ID: 1077076381

View in Genome Browser
Species Human (GRCh38)
Location 11:704258-704280
Sequence TCCGCTCGGTGGACTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077076369_1077076381 9 Left 1077076369 11:704226-704248 CCTCGCCCTCGGGCCCTGGCTGC 0: 1
1: 0
2: 3
3: 63
4: 378
Right 1077076381 11:704258-704280 TCCGCTCGGTGGACTCCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 68
1077076374_1077076381 -4 Left 1077076374 11:704239-704261 CCCTGGCTGCCGGGCGCCTTCCG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1077076381 11:704258-704280 TCCGCTCGGTGGACTCCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 68
1077076372_1077076381 4 Left 1077076372 11:704231-704253 CCCTCGGGCCCTGGCTGCCGGGC 0: 1
1: 0
2: 0
3: 24
4: 221
Right 1077076381 11:704258-704280 TCCGCTCGGTGGACTCCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 68
1077076375_1077076381 -5 Left 1077076375 11:704240-704262 CCTGGCTGCCGGGCGCCTTCCGC 0: 1
1: 0
2: 2
3: 22
4: 196
Right 1077076381 11:704258-704280 TCCGCTCGGTGGACTCCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 68
1077076373_1077076381 3 Left 1077076373 11:704232-704254 CCTCGGGCCCTGGCTGCCGGGCG 0: 1
1: 1
2: 3
3: 23
4: 296
Right 1077076381 11:704258-704280 TCCGCTCGGTGGACTCCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 68
1077076367_1077076381 18 Left 1077076367 11:704217-704239 CCTGGCTGGCCTCGCCCTCGGGC 0: 1
1: 0
2: 3
3: 60
4: 497
Right 1077076381 11:704258-704280 TCCGCTCGGTGGACTCCTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077076381 Original CRISPR TCCGCTCGGTGGACTCCTGA GGG Intronic