL000216v2:143251-143273 CCCCGTCCCCGGGCTTCCGCGGG - Intergenic
1203738770 Un_GL000216v2:161214-161236 CCCCGGCCCCGGGCTTCCACTGG - Intergenic
1185602535 X:1350164-1350186 CACTGCGCCCGGCCTCCCCAAGG - Intronic
1186638309 X:11428526-11428548 CCCCAGGCCTGGCCTTCCTCTGG - Intronic
1186747357 X:12583622-12583644 CCCCGCCCCCGGCCCTGGCCAGG + Intronic
1187974726 X:24693796-24693818 CTCCGCCCCCGGCCTTCCCGCGG - Intergenic
1188054204 X:25522668-25522690 CTCCGCGCCCGGCCTGCCTTTGG + Intergenic
1189391751 X:40582137-40582159 CACCGCGCCCGGCCTCCCATAGG - Intronic
1189847764 X:45152067-45152089 CACCGCGCCCGGCCCCACCCAGG - Intronic
1192321172 X:70091859-70091881 CCCCGGCCCCAGCCTTCACCAGG - Intergenic
1193668744 X:84356907-84356929 CACCGCGCCCGGCCCTCCTGTGG + Intronic
1194784934 X:98071501-98071523 CCCTGAACCCGGCCATCCCCTGG - Intergenic
1195322897 X:103735095-103735117 CACCGTGCCCGGCCTACACCAGG - Intergenic
1195324028 X:103743591-103743613 CACCGCGCCCGGCCTCACCCAGG + Intergenic
1195689958 X:107616364-107616386 CACCGCGCCCGGCCTTCTGCAGG - Intergenic
1196079496 X:111616211-111616233 CACCGCGCCCGGCCTGTGCCCGG + Intergenic
1196266280 X:113650944-113650966 CCCCCTACCCCGCCTTCCCCAGG - Intergenic
1196786609 X:119426532-119426554 CGCCGCGCCCGGCCTTGGACTGG - Intronic
1197267094 X:124386436-124386458 CCCGGCTCCCTGCCTTCACCTGG - Intronic
1197594532 X:128450199-128450221 CACCGCGCCCGGCCGTCTCTGGG + Intergenic
1198005503 X:132489421-132489443 CCCCACGCCCGGCCTCCGCGAGG - Intronic
1198253117 X:134901358-134901380 CACCGCGCCCGGCCAACTCCTGG - Intronic
1200100795 X:153688436-153688458 CCCCCGGCCCGGCCGCCCCCCGG + Exonic
1200155365 X:153972116-153972138 CCCCTCGCCCGGCCGTCCGCGGG + Intergenic
1200208206 X:154332834-154332856 CTTGGAGCCCGGCCTTCCCCGGG + Intergenic
1200217532 X:154374678-154374700 CCCCGCGCCCGCCCCGCGCCCGG + Intergenic
1200887678 Y:8285868-8285890 CACCGCGCCCGGCCGCCTCCAGG + Intergenic
1201177991 Y:11321591-11321613 CCCCGTCCCCGGGCTTCCGCGGG - Intergenic