ID: 1077072562

View in Genome Browser
Species Human (GRCh38)
Location 11:682718-682740
Sequence ATGTGGGTTGATGGAAATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077072549_1077072562 11 Left 1077072549 11:682684-682706 CCTCTCACTGCATGGACACCCCA 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1077072562 11:682718-682740 ATGTGGGTTGATGGAAATTGGGG 0: 1
1: 0
2: 4
3: 15
4: 232
1077072556_1077072562 -9 Left 1077072556 11:682704-682726 CCACCCTATGGGCAATGTGGGTT 0: 1
1: 0
2: 1
3: 8
4: 74
Right 1077072562 11:682718-682740 ATGTGGGTTGATGGAAATTGGGG 0: 1
1: 0
2: 4
3: 15
4: 232
1077072553_1077072562 -7 Left 1077072553 11:682702-682724 CCCCACCCTATGGGCAATGTGGG 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1077072562 11:682718-682740 ATGTGGGTTGATGGAAATTGGGG 0: 1
1: 0
2: 4
3: 15
4: 232
1077072555_1077072562 -8 Left 1077072555 11:682703-682725 CCCACCCTATGGGCAATGTGGGT 0: 1
1: 0
2: 0
3: 14
4: 90
Right 1077072562 11:682718-682740 ATGTGGGTTGATGGAAATTGGGG 0: 1
1: 0
2: 4
3: 15
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077072562 Original CRISPR ATGTGGGTTGATGGAAATTG GGG Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
902766026 1:18615927-18615949 ATGTGGGTTGAGAGCAATTGAGG - Intergenic
902923478 1:19680782-19680804 GTTTGTGTTGATGGAACTTGGGG - Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
911437293 1:97877309-97877331 ATGAGGGTTGGTGGCAAGTGTGG - Intronic
911502969 1:98711697-98711719 GTGTTGGTTGATGAAGATTGGGG + Intronic
913223316 1:116676936-116676958 ATGTGGGTTGGGGGAGAATGGGG - Intergenic
916019351 1:160778633-160778655 AAGTGGGTTGCTGGGACTTGGGG - Intergenic
916448632 1:164897075-164897097 AGGTGGGTGGAAGGCAATTGGGG + Intronic
921303838 1:213775667-213775689 GTGGTGGTTGCTGGAAATTGGGG + Intergenic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1067748491 10:48954653-48954675 CTGTGGGTTGATGTAAACTCTGG - Intronic
1068230184 10:54161435-54161457 TTTTGGGGTGATGGAAATTTTGG + Intronic
1068716118 10:60190561-60190583 ATGTGGTTTGGTGGAACTTCTGG + Intronic
1068954618 10:62811571-62811593 ATGTGGCTTTGTGGAAAGTGTGG - Intergenic
1073398359 10:103236854-103236876 TTATGGGTTGATGGTTATTGGGG + Intergenic
1074090139 10:110244420-110244442 AAGTGGGTAGATGGAGATAGAGG + Intronic
1074861338 10:117512466-117512488 ATGGGGGTAGTTGGAAATAGTGG + Intergenic
1074888357 10:117713153-117713175 TTGTTGGTTGATGGACATTTAGG + Intergenic
1077072562 11:682718-682740 ATGTGGGTTGATGGAAATTGGGG + Intronic
1077210077 11:1366748-1366770 TTGTGGGTTTATGGGAATGGGGG - Intergenic
1077321779 11:1946134-1946156 ACTGGGGTTGATGGAAATTCAGG - Intergenic
1079956748 11:26875775-26875797 TTGTTGGTTGATGGACATTTAGG - Intergenic
1081373406 11:42331376-42331398 ATGTGGGTTCAGGGCAACTGGGG - Intergenic
1081611195 11:44564670-44564692 GTGTGGGTTGATGAGAATAGTGG - Intronic
1083066488 11:59929383-59929405 TTGTGGGTTTATGGAAATGAGGG + Intergenic
1084969898 11:72765435-72765457 TTGTGGCTTCATGGGAATTGGGG - Intronic
1085713172 11:78848610-78848632 ATGAGGGTTGAAGGAAGGTGAGG - Intronic
1085839676 11:79997061-79997083 GTGTGGGAGGATGGCAATTGGGG - Intergenic
1086006241 11:82041156-82041178 TTGTGGGTATATGTAAATTGTGG - Intergenic
1086159230 11:83702661-83702683 CTGTGTGTTGATTGAAACTGAGG + Intronic
1086970859 11:93079102-93079124 GTGTGTGTTGGTGGAAATTGGGG + Intergenic
1089617596 11:119703726-119703748 ATCCAGGTTGATGGAAATTCAGG - Intronic
1091756392 12:3055057-3055079 ATGTGGGGTGCAGGAGATTGTGG + Intergenic
1091903040 12:4160756-4160778 ATGTGGCATGATTTAAATTGTGG - Intergenic
1092312016 12:7367894-7367916 ATTTGTGTAAATGGAAATTGTGG + Intronic
1092518251 12:9238514-9238536 ATCTGAGATGAAGGAAATTGAGG + Intergenic
1096591641 12:52663939-52663961 GGGTGGGTTGATGGTAATTTGGG - Intergenic
1096898852 12:54853392-54853414 AAGTAGATTGATGGAACTTGGGG + Intronic
1097577128 12:61408940-61408962 ATATGTTTTGATGTAAATTGTGG - Intergenic
1098632392 12:72740281-72740303 TTGTGGGTGGATAGAAACTGAGG + Intergenic
1100085659 12:90907174-90907196 TTGTGGGTTGATGGGCATTTAGG - Intronic
1100107528 12:91194128-91194150 TTGAGGGTTGAAGGAAAATGTGG + Intergenic
1100853841 12:98740750-98740772 ATGTAGGAGGATGGAAAATGTGG - Intronic
1104055128 12:125224198-125224220 ATTTGGGTTCATGGACATTTGGG + Intronic
1104425629 12:128675131-128675153 ATGTTGGCTGAATGAAATTGAGG - Intronic
1104609012 12:130213099-130213121 ATGTGTGTATATGGAAACTGAGG + Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106705856 13:32278712-32278734 CTGTGTGTTGATGGGATTTGTGG + Intronic
1106992698 13:35441160-35441182 GTGTGAGATGATGGAAAATGGGG - Intronic
1107665634 13:42687511-42687533 ATGTAGGTTCATAGAAATAGTGG + Intergenic
1110309748 13:74035331-74035353 ATTTCGGTTGGTGGAATTTGTGG + Intronic
1110346810 13:74458152-74458174 ATGGGGGTTGAAGAAAAATGGGG + Intergenic
1111698265 13:91653307-91653329 TTGTTTGTTGATGGAAATTAAGG - Intronic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1113645981 13:111996319-111996341 CTGTGGGATTATGGAAAGTGGGG - Intergenic
1115194413 14:30780658-30780680 GTGTGGGATGATGGAAGATGAGG - Intergenic
1115504896 14:34084510-34084532 ATGCTGGTTGCTGGAAATAGAGG - Intronic
1117109715 14:52438748-52438770 ATGTGGTTTTATAGAAAATGAGG - Intronic
1117427466 14:55615743-55615765 ATGTGGGATGCTGGGAATTATGG + Intronic
1118860766 14:69661286-69661308 GTGTGGGTAGTTGGAAAATGAGG - Intronic
1118864741 14:69694135-69694157 GTGTGGGTTGGTGGTTATTGGGG + Intronic
1123465371 15:20511092-20511114 ATGTGGGTGGATTCAAAGTGAGG - Intergenic
1123652745 15:22489945-22489967 ATGTGGGTGGATTCAAAGTGAGG + Intergenic
1123743168 15:23298809-23298831 ATGTGGGTGGATTCAAAGTGAGG + Intergenic
1124241956 15:28036179-28036201 CTGTCTGTTGATGGAAATTTAGG + Intronic
1124276097 15:28327071-28327093 ATGTGGGTGGATTCAAAGTGAGG - Intergenic
1124306603 15:28584536-28584558 ATGTGGGTGGATTCAAAGTGAGG + Intergenic
1125208447 15:37182339-37182361 ATGTGGGTAGATGGAAAATGTGG + Intergenic
1125358631 15:38842446-38842468 CTGTGGTGTGATGGAAACTGGGG + Intergenic
1126710720 15:51452840-51452862 TTGTTGGTTGATGGACATTTAGG - Intronic
1128707487 15:69847888-69847910 ATTTGGGTTGATGAGACTTGAGG - Intergenic
1129582622 15:76829054-76829076 TTGTTGGTTGATGGATATTTAGG - Intronic
1130794955 15:87197964-87197986 ATATGGGTTGTAGGGAATTGGGG - Intergenic
1131815509 15:96217406-96217428 CAGAGGGTTGATGGAAAATGGGG - Intergenic
1132493876 16:250666-250688 TTGTGGGATGATGAAAATAGTGG - Intronic
1133635197 16:7658298-7658320 CTGTGGCTTGAAGGAAATGGAGG - Intronic
1133886805 16:9837032-9837054 ATGTGAGTTAATGGAGTTTGTGG + Intronic
1133936340 16:10272481-10272503 TTGTGGGTTTATGGAAATGAGGG - Intergenic
1133982121 16:10640853-10640875 AGGTGGCTAGATGAAAATTGTGG - Intronic
1134330599 16:13247507-13247529 AAGTGGGGTGCTAGAAATTGTGG - Intergenic
1134413874 16:14027150-14027172 CTGTCTGTTGATGGAAATTTGGG - Intergenic
1134534347 16:15013449-15013471 ATTGGGGTTGATGGGATTTGGGG + Intronic
1135035065 16:19070247-19070269 AGGTGGGTTGGTGAAATTTGGGG - Intronic
1135874193 16:26182357-26182379 ATGTGGGATGAAGGCAATGGTGG + Intergenic
1136168758 16:28474777-28474799 TTGTTAGTTGATGGATATTGGGG - Intergenic
1137594524 16:49714926-49714948 GTGTGGCTTGGTGGAATTTGAGG + Intronic
1138988427 16:62361027-62361049 ATGTTGTTTGATGCAAATTTTGG - Intergenic
1139861697 16:70027300-70027322 ATTGGGGTTGATGGGATTTGGGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1146525635 17:33564768-33564790 TTGTGGGTTTATGGGAATGGGGG + Intronic
1146592493 17:34139754-34139776 GGGGGGATTGATGGAAATTGGGG + Intronic
1147887093 17:43691365-43691387 AGCTGGGTTGATGGAAAGTCTGG + Intergenic
1148711934 17:49688299-49688321 ATGTGGGTGAAGGGGAATTGGGG + Intergenic
1157759223 18:50247554-50247576 ATGTCAGTTGATGGACATTTGGG - Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159813304 18:73042992-73043014 ATTTGGGATGATGGGAATTGGGG - Intergenic
1161040024 19:2105341-2105363 TTGTGGGTTGATGGGAATGAGGG + Intronic
1161582587 19:5088806-5088828 ATGTGCATTGTTGGAAACTGGGG + Intronic
1162341610 19:10094710-10094732 TTGTGGGTAGAGGAAAATTGAGG - Intronic
1164289261 19:23852648-23852670 ATGTGGGTTTATGGGAATGAGGG - Intergenic
1164678540 19:30119057-30119079 GTGTGGGTGGATGGAGATTTGGG + Intergenic
1165663743 19:37607250-37607272 ATGTGGATTGTTGGTAGTTGGGG - Intronic
1165963813 19:39557685-39557707 ATATCTGTAGATGGAAATTGGGG - Intergenic
1168556035 19:57340788-57340810 CTGTGGGGTGGTGGAAATGGGGG - Intergenic
925768940 2:7263788-7263810 GTGAGGATTGATGGAAAGTGAGG + Intergenic
926758507 2:16254882-16254904 ATGTAAGTTGATGGAAACAGGGG + Intergenic
929182076 2:39052450-39052472 GTAAGGGTTGATGGAAATGGGGG - Intronic
930193543 2:48484898-48484920 ATCTTGGTTGATGGTAATTGAGG - Intronic
933079907 2:77972752-77972774 ATGTGTGTTGATGGTAATCCTGG - Intergenic
933564266 2:83930740-83930762 TTGTCGGTTGATGGACATTTAGG - Intergenic
935309149 2:101766018-101766040 ACATGGGTGGATGGAAAGTGTGG + Intronic
936012951 2:108936619-108936641 GTCTGGGTTGATGGGAAGTGGGG - Intronic
936160879 2:110083394-110083416 CTGTGGGTGGATGGACTTTGGGG + Intergenic
936183784 2:110287960-110287982 CTGTGGGTGGATGGACTTTGGGG - Intergenic
937180009 2:119986422-119986444 ATGTGAGATGTTGGAAATTAAGG + Intergenic
937499741 2:122465222-122465244 ATGTTGGTTGAAGGAAATTGAGG + Intergenic
937859086 2:126694282-126694304 ATGTGGGATGAGGGAGATGGTGG - Intronic
939285712 2:140126435-140126457 ATGTTGGCTTGTGGAAATTGTGG - Intergenic
939624096 2:144455340-144455362 GTGCAGGTTGGTGGAAATTGAGG - Intronic
939919567 2:148092410-148092432 TTGTTGGTTGATGGACATTTAGG - Intronic
939941083 2:148352217-148352239 AGGTGGGGTGATGGTAATTCAGG - Intronic
942125890 2:172824677-172824699 TTGTGGGATGGTGGAATTTGGGG - Intronic
943183453 2:184574701-184574723 ATGTCGGGTAATGGAAACTGAGG - Intergenic
945338676 2:208623426-208623448 ATGTGGGTAGATAAAATTTGGGG + Intronic
946857777 2:223969981-223970003 ATGTGGGTAGAAGGAACATGTGG + Intergenic
947397283 2:229698680-229698702 ATGTGGGAGGGTGGAAATTTTGG - Intronic
947782629 2:232783105-232783127 ATATGGCTTGATGAAAAATGTGG + Intronic
948856491 2:240732716-240732738 ATGAGGGATGAGGGAAAATGAGG + Intronic
1169369803 20:5020039-5020061 GTGTGTGTTGATGGAGATTGAGG - Intergenic
1169922485 20:10749995-10750017 AGGTGGGATGATGGAAAATCAGG + Intergenic
1171356378 20:24548666-24548688 ATTTGGGTGGAAGGAAATTTGGG + Intronic
1172095954 20:32460630-32460652 ATGTGGGGTGCAGGGAATTGGGG - Intronic
1177993744 21:28070680-28070702 ATCTAGGGTGATGAAAATTGAGG + Intergenic
1181869095 22:25883895-25883917 ATGTGCCTTGATGCAAACTGGGG + Intronic
1183090783 22:35520400-35520422 ATGTGAGTTTATGAAAACTGGGG + Intergenic
1183580551 22:38723554-38723576 TTCTGGGCTGATGGAAATTCAGG - Intronic
1183915849 22:41118250-41118272 TTATTGGTTGATGGAAATTAAGG + Intronic
949642624 3:6055663-6055685 ATGAGTGTTGATTGAATTTGTGG + Intergenic
951591029 3:24264891-24264913 AGGTGGGTGGAAGGGAATTGTGG + Intronic
951703124 3:25516147-25516169 AGGTGGGTTGATGCAATTTGGGG - Intronic
955108558 3:55924786-55924808 CTGTGGGTGGGTAGAAATTGAGG - Intronic
955805902 3:62734030-62734052 TTGTTGGTTGATGGACATTTAGG + Intronic
956146774 3:66198630-66198652 ATGTGGGTTGAGGTCAAGTGAGG - Intronic
956721669 3:72123408-72123430 AGGTTCGTTGATGGAAATTATGG + Intergenic
959928464 3:111952651-111952673 ATGTGGGGAGATGGAAGATGTGG - Exonic
961226298 3:125251126-125251148 ACGTGAGTTGATGGACTTTGTGG - Intronic
962433122 3:135338555-135338577 ATGTGTGATGATGTAAAGTGGGG + Intergenic
962500631 3:135988009-135988031 ATCCGGGTTGATAGAAATTTGGG - Intronic
962776805 3:138668850-138668872 GTGTGGGTTGATGGGTAGTGGGG - Intronic
963647490 3:147934271-147934293 ATGTGCTTTGATGTAAATTTAGG + Intergenic
965232105 3:166067967-166067989 ATGTGCATTCATGGAAGTTGTGG + Intergenic
965775560 3:172226592-172226614 ATCTTGGTTTATGGAACTTGAGG + Intronic
966978804 3:185110654-185110676 TTGTGGGTTTATGGGAATTAGGG + Intronic
968682589 4:1931446-1931468 ATGTGCTTGGATGTAAATTGTGG + Intronic
969510880 4:7617272-7617294 AGGTGGGTGGATGGATAATGGGG - Intronic
969643822 4:8414491-8414513 AGTTGGGTAGATGGAAATTTGGG - Intronic
970203538 4:13633174-13633196 CTTTGGGTTGATGGAGATTTAGG - Intergenic
970282173 4:14469343-14469365 AAGTGTGTTGTTGCAAATTGAGG - Intergenic
970445510 4:16120615-16120637 ATTTGGGTTGGGGCAAATTGAGG - Intergenic
970661847 4:18294045-18294067 CTCTGGGTTAATGGAAATCGGGG - Intergenic
970751530 4:19369086-19369108 CTTTGGGCTGATGGATATTGGGG - Intergenic
971234522 4:24829228-24829250 ATGTTGACTGATGGAATTTGAGG + Intronic
973257892 4:48131093-48131115 CTGTGAGTTGATGGAAATGCTGG + Intronic
974625585 4:64423788-64423810 ATGTGGATTAATGAAAAATGAGG - Intergenic
974775588 4:66476557-66476579 ATGTGTGTTCATGAAAAGTGGGG - Intergenic
976445301 4:85124162-85124184 TTGTGGATTGATGGACATTTGGG + Intergenic
977012262 4:91652409-91652431 TTGTCTGTTGATGGACATTGAGG + Intergenic
978264269 4:106803900-106803922 CTGGGGGATGGTGGAAATTGAGG - Intergenic
979368310 4:119851649-119851671 ATGTGGGTAGATGGCATTTGAGG + Intergenic
984823250 4:183902956-183902978 AGGTGAGTTGATGGACATTTGGG - Intronic
985314408 4:188639994-188640016 ATGAGAGTTGATTGTAATTGGGG + Intergenic
986693386 5:10332185-10332207 TTGTGGGTTGATGGACATTTGGG - Intergenic
989635765 5:43531162-43531184 ATGTGGGTAGTAGGAATTTGAGG - Intronic
993607160 5:90005882-90005904 TTGTTGGTTGATGGATATTTAGG - Intergenic
993729648 5:91407045-91407067 ATGTGTGTTGCTGGCTATTGGGG + Intergenic
995053999 5:107739014-107739036 ATGTGGGTGCATGCAAGTTGAGG - Intergenic
995084271 5:108089330-108089352 ATTAGTGTGGATGGAAATTGAGG - Intronic
996480638 5:123971612-123971634 ATGTGGGAGGATGGAAAGTGTGG + Intergenic
996656248 5:125940437-125940459 TTGTGGGTTTATGGAAATGAGGG + Intergenic
998323082 5:141250943-141250965 AGGTGAGTTAATGCAAATTGAGG - Intergenic
999436167 5:151565355-151565377 ATCTGGGGTGATGGAACATGGGG + Intronic
999989735 5:157038712-157038734 ATGTGGGTAGATGGAGAATGGGG + Intronic
1001819208 5:174696490-174696512 ATGAGTGTTGGGGGAAATTGAGG - Intergenic
1004029312 6:11850759-11850781 ATGTAGGTTGAGGGAACTTGTGG + Intergenic
1004471099 6:15929784-15929806 AGGTGGTTTGATGTAAATTAAGG + Intergenic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1009671339 6:66755180-66755202 ATCATGGTTGATAGAAATTGTGG + Intergenic
1009749318 6:67862684-67862706 AAGTGGGTTGGAGGAAACTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010897796 6:81386830-81386852 ATGTTGGTTTATGGAACTGGTGG + Intergenic
1012165698 6:95948333-95948355 ATGTGAGTTGGTGGAAATACAGG - Intergenic
1012497371 6:99848715-99848737 ATGTGGGACCATGGAAACTGGGG + Intergenic
1014570809 6:123005400-123005422 ATGTGGCTTAATGAAAACTGAGG + Intronic
1014681809 6:124440409-124440431 ATGTAGGGTGAAGGAAATTCAGG - Intronic
1016408664 6:143758846-143758868 ATGTGGATTGATGGGGAATGTGG + Intronic
1016927434 6:149365409-149365431 ATGTGGGTTGATTGACAGTTTGG + Intronic
1017896129 6:158681711-158681733 ATGTGTGTTGATGGAGATTTGGG - Intronic
1018538167 6:164846190-164846212 ATTTGGGAAGATGGAAAGTGGGG + Intergenic
1018851141 6:167590978-167591000 ATGTGGGGTGGTGGAAGTGGTGG - Intergenic
1020845782 7:13281254-13281276 ATGTGGCATGATGGAAAATCTGG + Intergenic
1021763406 7:23923467-23923489 ATGTGGCGTGGTGGAGATTGGGG + Intergenic
1021956360 7:25828830-25828852 GTGTGGGGAGATGGAAAATGGGG + Intergenic
1023066333 7:36381309-36381331 ATGTGGGTGGATGAAAAGGGAGG + Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1028627296 7:92891433-92891455 TTGTGGGAGGATGGAAAATGGGG + Intergenic
1029505149 7:100959143-100959165 ATGTGAGGTGATGGCAGTTGTGG - Exonic
1030403155 7:109078202-109078224 ATTTGGGGTGTTGGAAAATGTGG + Intergenic
1031205523 7:118752298-118752320 TTGTTGGTTGATGGGAATTTAGG - Intergenic
1035174662 7:157041801-157041823 TTGTTGGTGGATGGACATTGTGG + Intergenic
1035342099 7:158169213-158169235 AAGTGGGTTGATAGAGGTTGGGG + Intronic
1035811262 8:2493295-2493317 TTTTGAGTTGATGGCAATTGAGG - Intergenic
1036066132 8:5383729-5383751 AAGTGGGGTGATGGAAAGAGTGG - Intergenic
1039282728 8:36004513-36004535 ATCTTGGCAGATGGAAATTGAGG + Intergenic
1040460731 8:47645320-47645342 ATGTGGGATGATAGGAAGTGGGG + Intronic
1041790152 8:61686345-61686367 ATGTTGGTAGAGGGAAATGGTGG + Intronic
1042608424 8:70571014-70571036 ATGTTGGTTGATGGGCATTTAGG - Intergenic
1042803066 8:72742088-72742110 ATGTTGGTTGATGGGCATTTAGG - Intronic
1043049447 8:75366664-75366686 ATGTGGCCTGATTGAAATTGAGG + Intergenic
1043784555 8:84381557-84381579 ATGTGGGTTGAAGGAAATAGAGG - Intronic
1048159616 8:132002886-132002908 ATGTAAGCTGATGGAAATAGTGG + Intronic
1048945168 8:139440146-139440168 ATGTGGTTTTATGGAAGCTGAGG + Intergenic
1050927426 9:11282276-11282298 ATGTGAGTTGTTGTAAAATGAGG + Intergenic
1052043235 9:23765211-23765233 GTGTGGCTTAATTGAAATTGAGG + Intronic
1052502472 9:29309276-29309298 ATGGGAGTTTATGGAAATTAAGG - Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1056125233 9:83530214-83530236 ATTTGGGTTGATGGACATTTTGG - Intronic
1056419377 9:86408916-86408938 ATGTGAGTTTATGTAAATTTGGG + Intergenic
1056886975 9:90452462-90452484 AAGTGTGTTTATGGGAATTGTGG + Intergenic
1058604833 9:106709127-106709149 ATGTGGGTGCATAGAAAGTGAGG - Intergenic
1058638676 9:107061559-107061581 GTGCTGGTTGATGGAAATTGGGG + Intergenic
1058789734 9:108431135-108431157 ATTTGTGTTGATGTAATTTGTGG + Intergenic
1058841725 9:108916066-108916088 AAGTGGGTAGGTGGAAATGGGGG - Intronic
1060447885 9:123708479-123708501 CTCTGGGTAGATGGAATTTGGGG + Intronic
1061720839 9:132550367-132550389 TTGGGAGTTGATGGAATTTGGGG + Intronic
1185939889 X:4305008-4305030 AAGTGTATTGATGGGAATTGTGG + Intergenic
1186174096 X:6907068-6907090 ATGTGGGATTATGGGAATTATGG - Intergenic
1189703719 X:43738462-43738484 ATGTGGGTTGATTGGATTTCAGG + Intronic
1190396432 X:49989803-49989825 ATGAATGTTAATGGAAATTGGGG - Intronic
1190744271 X:53312176-53312198 ATGTGGGTTGGTGGGAATTGGGG - Intronic
1192734501 X:73836232-73836254 ATGTGGATTGAAGTAAATTCTGG + Intergenic
1193031478 X:76903420-76903442 ATGTGTGTTGATGGACACTTAGG - Intergenic
1193671927 X:84397532-84397554 ATGTGGGTAAATGGTAAGTGAGG - Intronic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195602014 X:106759791-106759813 AGGTGGGTAGAAAGAAATTGGGG + Intronic
1195864997 X:109422846-109422868 ATTTGGGTTGATTGCAATTTTGG - Intronic
1197088418 X:122507790-122507812 AAGAGGGTTAATGGAAGTTGTGG + Intergenic
1198591739 X:138190680-138190702 ATGTGGCTTGATGAGAATGGTGG + Intergenic
1199480672 X:148295430-148295452 ACGTGGTCTGATGGCAATTGAGG + Intergenic
1201990384 Y:20017546-20017568 CAGTGGGTTGATGGAAAGTAGGG + Intergenic