ID: 1077076477

View in Genome Browser
Species Human (GRCh38)
Location 11:704669-704691
Sequence CAGCGAGCACACAAAGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077076470_1077076477 19 Left 1077076470 11:704627-704649 CCTGTTGCCTTCATGGTTAATGG 0: 1
1: 0
2: 1
3: 7
4: 120
Right 1077076477 11:704669-704691 CAGCGAGCACACAAAGGCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 243
1077076472_1077076477 12 Left 1077076472 11:704634-704656 CCTTCATGGTTAATGGATCCTGA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1077076477 11:704669-704691 CAGCGAGCACACAAAGGCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 243
1077076473_1077076477 -6 Left 1077076473 11:704652-704674 CCTGATACCTCCAGTCTCAGCGA 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1077076477 11:704669-704691 CAGCGAGCACACAAAGGCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077076477 Original CRISPR CAGCGAGCACACAAAGGCAG TGG Intronic
900165394 1:1242429-1242451 CAGGCAGCACTCGAAGGCAGTGG + Intronic
901522221 1:9793868-9793890 CAGCATGGACAGAAAGGCAGTGG - Intronic
902598677 1:17526214-17526236 CAGGGAGCACAGGAATGCAGGGG + Intergenic
903282354 1:22257274-22257296 CAGGGAGGACACAGAGGCACAGG + Intergenic
904903131 1:33873385-33873407 CAGCCCACACACAAAGGGAGGGG - Intronic
905310146 1:37043333-37043355 AAGCCAGGACATAAAGGCAGGGG + Intergenic
908225923 1:62056048-62056070 CAGGTAGAACAAAAAGGCAGAGG - Intronic
909604297 1:77493237-77493259 CAGCTAGAACAAAAAGGCCGAGG + Intronic
909997260 1:82295705-82295727 CAAAGAGAACAAAAAGGCAGAGG + Intergenic
910140886 1:84026471-84026493 AGGCGAGCAAACAAAGGGAGAGG - Intergenic
911633773 1:100211532-100211554 CAGGGACCAGACAAGGGCAGTGG - Intronic
911775724 1:101809544-101809566 CAGTGAGTACACCAAGACAGGGG + Intronic
912496620 1:110095806-110095828 CAGAGAGCACACAGATGCAAAGG - Intergenic
913236691 1:116791135-116791157 CTGTGAGGACACAAAGGCACAGG + Intergenic
914928122 1:151906492-151906514 CATCGAGCACCCAAGGGCTGAGG + Intronic
917287808 1:173439941-173439963 TAGCAAGCACACAAAGACTGTGG + Intergenic
917680332 1:177359270-177359292 CAGATAGAACAGAAAGGCAGAGG - Intergenic
918703567 1:187635425-187635447 CAGCTAGGACACAAAGGAGGCGG + Intergenic
918943739 1:191033561-191033583 CAGTGAGAACACATAGACAGAGG + Intergenic
919656815 1:200205031-200205053 CAGCCAACACAGAAAGGGAGAGG + Intergenic
919728672 1:200899607-200899629 CAGCCAGCACACACAAGCATCGG + Intronic
920170760 1:204071174-204071196 CAGTGACCAGACAATGGCAGTGG - Intergenic
920746541 1:208634428-208634450 CAGATAGAACACAAAGGCAGAGG + Intergenic
1068460513 10:57322406-57322428 CAGCGAGACCACAAACGCACCGG + Intergenic
1068856033 10:61798288-61798310 CAGGGAGTAGACAAAGACAGAGG - Intergenic
1068894661 10:62186133-62186155 CATGGAGCAAACAAAGGCAAAGG - Intronic
1069840086 10:71334329-71334351 CAGTGTTCACACAAAGGAAGAGG + Intronic
1070564442 10:77592888-77592910 GAGAGAGCGCACAAAGGCAGTGG + Intronic
1071553617 10:86585807-86585829 CATGGAGCCCACAAAGGCACTGG - Intergenic
1072175024 10:92912097-92912119 CAGAGTGCACCCAAAGGCGGGGG - Intronic
1072318557 10:94226921-94226943 CAGCGAGCAGCGAGAGGCAGAGG - Intronic
1072650476 10:97291203-97291225 CAGCTCCCACACAAAGGGAGGGG - Intronic
1075886037 10:125900093-125900115 CAGCAAGCAGAGGAAGGCAGGGG + Intronic
1077076477 11:704669-704691 CAGCGAGCACACAAAGGCAGTGG + Intronic
1079404669 11:20134020-20134042 CAGCGAACAAAGAAAGGGAGAGG + Intergenic
1079717255 11:23764016-23764038 CAGCCAGAACAAAAAGGCAGAGG - Intergenic
1082808364 11:57463869-57463891 GAGCGAGCACTCCAGGGCAGAGG - Intronic
1082852543 11:57778205-57778227 CAGAGAACAAACAAAGGCAGCGG - Intronic
1086196183 11:84142649-84142671 CAGATAGAACAAAAAGGCAGAGG + Intronic
1086403341 11:86479123-86479145 CAGATAGAACAAAAAGGCAGAGG + Intronic
1087486328 11:98763414-98763436 CACCGACCACCCAAAGGCTGAGG - Intergenic
1088487411 11:110354136-110354158 CAGATAGAACAAAAAGGCAGAGG - Intergenic
1089062058 11:115633898-115633920 CATCGACCACACAAGGGCTGAGG - Intergenic
1089252540 11:117175293-117175315 CAGTCAGCAAAAAAAGGCAGTGG - Intronic
1089760862 11:120722150-120722172 AAGCCAGCACACAAAGGGTGTGG + Intronic
1090644270 11:128755049-128755071 CACAGAGAACACAAAGCCAGCGG - Intronic
1095901605 12:47333736-47333758 CATCGACCACCCAAAGGCTGAGG + Intergenic
1097074719 12:56384351-56384373 CAGGGAGGAGAGAAAGGCAGGGG + Intergenic
1097982064 12:65744670-65744692 CATCGACCACCCAAAGGCTGAGG + Intergenic
1098031197 12:66256634-66256656 CAGATAGAACAAAAAGGCAGAGG - Intergenic
1098519044 12:71414755-71414777 CTGTGAGGACACAAAGGCATAGG + Intronic
1098763899 12:74460402-74460424 CAGCTAGAACAAAAAGGCAGAGG - Intergenic
1100033868 12:90226572-90226594 CAGATAGAACAAAAAGGCAGAGG - Intergenic
1101588818 12:106108596-106108618 CAGTGAACACACACAGGCTGTGG + Intronic
1104462939 12:128969967-128969989 CAGGAAGCGCACACAGGCAGAGG - Intronic
1105305706 13:19167320-19167342 CAGGGAAGACAGAAAGGCAGAGG + Intergenic
1105753538 13:23444168-23444190 CAGATGGAACACAAAGGCAGAGG + Intergenic
1105883324 13:24622533-24622555 CAGCGAGAACACAAACCCACCGG - Intergenic
1107041225 13:35949947-35949969 CACCCAGCACAAAAAGGCAGGGG + Intronic
1107301379 13:38969334-38969356 CAGGGATCACAGAAAGGCAAGGG - Intronic
1108083592 13:46762065-46762087 CAGATAGAACAGAAAGGCAGAGG + Intergenic
1110207784 13:72937441-72937463 CAACAAGAACACAAAGGCTGGGG - Intronic
1110862197 13:80355892-80355914 CAGCGACCACCCAAGGGCTGAGG + Intergenic
1110979294 13:81875121-81875143 CAGCGAGAACATTATGGCAGTGG + Intergenic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1117507192 14:56415628-56415650 CAGATAGGACAAAAAGGCAGAGG - Intergenic
1117727282 14:58687276-58687298 CATCGACCACCCAAAGGCTGAGG - Intergenic
1117779805 14:59220833-59220855 CAGGTAGAACAAAAAGGCAGAGG - Intronic
1117984919 14:61377753-61377775 AAGAGAGCAAACAAAAGCAGTGG - Intronic
1118215310 14:63803269-63803291 CATCGACCACCCAAAGGCTGAGG - Intergenic
1122337643 14:101004456-101004478 CAGGCAGCACACAAGGGCAGGGG - Intergenic
1122753794 14:103961028-103961050 CAGCATGCAGACAAAGGGAGAGG - Intronic
1202872038 14_GL000225v1_random:173868-173890 CAGCAAGCAGAGGAAGGCAGGGG - Intergenic
1124083324 15:26521318-26521340 CAGCGGCCACACAGAGGCAAGGG - Intergenic
1124147264 15:27139385-27139407 CAGATAGAACAAAAAGGCAGAGG - Intronic
1127054807 15:55120756-55120778 CTGAGAGCACTCAGAGGCAGGGG - Intergenic
1128576647 15:68780539-68780561 CACAGAGCACAAAAAGGCCGGGG + Intronic
1129610381 15:77049942-77049964 CAGAGTACAAACAAAGGCAGGGG + Intronic
1130955718 15:88626120-88626142 AAGAGAGAACACACAGGCAGAGG - Intronic
1131525908 15:93152429-93152451 CCTCGAGCACACAGAAGCAGTGG - Intergenic
1134058609 16:11185597-11185619 GAGTGAGCACACATAGGGAGAGG - Intergenic
1134133678 16:11666431-11666453 AAGGGAGGACAGAAAGGCAGAGG - Intergenic
1135262064 16:20989647-20989669 CATCGACCACCCAAAGGCTGAGG - Intronic
1140021137 16:71239896-71239918 GAGCGAGGACAGGAAGGCAGAGG + Intergenic
1140838926 16:78820930-78820952 CAGAAAGGACACAAAGCCAGAGG - Intronic
1141358407 16:83371386-83371408 AAGCAAGAACAAAAAGGCAGGGG - Intronic
1141801070 16:86309664-86309686 CAGAGAGCACAACAAGGAAGAGG + Intergenic
1142199083 16:88752701-88752723 CAGAGTGGACTCAAAGGCAGAGG + Intronic
1142230911 16:88899884-88899906 CACCGAGCCCACATAGGTAGAGG - Intronic
1143577905 17:7805356-7805378 CAACGAGCCCACATGGGCAGAGG + Exonic
1143983792 17:10893782-10893804 CAGAAAGAACAAAAAGGCAGAGG + Intergenic
1144076159 17:11721475-11721497 CAGCCAGAAAACAAAGGTAGAGG - Intronic
1145245217 17:21264673-21264695 CAGATGGCAGACAAAGGCAGTGG - Intergenic
1146540448 17:33688969-33688991 CAGAGAGAATATAAAGGCAGTGG + Intronic
1146550498 17:33776651-33776673 AAGCAAACACACAAAGGCCGGGG + Intronic
1146616815 17:34363126-34363148 CAGCAAGCACACCAGGGCTGTGG + Exonic
1148475373 17:47925223-47925245 CAGAGAGCACAAGGAGGCAGGGG - Intronic
1150743659 17:67799371-67799393 CAGCAAGACCACAATGGCAGGGG - Intergenic
1150804550 17:68308917-68308939 CATCGACCACCCAAAGGCTGAGG - Intronic
1151516553 17:74599885-74599907 GAGAGAGCACAGACAGGCAGGGG + Intergenic
1152004789 17:77673410-77673432 CAGAGAAAACACAAAAGCAGAGG + Intergenic
1152768240 17:82152381-82152403 CAGGGGGAGCACAAAGGCAGTGG + Intronic
1152805175 17:82352304-82352326 CAGCGCCCACACACAGGAAGCGG - Intergenic
1156077802 18:33301596-33301618 CATCGAGCACACACTGGAAGGGG - Intronic
1156521943 18:37729402-37729424 CCGAGAGAACAAAAAGGCAGAGG + Intergenic
1160794862 19:940664-940686 TTCCGAGCACACAGAGGCAGCGG + Intronic
1162349016 19:10137686-10137708 CAGGGGTCACACAAAGGCTGAGG + Intronic
1163186624 19:15643684-15643706 CAGGTAGCACAAAAATGCAGAGG - Intronic
1163321110 19:16575524-16575546 TAGGGAGCAAACAGAGGCAGTGG + Exonic
1164523227 19:28994854-28994876 CAGAAAGCACAGAAAGGAAGTGG + Intergenic
1164562413 19:29301483-29301505 AAGCCAGGACACAAAGGCCGAGG + Intergenic
1166998143 19:46729580-46729602 CAGCATGCCCAGAAAGGCAGCGG + Intronic
925599222 2:5590896-5590918 CAGCAGGCACACATGGGCAGTGG + Intergenic
929343457 2:40851377-40851399 CAGATAGAACACAAAGGCAGAGG - Intergenic
930284394 2:49410049-49410071 CAGATAGAACAAAAAGGCAGAGG - Intergenic
933490706 2:82982964-82982986 CAACCATCACTCAAAGGCAGTGG - Intergenic
933854672 2:86401791-86401813 CAGATAGAACAAAAAGGCAGAGG - Intergenic
934920844 2:98344166-98344188 CAGCCAGGACACTAAGGAAGTGG - Intronic
934961746 2:98681903-98681925 CAAAGGGCACAGAAAGGCAGTGG + Intronic
937642376 2:124228263-124228285 CAGATAGAACAAAAAGGCAGAGG - Intronic
939102633 2:137913358-137913380 AGGAGAGCACTCAAAGGCAGTGG - Intergenic
940070289 2:149679042-149679064 CAGATAGAACAAAAAGGCAGAGG - Intergenic
940723539 2:157308514-157308536 CAGGCAGCAAACACAGGCAGGGG - Intronic
946193579 2:218020539-218020561 CAGAGAGCCCCCAAAGGCTGAGG + Intergenic
946376555 2:219313132-219313154 CATCGACCACCCAAAGGCTGAGG + Intergenic
949066925 2:241996952-241996974 CTGCGGGCAGACAATGGCAGGGG - Intergenic
1171386551 20:24773254-24773276 CAGCAAGTTCACAAAGCCAGGGG + Intergenic
1172379720 20:34478680-34478702 TAGCGTGCACACAAAGACACAGG - Intronic
1173729333 20:45317650-45317672 CAGGGAGCAAACACAGGCAAAGG - Exonic
1175488566 20:59363344-59363366 CTTGGAGCACACAAAGGCCGAGG + Intergenic
1176028708 20:62999828-62999850 CCGAGAGCACACAGAGGCTGTGG + Intergenic
1177240823 21:18454714-18454736 AAGATAGCACAAAAAGGCAGAGG - Intronic
1177296380 21:19181654-19181676 CAGAGAGAACAAAAAGGCAGAGG + Intergenic
1177655714 21:24013916-24013938 CAGGTAGAACAAAAAGGCAGAGG + Intergenic
1177867782 21:26533513-26533535 CAGCTAGAACAAAAAGGCAGAGG - Intronic
1180286056 22:10745624-10745646 CAGCAAGCAGAGGAAGGCAGGGG + Intergenic
1182823793 22:33244456-33244478 CAGGGAGCATAAAAAGTCAGAGG - Intronic
1183351552 22:37337407-37337429 CAGGGAGCCCAGAAGGGCAGGGG + Intergenic
1183966774 22:41446967-41446989 CGGCGAGCACAGAAGGGCACAGG - Exonic
949408418 3:3738800-3738822 CAGACAGAACAAAAAGGCAGAGG + Intronic
950964672 3:17138005-17138027 CACTGAGAACACAAAGGCAGAGG - Intergenic
951934099 3:28002566-28002588 CAGATAGAACAAAAAGGCAGAGG + Intergenic
952190003 3:31012941-31012963 CAACAAGAACAAAAAGGCAGAGG + Intergenic
952424982 3:33166616-33166638 CAGGGGGAATACAAAGGCAGGGG - Intronic
953133559 3:40163546-40163568 CAGATAGAACAAAAAGGCAGAGG + Intronic
953264514 3:41372959-41372981 TAGAGAGCAAACAAAAGCAGGGG + Intronic
954637695 3:52080229-52080251 CAGTGAGCACACTAAAGCACTGG + Intronic
956894425 3:73645215-73645237 CAGATACAACACAAAGGCAGAGG - Intergenic
959907413 3:111725324-111725346 CAGGGAGCAGCCAGAGGCAGAGG - Intronic
960159205 3:114331509-114331531 AAGGAAGCACACACAGGCAGAGG - Intergenic
962747100 3:138404964-138404986 CTGAGAGCACACAATGGCAAAGG - Exonic
964055175 3:152446668-152446690 CAGCGAGCACATGATGGCAATGG - Intronic
966190954 3:177271733-177271755 CATCGACCACACAAGGGCTGAGG - Intergenic
968269875 3:197395217-197395239 CAGTGAGCACACAGAAGCACAGG - Intergenic
968360963 3:198146530-198146552 CAGATAGAACAAAAAGGCAGAGG - Intergenic
968716221 4:2161623-2161645 CATCGACCACCCAAAGGCTGAGG + Intronic
970177031 4:13349877-13349899 CAGATAGAACACAGAGGCAGAGG + Intergenic
970673105 4:18418341-18418363 CATCGACCACCCAAAGGCTGAGG - Intergenic
971356988 4:25903981-25904003 CAGATAGAACAAAAAGGCAGAGG - Intronic
971563620 4:28113134-28113156 CATCGACCACCCAAAGGCTGAGG + Intergenic
971790782 4:31167618-31167640 CAGGTAGAACAAAAAGGCAGAGG - Intergenic
973136308 4:46711101-46711123 CAGCAAGCAAACAAATGCGGTGG + Intergenic
974276612 4:59728571-59728593 CAGATAGAACAGAAAGGCAGAGG + Intergenic
974321380 4:60354345-60354367 TAGCAAGCACACAAAGACTGTGG + Intergenic
975627133 4:76361100-76361122 GAGAGAGCACACAAAGGGGGAGG - Intronic
975742536 4:77443472-77443494 CAGATAGAACAAAAAGGCAGAGG + Intergenic
976520568 4:86021611-86021633 CAGCGACCACCCAAGGGCTGAGG - Intronic
976954588 4:90880149-90880171 CAGCCAGCACTCAATGGGAGAGG - Intronic
977005873 4:91569268-91569290 CAGCCAGCACTCAAGGGGAGAGG - Intronic
980761869 4:137245095-137245117 CAGAGAGCACAGAGAGGCTGGGG - Intergenic
981332046 4:143522016-143522038 CAGAGAGGAAACAAATGCAGAGG + Intronic
983954333 4:173679490-173679512 CAGATAGAACAGAAAGGCAGAGG - Intergenic
984042054 4:174747214-174747236 CAACGAGGACATAAGGGCAGTGG + Intronic
984144668 4:176045808-176045830 CAGAGAGAACAAAAAGGCAGAGG - Intergenic
984252370 4:177349441-177349463 CAAGGAGACCACAAAGGCAGAGG - Intronic
986525277 5:8667074-8667096 CAGTGAGCACAGAATGCCAGTGG + Intergenic
986973344 5:13363905-13363927 CATTGAGGACAGAAAGGCAGAGG - Intergenic
988255217 5:28810383-28810405 CAGCGGGCACAGGACGGCAGGGG - Intergenic
988367169 5:30315393-30315415 CAGTGAGGGCACAATGGCAGAGG - Intergenic
990435320 5:55784326-55784348 CAGACAGAACAAAAAGGCAGAGG - Intronic
992161087 5:74002724-74002746 CAGATAGGACAAAAAGGCAGAGG - Intergenic
992713515 5:79485687-79485709 AAGAGAGCAAACAAAGGCAATGG + Intronic
994029870 5:95129631-95129653 CAGAGAGAACAAAAAGGCAGAGG + Intronic
997599063 5:135127162-135127184 GAGAGAGCAAACAAAGGTAGGGG + Intronic
997795410 5:136804780-136804802 CAGATAGAACAAAAAGGCAGAGG - Intergenic
998540188 5:142973899-142973921 CAACAAACACAAAAAGGCAGAGG - Intronic
999372869 5:151066827-151066849 CAGCCAGGACACAGAGCCAGAGG + Intronic
999622861 5:153490328-153490350 GACCGAGCTCAGAAAGGCAGGGG + Intronic
1001540353 5:172533610-172533632 CAGCAACCACACAGAGGTAGGGG + Intergenic
1002597881 5:180335827-180335849 CAGCGCTCAGACAAAGGCAACGG - Exonic
1003641037 6:7875240-7875262 CAGAGAGAACAAAAAGACAGAGG - Intronic
1003647078 6:7921491-7921513 AAGTGAGGAAACAAAGGCAGAGG + Intronic
1003841394 6:10124329-10124351 CAGCGATCAGAGAAAGCCAGAGG + Intronic
1006630250 6:35425788-35425810 CAGGGAGCTCAGAAAGGCAGTGG - Intronic
1007710979 6:43824142-43824164 CAGCAGGCACACACAGGCATGGG - Intergenic
1009495365 6:64339845-64339867 CTGTGAGGACACAAAGGCATAGG + Intronic
1010965637 6:82204233-82204255 CAGTGAGAACCCAAAGGTAGGGG + Intronic
1011210033 6:84945257-84945279 GAGCTCCCACACAAAGGCAGGGG - Intergenic
1011392415 6:86868210-86868232 CAGCCAGCACTCAAGGGGAGAGG + Intergenic
1012422663 6:99081546-99081568 CAGATAGAACAAAAAGGCAGAGG - Intergenic
1012680856 6:102177230-102177252 CAGATAGAACAAAAAGGCAGAGG - Intergenic
1014252182 6:119126695-119126717 CTGCCCGCACAAAAAGGCAGAGG - Intronic
1014507821 6:122280937-122280959 CATCGACCACCCAAAGGCTGAGG + Intergenic
1017015284 6:150094826-150094848 CAGCAAGCACACATTTGCAGAGG - Intergenic
1017090757 6:150756701-150756723 CAGCCAGCCAAAAAAGGCAGGGG - Intronic
1017839435 6:158209754-158209776 CATCGACCACCCAAAGGCTGAGG - Intergenic
1019259047 7:70124-70146 CAGATAGAACAAAAAGGCAGAGG + Intergenic
1019729571 7:2622734-2622756 CTGTGAGCACAGAAAGGCTGGGG - Intergenic
1020023056 7:4880594-4880616 CAGGCAGCACACACTGGCAGAGG + Intronic
1023246792 7:38213559-38213581 GAGGGAGCAAACAAATGCAGAGG - Intronic
1024060280 7:45692362-45692384 CTGTGAGCACCCAAGGGCAGGGG - Intronic
1026174959 7:67988449-67988471 CAGACATCACACAAACGCAGTGG - Intergenic
1034259733 7:149747387-149747409 CTGCTAGAACAAAAAGGCAGAGG - Intergenic
1034818720 7:154197339-154197361 CACAGAGCACACAGAGGCACAGG - Intronic
1034893173 7:154858313-154858335 CAGCGAGGAAGCAAAAGCAGAGG + Intronic
1035032064 7:155867646-155867668 CAGTTAGCACACGAAGTCAGTGG + Intergenic
1035132439 7:156668528-156668550 GAGTGAGGACACAGAGGCAGAGG - Intronic
1036459721 8:8941185-8941207 CAGGGAGCAGTCAAGGGCAGTGG + Intergenic
1036588681 8:10148077-10148099 AAGCGAGCACTCGGAGGCAGTGG + Intronic
1038395877 8:27245007-27245029 CAGCCAGCACAGAAAGGCAAGGG - Intronic
1039622927 8:39016842-39016864 CAGAGTGCAAACCAAGGCAGAGG + Intronic
1040328333 8:46373606-46373628 CAGAGAGCACACACAGGCCAGGG - Intergenic
1041193936 8:55381596-55381618 CAGATAGAACAAAAAGGCAGTGG - Intronic
1042937922 8:74079128-74079150 CAGCTAGAACAGAAAGGCGGAGG + Intergenic
1048550729 8:135431664-135431686 CAGATAGAACAAAAAGGCAGAGG + Intergenic
1048556002 8:135476575-135476597 CACCTAGCACGAAAAGGCAGAGG - Intronic
1049406418 8:142453593-142453615 CGGCGTGCACACAGAGGAAGTGG + Intronic
1049441024 8:142609893-142609915 CAGTGTCCCCACAAAGGCAGGGG + Intergenic
1049441068 8:142610049-142610071 CAGTGTCCCCACAAAGGCAGGGG + Intergenic
1049441083 8:142610101-142610123 CAGTGTCCCCACAAAGGCAGGGG + Intergenic
1049441098 8:142610153-142610175 CAGTGTCCCCACAAAGGCAGGGG + Intergenic
1049500374 8:142959833-142959855 CATCGACCACCCAAAGGCTGAGG + Intergenic
1051809206 9:21031281-21031303 CAGAGGGCTCACAAGGGCAGGGG + Intronic
1052979610 9:34438301-34438323 CATCGACCACACAAGGGCTGAGG + Intronic
1054888416 9:70224594-70224616 CAGATAGAACAAAAAGGCAGAGG - Intronic
1055576819 9:77668569-77668591 CAGATAGAACAAAAAGGCAGAGG + Intergenic
1057897955 9:98924693-98924715 CAGCAAGCACAGAATTGCAGAGG - Intergenic
1058207822 9:102130648-102130670 CAGAAAGCAAAAAAAGGCAGGGG - Intergenic
1058365239 9:104200950-104200972 CATCGACCACACAAGGGCTGAGG + Intergenic
1059589343 9:115641009-115641031 TAGCAAGCATACAAAGGCAAGGG - Intergenic
1060225315 9:121786715-121786737 CAGAGAGAACACACAGGCTGGGG - Intergenic
1061483889 9:130910478-130910500 CATCGAGCACCCAAGGGCTGAGG + Intronic
1061655569 9:132087329-132087351 CAGAGAGATCAGAAAGGCAGGGG + Intergenic
1062745671 9:138210361-138210383 CAGATAGAACAAAAAGGCAGAGG - Intergenic
1186363472 X:8867572-8867594 CAGAGATCACACAAAAACAGAGG + Intergenic
1187005789 X:15231735-15231757 CATCGACCACCCAAAGGCTGAGG - Intergenic
1188166904 X:26873705-26873727 CATCGACCACACAAGGGCTGAGG - Intergenic
1189685860 X:43562915-43562937 CAGTGAGCGAAGAAAGGCAGTGG + Intergenic
1190045811 X:47111008-47111030 CATCGACCACACAAGGGCTGAGG - Intergenic
1196319478 X:114270565-114270587 CATCGACCACCCAAAGGCTGAGG - Intergenic
1196818964 X:119687751-119687773 CTTATAGCACACAAAGGCAGTGG + Intronic
1197696972 X:129560375-129560397 CATCTAGAACACAAAGGCAGTGG - Intronic
1198509119 X:137331379-137331401 CAGACAGAACAAAAAGGCAGAGG + Intergenic
1198603925 X:138315484-138315506 CAGTGAGCAAACACAGGTAGAGG + Intergenic
1199099935 X:143787903-143787925 CAGCTAACAAACAAATGCAGGGG + Intergenic
1200061576 X:153486149-153486171 CTGCCAGCACACAGAGGAAGAGG + Intronic
1200690532 Y:6304057-6304079 CTAAGAGCACCCAAAGGCAGGGG + Intergenic
1200955480 Y:8939569-8939591 CAGCGAGAACACAAACCCACTGG + Intergenic
1201044742 Y:9870659-9870681 CTAAGAGCACCCAAAGGCAGGGG - Intergenic
1201488212 Y:14513169-14513191 CATCGACCACCCAAAGGCTGAGG + Intergenic
1202628539 Y:56884893-56884915 CAGCAAGCAGAGGAAGGCAGGGG - Intergenic