ID: 1077077695

View in Genome Browser
Species Human (GRCh38)
Location 11:708853-708875
Sequence CCTGAAGTCCAGAGGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 495}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077077695 Original CRISPR CCTGAAGTCCAGAGGGAGCC CGG (reversed) Intronic