ID: 1077077480

View in Genome Browser
Species Human (GRCh38)
Location 11:708099-708121
Sequence CTGTTGGTATGGAGGGTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077077480_1077077495 28 Left 1077077480 11:708099-708121 CCCTTGACCCTCCATACCAACAG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1077077495 11:708150-708172 ACCCAAACTCTGAAGCCACAGGG 0: 1
1: 0
2: 1
3: 21
4: 207
1077077480_1077077497 29 Left 1077077480 11:708099-708121 CCCTTGACCCTCCATACCAACAG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1077077497 11:708151-708173 CCCAAACTCTGAAGCCACAGGGG 0: 1
1: 0
2: 2
3: 24
4: 271
1077077480_1077077494 27 Left 1077077480 11:708099-708121 CCCTTGACCCTCCATACCAACAG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1077077494 11:708149-708171 GACCCAAACTCTGAAGCCACAGG 0: 1
1: 0
2: 0
3: 14
4: 153
1077077480_1077077488 2 Left 1077077480 11:708099-708121 CCCTTGACCCTCCATACCAACAG 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1077077488 11:708124-708146 GTGGCTGGTGACCCCCACCGTGG 0: 1
1: 0
2: 2
3: 16
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077077480 Original CRISPR CTGTTGGTATGGAGGGTCAA GGG (reversed) Intronic
900151106 1:1179732-1179754 CTGTTGGTGAGGAGGGTCGGAGG + Exonic
902137886 1:14326472-14326494 TTGTTAGAATGGAGAGTCAACGG - Intergenic
902622698 1:17659622-17659644 CTGGTGGTGTGGAGGGTCCAGGG + Intronic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
908774945 1:67630639-67630661 CTGTTGGTAGGAAGGGGGAAAGG + Intergenic
909095658 1:71284633-71284655 CTGTTGGTGTAGAAGTTCAAAGG - Intergenic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
915646417 1:157275980-157276002 CCGTTGGTATAGAGGGAGAAAGG + Intergenic
918041648 1:180917312-180917334 CTATTGGTCTGCAGGGTCATGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1064871018 10:19937118-19937140 CTGAAGGAATGGAGGATCAAAGG - Intronic
1067181175 10:43987087-43987109 CTGTTGGAGAGGATGGTCAAGGG - Intergenic
1067676999 10:48389937-48389959 ATGTGGGTATGGAGGTTCATAGG + Intronic
1069678997 10:70270422-70270444 CTGTGGGTATGGATGGGCAGAGG + Intronic
1069888500 10:71638657-71638679 CCCTTGGGAGGGAGGGTCAAGGG - Intronic
1075584250 10:123645670-123645692 CTTTTGGAATGGAGGCTAAAGGG - Intergenic
1077077480 11:708099-708121 CTGTTGGTATGGAGGGTCAAGGG - Intronic
1077268923 11:1666078-1666100 CCGTTGTTCTGGGGGGTCAAAGG + Intergenic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1079349647 11:19681624-19681646 CTATTGGTGTGGAGGACCAAGGG - Intronic
1079469093 11:20761171-20761193 CTGTTGTCATGAAGTGTCAATGG + Intronic
1081407325 11:42713095-42713117 CTGTTTGTATGGAGGTGCATTGG - Intergenic
1089350411 11:117818799-117818821 CTGTGGGTTTGGAGAGTGAAGGG - Intronic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1093234408 12:16588874-16588896 CTGTTGTTATGAAGGGAGAATGG - Intronic
1098600315 12:72323737-72323759 CTGTGGGAATTGAAGGTCAAAGG + Intronic
1099790550 12:87329196-87329218 CTGTTGGGATGGAGGGAGAGGGG + Intergenic
1102500162 12:113346619-113346641 CTGAAGGAAGGGAGGGTCAAAGG + Intronic
1105732030 13:23227465-23227487 CAGTTTGTATGGCGGGTCTAAGG - Intronic
1106655321 13:31737715-31737737 CAGTTGGTAAGGAGGTTCCAAGG - Intergenic
1110554391 13:76842330-76842352 CTGTTGGTAGGGAAGCTCACAGG + Intergenic
1111291541 13:86177508-86177530 CTGTGGATATGGAGGGCCACTGG + Intergenic
1112939174 13:104840409-104840431 CTTTTGGTAGGAAGGGTCATTGG - Intergenic
1122036289 14:98951421-98951443 ATGCTGGCTTGGAGGGTCAATGG - Intergenic
1123428442 15:20192817-20192839 GTGGTGGTATGGAGGTGCAAAGG - Intergenic
1125328296 15:38559294-38559316 ATGTTGCAATGCAGGGTCAAGGG - Intronic
1125460339 15:39900681-39900703 CTTCTGGAATGGTGGGTCAAAGG - Intronic
1126450435 15:48802763-48802785 TTGTTTGTATTGAAGGTCAAAGG - Intronic
1128138172 15:65279445-65279467 ATGGTGATATGGAGGGTGAAGGG - Intronic
1129388558 15:75208975-75208997 CTGATTGTCTGGAGGGTCAAGGG - Intronic
1134006742 16:10823017-10823039 CAGTTGGCATAGAGGGTCAGTGG + Intergenic
1135421029 16:22305652-22305674 CTGTTGTCATGGAGGCTCCAAGG + Intronic
1136855875 16:33656945-33656967 GTGATGGTATGGAGGTGCAAAGG + Intergenic
1138695522 16:58809216-58809238 CTGTTGGTAGGGTGTGTCATTGG + Intergenic
1138907957 16:61360958-61360980 CTGTTGGAGTGGAAGGTCACAGG + Intergenic
1139200131 16:64966836-64966858 CAGTAGGTATGGTAGGTCAAAGG + Intronic
1139960933 16:70716873-70716895 CTGTGGATCTGGAGGGTCACTGG + Intronic
1141752811 16:85970431-85970453 CTGGTGGTAGGGAGGTTCCACGG - Intergenic
1142344517 16:89545462-89545484 CTGTTGGGATGGAGAGTGAAGGG + Intronic
1203117460 16_KI270728v1_random:1505424-1505446 GTGATGGTATGGAGGTGCAAAGG + Intergenic
1151097655 17:71517700-71517722 CTGTTTGATTGGAAGGTCAATGG - Intergenic
1156564435 18:38169091-38169113 ATTTTGGTATGAAGGGTCAGGGG + Intergenic
1158012011 18:52739755-52739777 CTGCTAGTATGGTGGGTCCAAGG + Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161347162 19:3774193-3774215 GTGTGGGTATGGAGGTGCAAGGG + Intergenic
1162495538 19:11021338-11021360 CTGCTGGTGTGGAGGGTCTCAGG - Intronic
1164585371 19:29467988-29468010 CTGCTGGTATGGAGAGCTAAAGG - Intergenic
1165027016 19:32969572-32969594 CTGCAGGGATGGAGGGTGAAGGG + Intronic
1165393363 19:35550721-35550743 TGGTTGCTATGGAGGGTCAAGGG + Intronic
930993341 2:57686007-57686029 CTGTTGGTACAGTGGGTCAAGGG - Intergenic
932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG + Intronic
935345579 2:102104629-102104651 CAGCTGGTACGGAGGCTCAAAGG - Intronic
940383634 2:153045164-153045186 CTACTGGTATGGAGTGTTAAAGG - Intergenic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
945299621 2:208203753-208203775 CTGTTTGGATAGATGGTCAAGGG + Intergenic
1170967363 20:21085952-21085974 CTGTGGGTCTTGAGGGTTAAAGG - Intergenic
1175559215 20:59904982-59905004 ATGTTGGTGTTGAGGGTGAAGGG - Intronic
1178440595 21:32595003-32595025 CAGTTGGTATGAAGAGTAAATGG + Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
1185109086 22:48890768-48890790 CTGATGGGATGGTGGGTCACTGG + Intergenic
950190257 3:10971700-10971722 ATGTTGGGATGGAGGGACATAGG - Intergenic
950590004 3:13930198-13930220 GTGTTGGAATTGGGGGTCAAGGG - Intergenic
952089690 3:29869594-29869616 CAGTTTGTATTGAGGGTAAATGG - Intronic
957998939 3:87727406-87727428 CTGTTGGTTTGGAGTCTCAGGGG - Intergenic
960346637 3:116540648-116540670 TTGTTGCTATATAGGGTCAATGG - Intronic
961319489 3:126063111-126063133 CAGTGGGAATGGAGGGTCACAGG - Intronic
963790405 3:149577397-149577419 CTGGTGGTATGTGGGGTTAACGG + Intronic
964761456 3:160138265-160138287 CTGTTTGAATGGAGGGTAACTGG + Intergenic
967577784 3:191116309-191116331 CTCTTGGCCTGAAGGGTCAAGGG - Intergenic
970271286 4:14350658-14350680 TTGTTGGTAGGGAGGGGCATTGG + Intergenic
973564720 4:52172780-52172802 CTGTTGCTTTCAAGGGTCAAAGG - Intergenic
976460235 4:85302533-85302555 CTGCTGGTAAGGAGGGTGTAGGG + Intergenic
976536428 4:86223047-86223069 ATGTGGGTATTGAGGGTCAATGG - Intronic
976665728 4:87588753-87588775 CTATTGGTTTGAAGGGGCAACGG - Intergenic
978256432 4:106697947-106697969 CTAATAGTATGGAGGGTCGAGGG - Intergenic
979812204 4:125051024-125051046 CTGTTGGTGGGTAGGGTCAAGGG - Intergenic
986123978 5:4868311-4868333 CTGGTGGTATGCAGGGTGAGGGG - Intergenic
986374326 5:7114852-7114874 GTGTTAGTCTGGAGGGTCAGGGG + Intergenic
989505116 5:42217783-42217805 CTGTTCCTATTTAGGGTCAAGGG + Intergenic
991045969 5:62223165-62223187 GTGGTGGTATGGAGGTGCAAAGG - Intergenic
991976051 5:72184555-72184577 CTGTTGCTATGGAGAGTCACTGG + Intronic
998098765 5:139414462-139414484 CTGTTGGACTGCAGGGTCACAGG - Intronic
999624783 5:153508910-153508932 GTTTGGGTATTGAGGGTCAAGGG + Intronic
1004878727 6:19984076-19984098 CTGTGGATAGAGAGGGTCAAAGG - Intergenic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1013308964 6:108875461-108875483 CAGCTGGTATGGAGGCTCTAAGG - Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1021242309 7:18218506-18218528 CGGTTGGTTAGTAGGGTCAATGG - Intronic
1021802048 7:24316837-24316859 CTGTAGGGCTGGAGGGGCAAGGG - Intergenic
1021920417 7:25479432-25479454 CTCTTGGTGGGGAGGGTCAATGG + Intergenic
1024665950 7:51547461-51547483 TTCTTGATATGCAGGGTCAAGGG + Intergenic
1026787632 7:73311865-73311887 CTGTGGGTATGGTGAGTCAAAGG + Intergenic
1029905233 7:104085840-104085862 CTGTTGGCATGGGGGGTTAGGGG + Intergenic
1030445337 7:109642216-109642238 GTGGTGGTATGGAGGGATAATGG + Intergenic
1031479453 7:122260548-122260570 CTGATGGTTTGGAGAGACAATGG + Intergenic
1032181879 7:129686790-129686812 ATGTTGGTATGAAGTGACAAAGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1040482836 8:47841999-47842021 CTGTTGGTATAGTAGGTCAAGGG - Intronic
1044440186 8:92215057-92215079 CTGTTGGTAGTGGGGGTCGAGGG - Intergenic
1047815845 8:128461455-128461477 CTGTTGCTATGGAGTTTCATTGG - Intergenic
1052140402 9:24974672-24974694 ATGTTGGAAGGGAGGTTCAAAGG - Intergenic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1057735429 9:97654617-97654639 CTGTGCGTATGGAGGGGCATGGG + Intronic
1058597618 9:106631725-106631747 ATGATGGAATGGAGAGTCAATGG + Intergenic
1059693518 9:116709095-116709117 CAGCTGGTATGGAGAGTCACAGG - Intronic
1061330318 9:129888430-129888452 CTGTTGGTTTGCAGGGACAGAGG + Exonic
1061782742 9:133005315-133005337 CTCTTGGTATCCAGGGCCAAGGG + Intergenic
1188122485 X:26326170-26326192 CTGTTTCTATGGAGTGTAAAGGG + Intergenic
1194349457 X:92808386-92808408 CTGGTGATATAGTGGGTCAAGGG + Intergenic
1196372871 X:114998664-114998686 CTGGTGGTATGGTGATTCAAGGG - Intergenic
1198682040 X:139193326-139193348 CTTTTGGTATAGAGTTTCAAAGG + Intronic
1200657779 Y:5924987-5925009 CTGGTGATATAGTGGGTCAAGGG + Intergenic