ID: 1077077695

View in Genome Browser
Species Human (GRCh38)
Location 11:708853-708875
Sequence CCTGAAGTCCAGAGGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 495}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077077695 Original CRISPR CCTGAAGTCCAGAGGGAGCC CGG (reversed) Intronic
900092491 1:926476-926498 GCTGAAGGCCAGAGGGTGCAAGG + Intronic
900715602 1:4141574-4141596 CCTGAGGTCACGAGGGAGCTGGG - Intergenic
901185737 1:7371975-7371997 CCTGGAGTCCAGACCCAGCCTGG + Intronic
902197148 1:14806139-14806161 CCTAAAGGCCAGAGGAACCCTGG - Intronic
902735317 1:18396914-18396936 GGTGAAGTCCAGAGGAAACCAGG - Intergenic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903683228 1:25111663-25111685 CCAGGAGTTCAAAGGGAGCCAGG + Intergenic
903741442 1:25560796-25560818 CCCGAAGGCCAGAGGCAGTCAGG + Intronic
904163120 1:28535899-28535921 GCTGAAATCCAGGGGAAGCCGGG + Exonic
904697455 1:32338233-32338255 CCAGAGCCCCAGAGGGAGCCTGG + Intergenic
905297180 1:36961583-36961605 CCTGAAGCCCACAGCAAGCCTGG - Intronic
905593514 1:39185870-39185892 CCTGAAGTGCTGAAGGACCCAGG + Intronic
905935207 1:41817918-41817940 CATGAACTCCTGAGGGAGACTGG + Intronic
905937209 1:41834101-41834123 CCCCAGGCCCAGAGGGAGCCGGG - Intronic
906289479 1:44610489-44610511 CCTGACCTCCTGAGGGAGCGAGG + Intronic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
907404421 1:54245081-54245103 CATGAAGACCAAAGGGAGCCTGG + Intronic
908374114 1:63516203-63516225 GCTTGAGTCCAGAGTGAGCCTGG + Intronic
908480656 1:64535803-64535825 CCAGAGGCCCAGAGGAAGCCAGG - Intronic
908514524 1:64878975-64878997 CCCTCAGTGCAGAGGGAGCCAGG + Intronic
910577149 1:88777780-88777802 CCTGAATTCCAAAGGGAGGAAGG - Intronic
912274272 1:108240167-108240189 GCTGAAGTTCAGAGAGAGGCTGG - Intronic
912286995 1:108379695-108379717 GCTGAAGTTCAGAGAGAGGCTGG + Intronic
912293947 1:108454156-108454178 GCTGAAGTTCAGAGAGAGGCTGG + Intronic
912300574 1:108511961-108511983 GCTGAACAACAGAGGGAGCCAGG + Intergenic
912520456 1:110241094-110241116 ACCGAGGCCCAGAGGGAGCCTGG - Intronic
912525485 1:110279768-110279790 CCTAAAGCCCACAGGGAACCAGG - Intronic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
914849747 1:151305465-151305487 CCAGAAGACAAGAGGGAGCTTGG - Intronic
915104778 1:153527020-153527042 CCTGAAGGCCAGAGGGTGAATGG + Intergenic
915118811 1:153616064-153616086 CCTGAAGCCCAGGCGGGGCCTGG - Intronic
915624303 1:157105546-157105568 ACAGCAGTCGAGAGGGAGCCTGG - Intergenic
915632359 1:157162437-157162459 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
917649921 1:177066233-177066255 CCTGAGGTCCAGTGGGAACATGG - Intronic
919787647 1:201270010-201270032 CCTGAAGTCCACAGGCAGCCAGG - Intergenic
919989636 1:202700269-202700291 TCAGAAGTCCAGAGTCAGCCTGG - Intronic
920177956 1:204114850-204114872 CCTGAAGTCACAAGGGTGCCTGG - Intronic
920774174 1:208919972-208919994 CCTGAAGTCGAGAGGTAACTAGG + Intergenic
921665833 1:217869701-217869723 CCTGAATTCCAAAGGGAGGAGGG + Exonic
921725542 1:218519485-218519507 GAGGAAGGCCAGAGGGAGCCTGG + Intergenic
922166472 1:223119570-223119592 CCTGAATTCCAAAGGGAGGAGGG - Intronic
922619212 1:226980132-226980154 CCTCCAGTCCAGAGGGTGCCAGG - Intronic
922895102 1:229093800-229093822 CCTGAACTCCAAAGGGAGGAGGG - Intergenic
923101959 1:230823996-230824018 CCTGCAGTCCACAGGCAGTCAGG - Intergenic
923328790 1:232903486-232903508 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG + Intergenic
1063028069 10:2202549-2202571 CCTGAATTCCAGAGGGAGCAGGG + Intergenic
1063299262 10:4836893-4836915 CCTGAAGCTCAGGGGCAGCCTGG + Intronic
1063400333 10:5737542-5737564 CCTGAAGGGCAGAGGTTGCCTGG - Intronic
1063413724 10:5856553-5856575 CCTGAAGGCAAGGGAGAGCCGGG + Intergenic
1063976903 10:11424656-11424678 CATGACGTCCAGAGGGAACTGGG - Intergenic
1064414559 10:15137255-15137277 TCTGAAGTCCAGCTGGAGGCAGG + Intronic
1065570258 10:27063745-27063767 CATTAAGACCTGAGGGAGCCAGG - Intronic
1065677366 10:28192040-28192062 CTTGAACCCCAGAGGCAGCCTGG + Intronic
1066192899 10:33072048-33072070 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1066336821 10:34486238-34486260 CCTGAATTCCAAAGGGAGGAGGG + Intronic
1066386450 10:34945563-34945585 CCTGAATTCCAAAGGGAGAAAGG + Intergenic
1067187788 10:44044813-44044835 CTTGAGGTCCAGAGGGGGCTGGG + Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067838228 10:49654670-49654692 CATGACCTCCAGAGGGAGGCAGG - Intronic
1067941695 10:50661860-50661882 CCTAAAGCCAAGAGGTAGCCAGG - Intergenic
1068091800 10:52441055-52441077 CCTGAAGGCAAGGGAGAGCCAGG + Intergenic
1069248721 10:66243075-66243097 CCTGAATTCCAAAGGGAGGAGGG - Intronic
1069554008 10:69384857-69384879 CGTGAAGCCCAGAGGCATCCTGG - Exonic
1070699316 10:78588182-78588204 TTTGGAGCCCAGAGGGAGCCAGG + Intergenic
1071603728 10:86971136-86971158 CCTGAAGTCCTGAGGGGCCGTGG - Intronic
1071863040 10:89695539-89695561 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1072798356 10:98374084-98374106 CCTGAAGTCCCAAGGAACCCAGG + Intergenic
1072841191 10:98775747-98775769 CCTGGAGTTCAGAAGAAGCCTGG - Intronic
1073142265 10:101255978-101256000 CCTGAAGCCCAAAGGAAGCAAGG - Intergenic
1073260791 10:102188738-102188760 CCCAAAGTCCAGAGGGGGGCAGG + Intergenic
1073339803 10:102735973-102735995 CCTGCTGTCCAGAAGGAGACAGG + Intronic
1073541624 10:104319869-104319891 CCTGAATTCCAGAGGGAGGAGGG - Intronic
1074306928 10:112287679-112287701 CCAGAAGCCCAGAGGGAGGAAGG + Intronic
1075226084 10:120630453-120630475 CCTGAATTCCAAAGGGAGGAAGG - Intergenic
1076471650 10:130723259-130723281 CCTGAATTCCAGAGGAAGGAAGG + Intergenic
1076902305 10:133345951-133345973 CCTGAATTCCAAAAGGAGGCGGG + Intronic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1077464367 11:2726562-2726584 CCAGAAGTCCAGAGGGACACTGG + Intronic
1077515032 11:2996245-2996267 ACTGCAGTCCAGGTGGAGCCAGG + Intergenic
1077559194 11:3246792-3246814 CCTGAATTCCAAAGGGAGGAAGG + Intergenic
1078565693 11:12412218-12412240 CCTCATGTCCAGCGTGAGCCTGG + Intronic
1079328428 11:19513936-19513958 CCTGAGCTCCAGAGGGAGCATGG + Intronic
1079471994 11:20787155-20787177 CATAAAGTCCAGAGGGAGAGGGG - Intronic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1081969428 11:47187370-47187392 CTTGAAGACCAGGGGGAGCGCGG + Intergenic
1082044584 11:47714806-47714828 TCTGAAGTCAAGAGGGAGCTGGG - Intronic
1082784988 11:57311727-57311749 CCTTAAATTCAGAGGCAGCCTGG + Intronic
1083083108 11:60113981-60114003 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1083160354 11:60850503-60850525 ACAGAAGCCCAGAGGGGGCCTGG + Exonic
1083296146 11:61716702-61716724 CCTGCAGGCCATGGGGAGCCAGG + Intronic
1083660120 11:64248049-64248071 GCTGGAGTTCAGCGGGAGCCAGG - Intergenic
1084445634 11:69202051-69202073 CCCGCAGCCCTGAGGGAGCCAGG + Intergenic
1084445991 11:69204121-69204143 ACTGAGGCCCAGAAGGAGCCAGG + Intergenic
1084461565 11:69299249-69299271 CCAGGTGTCCACAGGGAGCCCGG + Intronic
1084553732 11:69863992-69864014 CCTGGAAGCCGGAGGGAGCCAGG - Intergenic
1085442187 11:76575373-76575395 CCTGAATTCCAAAGGGGGACAGG - Intergenic
1085831028 11:79901134-79901156 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1086108328 11:83171118-83171140 TTTGCAGTCCAGAGGGAGGCAGG - Intronic
1087657303 11:100939837-100939859 CCTGAACTTCAGATGGAGGCGGG + Intronic
1087994013 11:104781202-104781224 CCTGAATTCCAGAGAGAGAAGGG + Intergenic
1088330031 11:108641891-108641913 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1088912987 11:114206059-114206081 CTGGATGTCAAGAGGGAGCCTGG + Intronic
1089634915 11:119805852-119805874 GCTGAAGATCAGAGTGAGCCAGG - Intergenic
1090116659 11:123980183-123980205 CCCAAAGTCCAGAGGGAGACAGG + Intergenic
1090962806 11:131572249-131572271 CCTGATGTACAAGGGGAGCCTGG + Intronic
1090973515 11:131662776-131662798 TCTGAGGTCCACAGGGAGCCAGG - Intronic
1091271171 11:134312926-134312948 CCTCAAATGCAGACGGAGCCTGG + Intronic
1091700344 12:2654889-2654911 CCTGCAGCCCAGTGGGAGCTGGG - Intronic
1091896941 12:4113140-4113162 GCTGCAGTCCTGAGGAAGCCAGG + Intergenic
1092941049 12:13407509-13407531 CCTGAAGTCAAGATGAAGCAGGG + Intergenic
1093434283 12:19118070-19118092 CCTGAAGTCCTTAGGGACCCAGG + Intergenic
1097021583 12:56024777-56024799 CCTGACGTCCACAGGAAGCAGGG - Intronic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1097459768 12:59846631-59846653 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1098849260 12:75575512-75575534 CCTGAAGTCCACAGACAGCTGGG - Intergenic
1098876591 12:75872160-75872182 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1098903353 12:76135505-76135527 CCTGCAGTCTAGGGGAAGCCAGG + Intergenic
1099127193 12:78777053-78777075 CCTGAAGGCCAGAGGCTGGCTGG + Intergenic
1099942567 12:89206249-89206271 CCAGAAGTCCATTGGGAGACAGG - Intergenic
1101275002 12:103189785-103189807 GCTGAAGTCCATAGGCAGGCAGG - Intergenic
1101538399 12:105641810-105641832 CCAGAAGTCCAGAAGGAGGCAGG + Intergenic
1102072561 12:110033936-110033958 GCTGGAGTCCAGCAGGAGCCAGG + Exonic
1102146914 12:110661203-110661225 CCTGAAGTCAAGGGGGGCCCTGG + Exonic
1102444412 12:112990826-112990848 CCTGAATTCCAAAGGGAGGAGGG + Intronic
1102872251 12:116423135-116423157 CCTGATGACCAGAGGCACCCCGG - Intergenic
1102968997 12:117151214-117151236 CGAGAAGTCCAGAAGGAGGCGGG + Intronic
1103828755 12:123762309-123762331 CGCGCAGTGCAGAGGGAGCCGGG - Intergenic
1104355331 12:128080174-128080196 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1104428523 12:128697431-128697453 CCAGAGGTTCAGAGGGAGCAGGG + Intronic
1104461928 12:128963203-128963225 ACTGATGGCCAGAGGCAGCCTGG - Intronic
1104530471 12:129565473-129565495 CCTGAATTCCAAAGGGAGGAGGG + Intronic
1104694071 12:130850164-130850186 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1104860279 12:131919843-131919865 CCTCAAGGCCACGGGGAGCCAGG + Intronic
1105601428 13:21891873-21891895 CCTGAAGGGAAGAGGGAGCTGGG + Intergenic
1107117411 13:36762052-36762074 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1107426367 13:40297100-40297122 CCTGAAGCCTTGAGGGATCCAGG + Intergenic
1110137570 13:72086923-72086945 CCATAAGTCAAGAGGGAGACTGG + Intergenic
1110709689 13:78636610-78636632 CCTAGAGCCCAGAGGGAACCTGG - Intronic
1110718316 13:78732846-78732868 CCTGAATTCCAGAGGGAGAAGGG - Intergenic
1111172187 13:84541895-84541917 CCTTAATTCCAAAGGGAGTCGGG + Intergenic
1111924249 13:94445958-94445980 CCTGGAACCCAGAGGGGGCCAGG - Intronic
1112322916 13:98423328-98423350 ACTGAAGTCAGGAGGGACCCGGG - Intronic
1113479775 13:110612009-110612031 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1113609917 13:111637127-111637149 CCTGCAGTCCAGAGGATGCTTGG + Intronic
1114032150 14:18587184-18587206 CCTGGTGTCCATATGGAGCCTGG - Intergenic
1114426300 14:22626425-22626447 CCTGAATTCCAAAGGGAGGAAGG - Intergenic
1115747530 14:36452524-36452546 GCTGAAATCCAGATGGTGCCAGG - Intergenic
1115857952 14:37651623-37651645 TCTCAAGTACAGAGGGTGCCAGG + Intronic
1115933535 14:38526049-38526071 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1118380424 14:65213535-65213557 CCTGAATTCCACAGGGAGGAGGG + Intergenic
1118475193 14:66109832-66109854 CCTGATGACCACAAGGAGCCAGG + Intergenic
1119910379 14:78344554-78344576 CCTGAATGCCAGTGGTAGCCCGG - Intronic
1120685137 14:87529222-87529244 CTTGCAGACAAGAGGGAGCCTGG - Intergenic
1120756307 14:88247528-88247550 CCTCAGGTCCTCAGGGAGCCAGG + Intronic
1120769667 14:88365278-88365300 CCTGAACTTCAAAGGGAGGCGGG + Intergenic
1121031174 14:90659896-90659918 CCAGAAGACTAGAGAGAGCCAGG + Intronic
1121453569 14:94024705-94024727 CCAGAAGACCAGAGAGGGCCTGG + Intergenic
1121516866 14:94558301-94558323 CCTGGATTCCAAATGGAGCCAGG - Intergenic
1122067172 14:99181807-99181829 CCTGAAGTCCAGAGTGGGGAAGG - Intronic
1122306862 14:100772064-100772086 CCTAGAGTCCAGAGAGAGCTGGG + Intergenic
1122378651 14:101286213-101286235 CCTGAAGTCCAGGAGGAGCCCGG + Intergenic
1122683165 14:103482577-103482599 CCTAAAGTTCAGAAGGAGCTGGG - Intronic
1123167728 14:106342576-106342598 CTTGGTGTCCTGAGGGAGCCTGG + Intergenic
1123170354 14:106367287-106367309 CTTGGTGTCCTGAGGGAGCCTGG + Intergenic
1202896796 14_GL000194v1_random:15062-15084 CCTGGTGTCCACATGGAGCCTGG + Intergenic
1123425360 15:20166556-20166578 CCTTAAATCCAGAGTGGGCCGGG + Intergenic
1123534583 15:21173088-21173110 CCTTAAATCCAGAGTGGGCCGGG + Intergenic
1124064240 15:26324974-26324996 CCTGAATTCCAAAGGGAGCAGGG - Intergenic
1124208749 15:27744880-27744902 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1124381579 15:29172198-29172220 CCTGAAGTCCAGTTGGTCCCTGG - Intronic
1126158284 15:45585590-45585612 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1126372728 15:47964303-47964325 CCTGAAGCTCAGGGGGAGCCAGG + Intergenic
1127728007 15:61769849-61769871 CCTGATGTGCAGAGGGATTCAGG - Intergenic
1127774301 15:62253474-62253496 GCTGAACTCCAGGGGGAGCGAGG - Intergenic
1127901694 15:63345719-63345741 CCTGGAGCCCAGAGAGAGGCAGG + Intronic
1129116638 15:73368531-73368553 CCTGAACGCCAGAGGGAGGGAGG - Exonic
1129687092 15:77692749-77692771 CCTGGAGGCGGGAGGGAGCCAGG - Intronic
1130577618 15:85106309-85106331 TCTGAAGTTCAGGAGGAGCCTGG - Intronic
1130695050 15:86122835-86122857 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1131459111 15:92606085-92606107 CCTTAAATCCCAAGGGAGCCTGG + Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132567644 16:630707-630729 CCTGGGGTCCAGAGGGCGCCAGG + Intronic
1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG + Intergenic
1132933300 16:2469386-2469408 CCTGACGTCCAGAGACAGCTTGG + Intergenic
1133693295 16:8236686-8236708 CCAGAGGTCCATGGGGAGCCAGG - Intergenic
1134314834 16:13109010-13109032 TCTGGAGTCTAGAGAGAGCCAGG - Intronic
1135644816 16:24152593-24152615 CCTGGATTCCAGAGAGAGCTGGG - Intronic
1136061682 16:27730955-27730977 TCTCAAGTCCAGAGGAAGCAGGG - Intronic
1136289586 16:29263452-29263474 CCTGAATTCCATAGGGAGGGGGG + Intergenic
1136385239 16:29921377-29921399 CGTGAGGTGCAGAGGGAACCTGG + Intronic
1136859505 16:33689171-33689193 CCTTAAATCCAGAGTGGGCCGGG - Intergenic
1137700406 16:50493902-50493924 TCTGGATTCCAGTGGGAGCCAGG - Intergenic
1138031605 16:53563659-53563681 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1138212210 16:55173180-55173202 CCTGAAGTCAACTGGGAGGCAGG - Intergenic
1138261721 16:55628405-55628427 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1138292870 16:55862821-55862843 CCTGAAGGACAGAGAGATCCTGG + Intronic
1138517068 16:57541972-57541994 CCTGAAGCCCAGAGAGGACCTGG - Intergenic
1138656099 16:58492336-58492358 CCTGAAGTCCCGTGGGAACAGGG - Intronic
1139367496 16:66442364-66442386 CCCAAAGGCCAGAGGGAGGCGGG - Intronic
1139526276 16:67518677-67518699 ACTGAGTTCCAGAGGGAGCAAGG - Intronic
1140868100 16:79081781-79081803 GCTGGAGACCAGAGGCAGCCAGG - Intronic
1141232226 16:82179407-82179429 CCTGATGCCCAGAGGCAGACAGG - Intergenic
1141477021 16:84280936-84280958 CAAGAAGTCCAGAGGTAGGCTGG + Intergenic
1141519818 16:84571319-84571341 ACTAAGGCCCAGAGGGAGCCCGG - Intronic
1141739734 16:85883330-85883352 CCTGAATTCCACGGAGAGCCGGG + Intergenic
1141922131 16:87143438-87143460 CCTGGAATCCAGACGCAGCCTGG + Intronic
1142095320 16:88236432-88236454 CCTGAATTCCATAGGGAGGCGGG + Intergenic
1142211321 16:88809958-88809980 ACTGTTGTCCAGAGGGTGCCTGG - Intronic
1142476879 17:193985-194007 CTAGAACCCCAGAGGGAGCCGGG - Intergenic
1143226120 17:5305346-5305368 CCTGAAGCCTGGAGAGAGCCAGG + Intronic
1143757982 17:9080339-9080361 CCTGAAGTGTAGAGGGCTCCAGG - Intronic
1143787447 17:9266512-9266534 GCTGAAATCAAGAGGAAGCCAGG + Intronic
1144493948 17:15735575-15735597 CCTGAAACCCAGAGGAGGCCAGG - Exonic
1144810104 17:17993603-17993625 GCTGAGCTCCAGAGGGAACCAGG + Intronic
1144906313 17:18641104-18641126 CCTGAAACCCAGAGGAGGCCAGG + Exonic
1145031848 17:19510447-19510469 CCTGAATTCCAAAGGGAGGAAGG + Intronic
1145032125 17:19512329-19512351 CCTGAATTCCAAAGGGAGAAGGG - Intronic
1145055970 17:19704227-19704249 CCTGAAGTCCTGAGCCAGCCTGG + Intronic
1145252456 17:21304087-21304109 CATGAGGTCCAGTGAGAGCCTGG - Intronic
1146095087 17:29922157-29922179 CCTAAAGACCAAAGGGAGCATGG + Intronic
1146667676 17:34715745-34715767 CCTGAAGTCCTGACGGAGTCTGG - Intergenic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147535924 17:41323406-41323428 CCTGCAACTCAGAGGGAGCCAGG - Intergenic
1148792770 17:50183059-50183081 TCAGAAGTCCAGAGAGAACCAGG - Intergenic
1148951839 17:51320168-51320190 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1149599879 17:57886292-57886314 CCTGAAGACCTGAGTGAGGCAGG + Intronic
1150805052 17:68312169-68312191 CCTGAAGTCCAGAGCTAGGAGGG - Intronic
1151455886 17:74225624-74225646 CCTGCAGGCCAGAGGGACACAGG + Intronic
1151931361 17:77233882-77233904 CGCTAAGTCCAGAGCGAGCCAGG - Intergenic
1152265531 17:79292158-79292180 CCTGAAAACCACAGGAAGCCAGG + Intronic
1153433000 18:5039238-5039260 CCTGAATTCCAAAGGGAGGAAGG + Intergenic
1154943949 18:21142223-21142245 CCTAAATTCCTGAGGGAGCCAGG + Intergenic
1155904115 18:31428868-31428890 CATGAAGTCCAGAGGGATAAGGG - Intergenic
1156133218 18:34003896-34003918 CCTGAATTCCAAAGGGAGGAGGG - Intronic
1156345995 18:36257667-36257689 ACTGAAGTCCCAAGGTAGCCAGG + Intronic
1157429788 18:47615266-47615288 CCTGAGGCACAGAGGGAGCAAGG + Intergenic
1157574173 18:48732647-48732669 CCTCATGTCCAGAAGGAGCTGGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158703506 18:59770556-59770578 TCGGTAGTCCAGAGAGAGCCTGG + Intergenic
1159986221 18:74844356-74844378 TCTGAAGTCCTGAGGGAAGCTGG - Intronic
1160077341 18:75691130-75691152 CTTGATGTTCAGAGTGAGCCTGG - Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160543740 18:79639303-79639325 CCTGAATTCCAGAGGGAGGAGGG - Intergenic
1160553048 18:79707320-79707342 CCTGAAAGCTGGAGGGAGCCTGG + Intronic
1160754477 19:750544-750566 CCAGCAGCCCTGAGGGAGCCCGG + Intergenic
1160847347 19:1172433-1172455 CCTGAAGGCCAGAGGATGTCTGG + Intronic
1161590847 19:5128480-5128502 CCTGCAGTCCTGAGTGAGGCTGG + Intronic
1162963398 19:14142512-14142534 GCTGAAGTCCAGAGGAAACCAGG - Intergenic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1164669336 19:30063776-30063798 GCTGAACTCCGGAGGGACCCCGG - Intergenic
1164713181 19:30373857-30373879 CCTGAGCTGCAGTGGGAGCCGGG + Intronic
1164767597 19:30783764-30783786 GCTGAAGTTCAGAGGGAGGAAGG + Intergenic
1165391089 19:35539313-35539335 CCTGAATTCCAAAGGGAGGAAGG + Intronic
1165953596 19:39488483-39488505 TCTAAAGGCCAGAGGGAGGCAGG - Intronic
1167292337 19:48631076-48631098 ACTGAGGTCCAGAGGGACCCAGG + Intronic
1167360183 19:49025916-49025938 CAGGAAGACCAGAGGGGGCCCGG + Intronic
1167360902 19:49029865-49029887 CAGGAAGACCAGAGGGGGCCCGG - Intronic
1167362750 19:49038932-49038954 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1167363385 19:49042256-49042278 CAGGAAGACCAGAGGGGGCCCGG - Intergenic
1167365108 19:49050671-49050693 CAGGAAGACCAGAGGGGGCCCGG + Intergenic
1168133011 19:54332685-54332707 CCTGGAGTCCAGAAGGTGCTAGG - Intergenic
1168240588 19:55086978-55087000 CGTGGAGACCACAGGGAGCCGGG + Intronic
1168430094 19:56271837-56271859 CCAGGAGTCCAGAGGGATACTGG + Intronic
1168611281 19:57802569-57802591 CCTGAAGGCCACAGTGAGCAAGG - Intronic
925055344 2:852990-853012 CCTGAACTCCACAGGGAGGAGGG + Intergenic
925882525 2:8365007-8365029 CCTGAACTCCAGACAAAGCCAGG - Intergenic
926333142 2:11841916-11841938 GCTCAAGTCCAGAGGCAGTCAGG + Intergenic
926347116 2:11957563-11957585 CTTGCAGTACAGAGGGAGGCTGG + Intergenic
926797701 2:16632379-16632401 GCTGAAGTTCAGAGGGTGCCTGG + Intronic
928072917 2:28235515-28235537 CCTGTAGTCAATAGGGAGACAGG + Intronic
928840335 2:35598472-35598494 CCATAAGGCCAGTGGGAGCCAGG + Intergenic
929810414 2:45184899-45184921 CCATAAGTCCTGAGGGAGGCTGG - Intergenic
929962188 2:46505155-46505177 TCTGAAGCCCAGAGTAAGCCAGG - Intronic
930990680 2:57650506-57650528 CCTCAATTCCAGAGGGACCATGG - Intergenic
931173933 2:59834022-59834044 CCTGGGGTGCTGAGGGAGCCTGG - Intergenic
932096549 2:68855075-68855097 TCTGAGGTCAAGAGAGAGCCTGG + Intergenic
932274590 2:70442667-70442689 CCTGAAGCCCAGTGGGAGTGGGG + Intergenic
932803947 2:74767222-74767244 CATAAATGCCAGAGGGAGCCAGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
932918801 2:75885972-75885994 CCTGAAGTCCACAGGCTGGCAGG - Intergenic
932959719 2:76398346-76398368 CCTGAATTCCAAAGGGAGGAAGG - Intergenic
933117735 2:78496052-78496074 CCTGTGGTCTAGAGGGAGGCAGG + Intergenic
934457863 2:94190291-94190313 CCTTAAATCCAGAGTGGGCCGGG - Intergenic
934881358 2:97983308-97983330 CCTGAATTCCAAAGGGAGGAGGG + Intronic
934951407 2:98578249-98578271 CCTGATGTCCAGTGTGACCCTGG + Intronic
935903885 2:107822518-107822540 CCCGAAGTGCAGAAAGAGCCTGG - Intergenic
936069178 2:109353902-109353924 TCTGAACTCCAGAGGGAGGCAGG - Intronic
936586439 2:113762548-113762570 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
937037581 2:118794568-118794590 ACTGAACTCCCGAGGGAACCAGG + Intergenic
938307731 2:130266407-130266429 CCTGAGGTCCAGATGGACCCTGG - Intergenic
938447607 2:131390434-131390456 CCTGAGGTCCAAATGGACCCTGG + Intergenic
938878343 2:135557471-135557493 CCAGAAGTTAAGAGGCAGCCAGG + Intronic
938986217 2:136579069-136579091 CCTGAAGTCTAGAAGTGGCCTGG + Intergenic
940993956 2:160126985-160127007 CCTGAATTCCAAAGGGAGAAGGG - Intronic
942111149 2:172683882-172683904 CCTGCAGCCCAGAGGAAGACTGG + Intergenic
942868176 2:180700179-180700201 CCAGGAAGCCAGAGGGAGCCAGG - Intergenic
943309253 2:186306583-186306605 CCTGAATTCCAAAGGGAGCGGGG - Intergenic
943834375 2:192500526-192500548 CCTGAAGTCCAGTGGTCTCCAGG - Intergenic
944155620 2:196604288-196604310 CCTGGAGTCCAGAGAGGGCTGGG - Intergenic
947747924 2:232518896-232518918 CCTGAAGACCAGAGGCAGGAGGG + Intergenic
947994534 2:234515855-234515877 GAGGAAGTCCAGAGGAAGCCAGG - Intergenic
948434477 2:237943906-237943928 CCCAAAGTCCAGAGGGGGCAAGG - Intergenic
948840609 2:240647097-240647119 CCTGGAGCCAAGGGGGAGCCGGG - Intergenic
1168845857 20:944355-944377 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1172186778 20:33035834-33035856 CCTGAAGTCCCCAGGGAATCTGG + Intronic
1172844454 20:37921409-37921431 CCTGAAGGCCCCAGGCAGCCCGG + Intronic
1173390263 20:42625563-42625585 CCTCAACTCCAGAGGTAGCTGGG + Intronic
1173475741 20:43358091-43358113 CCTCAAGTTCAGAGGAAGCTAGG + Intergenic
1174384605 20:50179674-50179696 CCTGAAGTCCAGCTGGAGCCTGG + Intergenic
1174913874 20:54635088-54635110 CCTGAACTCCAAAGGGAGGAGGG - Intronic
1176300865 21:5098333-5098355 CCAGAAGCCCATAGGGAGCAGGG + Intergenic
1176362877 21:6012898-6012920 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1176616483 21:9031058-9031080 CCTGGTGTCCACATGGAGCCTGG + Intergenic
1176708645 21:10132573-10132595 CCTGGTGTCCACATGGAGCCTGG - Intergenic
1176708658 21:10132644-10132666 CCTGATGTACATATGGAGCCTGG - Intergenic
1177735188 21:25080356-25080378 CCTGAAAACCACAGGGAGCCTGG - Intergenic
1177801727 21:25834614-25834636 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1178367524 21:31999670-31999692 CCTGAAGGCCAGCAGGAGCCGGG + Exonic
1178698514 21:34814763-34814785 CCTGCAGTCCAGTGGCAGGCAGG - Intronic
1178835380 21:36093030-36093052 GCTGGAGTCCACAGAGAGCCTGG - Intergenic
1179760641 21:43525647-43525669 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1179856171 21:44163620-44163642 CCAGAAGCCCATAGGGAGCAGGG - Intergenic
1180043018 21:45289894-45289916 CCTGAACTCCAAAGGGAGGTGGG + Intergenic
1180456264 22:15514241-15514263 CCTGGTGTCCATATGGAGCCTGG - Intergenic
1180782882 22:18530475-18530497 CCTGGAGTCCACCTGGAGCCAGG - Intronic
1181126445 22:20704506-20704528 CCTGGAGTCCACCTGGAGCCAGG - Intergenic
1181239780 22:21469837-21469859 CCTGGAGTCCACCTGGAGCCAGG - Intergenic
1181507536 22:23370191-23370213 CCTGAAGGACAGAGAGATCCTGG + Intergenic
1181581481 22:23831334-23831356 TCTGAGGGACAGAGGGAGCCAGG - Intronic
1181782377 22:25202438-25202460 TCTGATGTCCAGCAGGAGCCAGG - Intronic
1182501713 22:30752945-30752967 CCTGAATTCCAAAGGGAGGAGGG + Intronic
1182859136 22:33544165-33544187 GGTGAAGTCCAGAGGAAACCAGG - Intronic
1183187923 22:36303017-36303039 GCTGAAGTCCAGAGTCACCCAGG - Intronic
1183342121 22:37287217-37287239 CCTGAAGGCAGGTGGGAGCCAGG + Intronic
1184031842 22:41899829-41899851 CCTGAAAAGCAGAGGGACCCAGG - Intronic
1184123597 22:42471023-42471045 CCTGAGATACAGAGGGAGCTGGG - Intergenic
1184757062 22:46522790-46522812 TCGGAGGTCCAGAGGGGGCCAGG + Intronic
1184933355 22:47698438-47698460 CCTGAACTCCAAAGGGAGGAGGG + Intergenic
1185047696 22:48537253-48537275 CCTCAGGTCCCCAGGGAGCCGGG - Intronic
1185153633 22:49180321-49180343 CCACATGTGCAGAGGGAGCCTGG - Intergenic
1185157913 22:49205320-49205342 CCATAATTCCAGAGGGACCCAGG + Intergenic
1185282873 22:49983212-49983234 CCGGGAGTCTGGAGGGAGCCGGG - Intergenic
950090507 3:10291181-10291203 CCGGGAGTCCGCAGGGAGCCAGG + Exonic
950551082 3:13666260-13666282 GGGGAAGTCCTGAGGGAGCCAGG - Intergenic
950805737 3:15601716-15601738 CCAGAATGCCAGAGGGAGGCGGG + Exonic
950818459 3:15732145-15732167 TCTGAAGTACAGAGGGACTCTGG + Intronic
951160270 3:19410929-19410951 CCAGAAGTACAGAGAAAGCCAGG + Intronic
952033796 3:29175835-29175857 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
952619710 3:35322962-35322984 CCTGAAGTCTTGAGGCATCCAGG + Intergenic
953505409 3:43481535-43481557 CCTGAATTCCAAAGGGAGGAGGG - Intronic
954128453 3:48546961-48546983 GGTGAAGTCCAGAGGAAACCAGG - Intronic
954383286 3:50230954-50230976 GCTGAGGTCCAGAGTGGGCCAGG - Intronic
954681536 3:52348753-52348775 CCTGAAGCCTAGAGGGTGGCAGG - Intronic
955043102 3:55335733-55335755 ACTGAAGTCAGGAGGGAGACTGG + Intergenic
955405974 3:58626040-58626062 CCTGAGGTCCAGAGGGGTTCAGG + Intronic
955685624 3:61545746-61545768 CCTGCAGTCAAGAGGGACCCAGG + Intergenic
956855947 3:73274878-73274900 CCTGAAGGACAGAAGAAGCCAGG - Intergenic
960090183 3:113630827-113630849 CCTGAATCCCACAGGGAGGCAGG + Intergenic
960338797 3:116449861-116449883 CATGAAATCCAGATGCAGCCTGG + Intronic
960405348 3:117252924-117252946 TTTGAAGTCCTGAGGGAGACTGG + Intergenic
960758828 3:121049751-121049773 CCTGGAGACGTGAGGGAGCCTGG + Intronic
961183638 3:124895896-124895918 ACTGAGGTCCAGAGGGTGGCAGG - Intronic
961378478 3:126482335-126482357 CCTGCAGCTCTGAGGGAGCCAGG - Exonic
961537367 3:127578248-127578270 GCTGCAGCCCAGTGGGAGCCTGG - Intronic
961794255 3:129398229-129398251 CCTGAATTCCATAGGGAGAAGGG - Intergenic
961993068 3:131213032-131213054 CCTTAAGTCCAAAGGAAGCCTGG - Intronic
963319318 3:143795926-143795948 CCTGACAGCAAGAGGGAGCCTGG + Intronic
965959503 3:174412116-174412138 CCTGAATTCCAAAGGGAGGAAGG - Intergenic
968649303 4:1754084-1754106 CCTGAAGTCCAGAGGACTCCAGG - Intergenic
968661962 4:1802354-1802376 TCTGAGGCCCAGAGGGGGCCTGG - Intronic
968746682 4:2364119-2364141 CCAGAAGGCCACAGTGAGCCTGG - Intronic
968890161 4:3364595-3364617 CCCGACGCTCAGAGGGAGCCAGG + Intronic
969578395 4:8049528-8049550 CCTGAATTCCAAAGGGAGGCGGG - Intronic
969856864 4:10007029-10007051 GGTGAAGTCCAGAGGAAACCAGG - Intronic
969859412 4:10023808-10023830 ACTGAAGTTCAGGGGGAGCATGG + Intronic
970169971 4:13279540-13279562 CCTGAAGTCCCAAGGGAGAGCGG + Intergenic
970348878 4:15181055-15181077 CAAGAAGTCCAGAGGTAGGCAGG + Intergenic
971689209 4:29811310-29811332 CCTGAAATCCAAAGGGAGGAAGG + Intergenic
971867226 4:32189217-32189239 CCACAGGTCCAGCGGGAGCCAGG + Intergenic
971970409 4:33612445-33612467 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
972322870 4:37988862-37988884 CCTGAATTCCAGAGAGAGGAAGG - Intronic
973217070 4:47681312-47681334 CCAGAAGAGCACAGGGAGCCAGG + Intronic
973785616 4:54330068-54330090 TCTGAATTCCAGAGGGAACAGGG - Intergenic
973975291 4:56256911-56256933 CCTGAATTCCAAAGGGAGAAAGG - Intronic
976152349 4:82104897-82104919 CCTGCCTTCAAGAGGGAGCCTGG + Intergenic
978802015 4:112764236-112764258 CATGAAAGCCAGAGGGGGCCGGG - Intergenic
982904493 4:161050402-161050424 GCTGAAGACCAGAGAGACCCTGG + Intergenic
983106831 4:163697046-163697068 AGTGAAGTCCAGAGGAAACCAGG + Intronic
984778816 4:183505743-183505765 CCCGCAGACCAGCGGGAGCCCGG - Intronic
985249207 4:188006529-188006551 CCTCAAGGCCAGAGGAAGTCAGG + Intergenic
985907515 5:2852569-2852591 CCAGAGTTCCAGAGGGAGCCTGG - Intergenic
986507958 5:8472363-8472385 AGTGAAGTCCAGAGGAAACCAGG - Intergenic
986519918 5:8604382-8604404 CGTGAAGTCCAGATGGACCATGG - Intergenic
986988202 5:13522630-13522652 ACTGAGGCCCAGAGGGAGCCAGG - Intergenic
987305199 5:16630919-16630941 CCTGAAGGCAATGGGGAGCCAGG + Intergenic
988679729 5:33473182-33473204 CCTGAATTCCAAAGGGAGGTGGG - Intergenic
989231528 5:39092721-39092743 AGTGAAGTCCAGAGGAAACCAGG + Intergenic
989359035 5:40578505-40578527 CCTGAAGCTAAGAGGGAGCGTGG + Intergenic
990115830 5:52389243-52389265 CCTGAACTACTGAAGGAGCCAGG + Intergenic
991434244 5:66580198-66580220 GCTGAAGTCTAGAGGAAGACTGG + Intergenic
992110480 5:73488014-73488036 CCTGAATTCCAGAGAGAGTAAGG + Intergenic
992911175 5:81397448-81397470 CCTGAACAGCAGAGGCAGCCGGG + Intergenic
993339137 5:86700971-86700993 CCTCAAGTCAAGATAGAGCCAGG + Intergenic
993669880 5:90747478-90747500 TGTAAAGTCCAGAGGAAGCCAGG + Intronic
993741121 5:91541008-91541030 CCTGAAATCCAGAGTCAACCAGG - Intergenic
993979535 5:94528522-94528544 CCAGAATTCCAGTGGGTGCCGGG + Intronic
994018292 5:94994219-94994241 CCTGAAGGCCTGAGTGAGGCTGG + Intronic
995422463 5:111982555-111982577 CCTAAAGTCTAGAGGTAGGCAGG + Intronic
996708169 5:126518118-126518140 CCTGAATTCCAGTGGGAGGAGGG - Intergenic
996998123 5:129724369-129724391 CCTGAATTCCAAAGGGAGGAGGG + Intronic
997961884 5:138328503-138328525 CCTGAAGTCCTGAAGAATCCAGG + Exonic
998379205 5:141712007-141712029 CCTGGAGGCCAGACAGAGCCTGG - Intergenic
999433567 5:151544521-151544543 CCCGGAGTCCAGAGGGACTCCGG - Exonic
1001050902 5:168413632-168413654 CATGAAGGCCAGAGCGAGCCAGG + Intronic
1001674577 5:173501323-173501345 CCCCAAGTCCAGAGAGAACCCGG + Intergenic
1002407268 5:179044898-179044920 CCTAAACTCCAGAGGGAGGAGGG + Intergenic
1003568876 6:7242948-7242970 CCTCAAGGGCAGAGGGGGCCAGG - Intronic
1004493296 6:16138829-16138851 CCTGGAGTGCAGAGGATGCCTGG - Intronic
1006296862 6:33173651-33173673 CCTGAGGTCCCCAGGGAGCCTGG - Intronic
1006297507 6:33176468-33176490 CCTGAGGTCCAGAGGGACCCTGG + Exonic
1006514387 6:34538026-34538048 CCTGGAGGACAGAGGGAGACAGG - Exonic
1006579955 6:35071491-35071513 CCTGAATTCCACAGGGAGGAGGG + Intronic
1006628704 6:35415912-35415934 GCTCAAGTCCAAAGGCAGCCTGG + Intronic
1006724317 6:36185885-36185907 AGTGAAGTCCAGAGGAAACCAGG + Intergenic
1007254339 6:40518111-40518133 ACTGAGGCCCAGAGGGAGCTAGG - Intronic
1007391362 6:41551351-41551373 CCTGATCTCAAGAGGGATCCTGG - Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1008274067 6:49523163-49523185 TGTAAAGTCCAGAGGAAGCCAGG + Intronic
1008824315 6:55674178-55674200 CCTGAAGTCCTGTGGGAGTCAGG - Intergenic
1009413812 6:63395025-63395047 CTTGGAGTCCTGAGGGACCCAGG - Intergenic
1011624054 6:89269226-89269248 AGTGAAGTCCTGTGGGAGCCGGG + Exonic
1013155365 6:107488359-107488381 CCAGGAGGCCAGAGCGAGCCAGG - Intergenic
1013490884 6:110645609-110645631 CCTGTAGTCCCGAGGGACCGAGG - Intronic
1013607347 6:111762459-111762481 CCTGAACTCCAAAGGGAGGAGGG - Intronic
1014242703 6:119035313-119035335 CCTGAATTCCAGTGGGAGGAGGG - Intronic
1014658405 6:124134958-124134980 CCTAAAGTCCAGAGGGATTGGGG + Intronic
1015571590 6:134626663-134626685 CTTGAATGCCAGAGAGAGCCAGG - Intergenic
1016199367 6:141388894-141388916 CCTGAATTCCAAAGGGAGAAGGG + Intergenic
1019034247 6:169041365-169041387 CCAGAAGCTGAGAGGGAGCCCGG - Intergenic
1019433543 7:1010615-1010637 CCTGCAGCCCAGGGGGAGCCAGG - Intronic
1019950071 7:4364974-4364996 CCTGAATTCCAGTGGGAGGAGGG - Intergenic
1020761190 7:12269693-12269715 CCCAAAGTCCAGAAGGGGCCTGG - Intergenic
1020782104 7:12530513-12530535 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1021234635 7:18127445-18127467 CCAGAAGTACAGAGGGAGCAGGG - Intronic
1022213021 7:28230297-28230319 CCTCAAGGCCAGAGGAAGGCAGG + Intergenic
1023327471 7:39075645-39075667 CCTGAAGGCCACAGGGAGGCTGG + Intronic
1023731208 7:43194108-43194130 CCTGAACTCCAAAGGGAGGAGGG + Intronic
1024034511 7:45495806-45495828 CCTGAATTCCAGAGGGAGGAGGG + Intergenic
1024451571 7:49551519-49551541 CCTGAAGTCCAGTCTGAACCTGG + Intergenic
1025005896 7:55354499-55354521 CCTGAATTCCAAAGGGAGGAAGG - Intergenic
1025034705 7:55586987-55587009 CCTGAGGTTCAGATGGACCCTGG - Intergenic
1026247424 7:68633662-68633684 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1027521501 7:79215135-79215157 CCTGAATTCCAAAGGGAGGTGGG - Intronic
1027620683 7:80481400-80481422 CCTGAATTCCAAAGGGAGGAGGG - Intronic
1029616241 7:101659870-101659892 CCTGAATTCCAAAGGGAGGTGGG + Intergenic
1030558099 7:111051977-111051999 CCTAAACTCCAAAGGGAGCATGG - Intronic
1031750666 7:125569074-125569096 CCAGAAGTTCAGAGGCAGCGGGG + Intergenic
1032817600 7:135493123-135493145 ACAGGAGTCAAGAGGGAGCCTGG - Intronic
1033234967 7:139630844-139630866 CTGGCAGTCCAGAGGGAGACAGG - Intronic
1033932972 7:146546992-146547014 CCTGAAGAAGAGAGGGAGACAGG + Intronic
1034109866 7:148526531-148526553 CCTGAACTCCAAAGGGAGGAAGG - Intergenic
1034284872 7:149878180-149878202 CCTGAAGAACAGAGGTGGCCTGG + Intronic
1034354851 7:150444040-150444062 CCTAGACTCCAGAGGGACCCTGG + Intergenic
1034678689 7:152911408-152911430 CCTGAACTTCAGAAAGAGCCAGG + Intergenic
1034895999 7:154876759-154876781 CCTGAAGGCCAGCTGCAGCCTGG - Intronic
1035296180 7:157867976-157867998 CCTGCTGTCCAGAGGAAGTCTGG - Intronic
1035930761 8:3777548-3777570 CCTGTGGACTAGAGGGAGCCTGG - Intronic
1036127773 8:6079127-6079149 CCTGAAGGTGAGAAGGAGCCAGG + Intergenic
1036201769 8:6776228-6776250 GCTGAAGTCCAGAGAGCCCCTGG + Intergenic
1036284307 8:7430356-7430378 CCTGGAGTCCAGAGAGCACCCGG - Intergenic
1036337169 8:7881174-7881196 CCTGGAGTCCAGAGAGCACCCGG + Intergenic
1036434583 8:8722031-8722053 ACTGAAGTCCAGAGAGAGGAAGG - Intergenic
1036636657 8:10555255-10555277 CCTGAATTCCAAAGGGAGGAGGG - Intergenic
1037447213 8:18978075-18978097 CCTAAAGTCAGGTGGGAGCCTGG - Intronic
1037824268 8:22151675-22151697 ACTGAAGACCAGAGGGAGAAGGG + Intronic
1038533721 8:28339073-28339095 CATGGAGTCCAGAGGGGGCTGGG - Exonic
1042864990 8:73349270-73349292 CCAGAAGTCCTAAGGGAGTCAGG + Intergenic
1043012732 8:74900834-74900856 CCTGAGGGCCAAAGGGACCCTGG + Intergenic
1043082601 8:75784807-75784829 CCCAAAGTCCAGAGGGGGCCAGG + Intergenic
1043444381 8:80304898-80304920 CCTGAAGTCTTAAGGGATCCAGG + Intergenic
1043977327 8:86598054-86598076 CCTGAAGTAGAGAGGTAGGCAGG + Intronic
1044198683 8:89409020-89409042 TCTGAAGCCCTGAGGGAGCCAGG - Intergenic
1045290827 8:100831260-100831282 CCTGAACTCCAAAGGGAGGAGGG + Intergenic
1045665769 8:104482842-104482864 CTAGAAGTCCAGAGATAGCCAGG + Intergenic
1046482370 8:114839086-114839108 CATGAAGTCCAGTGGAAGCTGGG - Intergenic
1048247075 8:132817378-132817400 ACTTAAGTCAAGAGGGAGACAGG - Exonic
1048759027 8:137771025-137771047 CATGAATTCCACAGGTAGCCTGG - Intergenic
1048800573 8:138190362-138190384 CCTGAATTCCAAAGGGAGGAAGG - Intronic
1049189311 8:141278212-141278234 CCTGCAGCACATAGGGAGCCTGG + Intronic
1049250847 8:141588242-141588264 CCTGATGGACAGAGTGAGCCAGG + Intergenic
1049460439 8:142724898-142724920 CCTGAAATCCAAAGGGAGGAGGG - Intergenic
1049510541 8:143024754-143024776 CCCGAGGTCCAGAAGCAGCCTGG - Intergenic
1049540851 8:143208138-143208160 CCTGATGTGCAGAGGCTGCCAGG + Intergenic
1049815654 8:144598108-144598130 GGGGAAGTCCAGAGGGCGCCCGG + Intronic
1049959145 9:721683-721705 CCTGAAGCCTTGAGGGACCCAGG - Intronic
1049959846 9:727985-728007 CCTGAATTCCAAAGGGAGGAGGG - Intronic
1050206086 9:3197731-3197753 CACAAAGTGCAGAGGGAGCCAGG + Intergenic
1050586449 9:7116769-7116791 CCTGAAGTCCAGAGAAACCTAGG + Intergenic
1053429428 9:38032408-38032430 CCTGTTGCCCAGAAGGAGCCTGG - Intronic
1053645615 9:40118069-40118091 CCTGGTGTCCACATGGAGCCTGG - Intergenic
1053645629 9:40118140-40118162 CCTGATGTACACATGGAGCCTGG - Intergenic
1053688372 9:40566088-40566110 CCTTAAATCCAGAGTGGGCCGGG - Intergenic
1053760080 9:41345369-41345391 CCTGATGTACACATGGAGCCTGG + Intergenic
1053760095 9:41345440-41345462 CCTGGTGTCCACATGGAGCCTGG + Intergenic
1053939736 9:43221564-43221586 CCTTAAATCCAGAGTGGGCCGGG - Intergenic
1054275658 9:63064962-63064984 CCTTAAATCCAGAGTGGGCCGGG + Intergenic
1054299613 9:63366999-63367021 CCTTAAATCCAGAGTGGGCCGGG - Intergenic
1054326630 9:63715970-63715992 CCTGGTGTCCACATGGAGCCTGG - Intergenic
1054326644 9:63716041-63716063 CCTGATGTACACATGGAGCCTGG - Intergenic
1054349915 9:64012198-64012220 CCTGATGTCCAGCTGGGGCCTGG - Intergenic
1054399175 9:64699967-64699989 CCTTAAATCCAGAGTGGGCCGGG - Intergenic
1054432753 9:65184233-65184255 CCTTAAATCCAGAGTGGGCCGGG - Intergenic
1054497632 9:65837443-65837465 CCTTAAATCCAGAGTGGGCCGGG + Intergenic
1054538944 9:66257832-66257854 CCTGATGTACACATGGAGCCTGG + Intergenic
1054538958 9:66257903-66257925 CCTGGTGTCCACATGGAGCCTGG + Intergenic
1056187633 9:84151312-84151334 CCGAAAGTCCATAGGTAGCCAGG + Intergenic
1056955977 9:91081602-91081624 CCTGAATTCCAAAGGGAGGAAGG + Intergenic
1057192174 9:93094397-93094419 CCTGGAGGCCAGAGCCAGCCTGG + Intergenic
1057918079 9:99072755-99072777 CATGAAGTCCAGGAGGAGACGGG - Intergenic
1058269447 9:102951827-102951849 CCTGTAGTCCCGAGTGAGGCAGG + Intergenic
1059438995 9:114292172-114292194 CCTGGAAACCAGGGGGAGCCTGG + Exonic
1060515509 9:124263313-124263335 CCTGAGGCTCAGAGGGAGCAAGG + Intronic
1060775582 9:126371419-126371441 CCTGATGGCCGAAGGGAGCCAGG - Intronic
1061221914 9:129257140-129257162 CCTGGAGGCCAGAAGGAGCTTGG - Intergenic
1062527482 9:136983863-136983885 CACGGAGTCCAGAGGGACCCAGG + Intronic
1202793406 9_KI270719v1_random:101542-101564 CCTGGTGTCCACATGGAGCCTGG - Intergenic
1202793419 9_KI270719v1_random:101613-101635 CCTGATGTACATATGGAGCCTGG - Intergenic
1185788665 X:2911782-2911804 CCTGAATTCCAAAGGGAGGAGGG - Intronic
1186811922 X:13198672-13198694 CCTGAACTCCAAAGGGAGGAGGG - Intergenic
1187473261 X:19588178-19588200 AGTGAAGAGCAGAGGGAGCCTGG + Intronic
1188521501 X:31043217-31043239 CCTGAATTCCAAAGGGAGTAGGG + Intergenic
1189176201 X:38959883-38959905 CCTGAATTCCAAAGGGAGGAGGG + Intergenic
1189522011 X:41779356-41779378 GCTGAAGTCCAGGGGAAACCAGG - Intronic
1190411399 X:50140434-50140456 CTTCAAGTCCAGAGGGAACAAGG - Intergenic
1190687989 X:52891223-52891245 CCTGAATTCCATAGGGAGAAGGG + Intergenic
1190697993 X:52964569-52964591 CCTGAATTCCATAGGGAGAAGGG - Intronic
1190743506 X:53306335-53306357 CCAGGGGTCCAGAGGGAGGCAGG + Intronic
1191914600 X:66188048-66188070 CTTGAAGACCAGAGGGTGGCAGG + Intronic
1192554288 X:72077716-72077738 CCTCCAGCCCAGAGGGATCCGGG + Intergenic
1193181101 X:78457315-78457337 CCAGAAGTCTTGAGGGATCCAGG + Intergenic
1199721312 X:150544559-150544581 CCTGGAGTCCAGAGGGGCCAGGG - Intergenic
1200106341 X:153715355-153715377 CCTGACCTCCAGAGGCAGCGTGG - Intronic
1200135678 X:153873495-153873517 CATGTAGCCCAGAGGCAGCCAGG + Intronic
1201149860 Y:11089782-11089804 CCTGGTGTCCACATGGAGCCTGG + Intergenic
1202125964 Y:21569159-21569181 CCTGAAATCCAGAGTTTGCCAGG - Intergenic