ID: 1077079805

View in Genome Browser
Species Human (GRCh38)
Location 11:720230-720252
Sequence TCCCTGTCCCCCGTGGCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077079805_1077079812 -1 Left 1077079805 11:720230-720252 CCCAGCGCCACGGGGGACAGGGA 0: 1
1: 0
2: 0
3: 6
4: 146
Right 1077079812 11:720252-720274 AGCACAGTGGGTAGAGGCGGTGG 0: 1
1: 0
2: 3
3: 21
4: 334
1077079805_1077079813 9 Left 1077079805 11:720230-720252 CCCAGCGCCACGGGGGACAGGGA 0: 1
1: 0
2: 0
3: 6
4: 146
Right 1077079813 11:720262-720284 GTAGAGGCGGTGGCAGCCACCGG 0: 1
1: 0
2: 1
3: 18
4: 216
1077079805_1077079810 -7 Left 1077079805 11:720230-720252 CCCAGCGCCACGGGGGACAGGGA 0: 1
1: 0
2: 0
3: 6
4: 146
Right 1077079810 11:720246-720268 ACAGGGAGCACAGTGGGTAGAGG 0: 1
1: 0
2: 0
3: 34
4: 367
1077079805_1077079817 28 Left 1077079805 11:720230-720252 CCCAGCGCCACGGGGGACAGGGA 0: 1
1: 0
2: 0
3: 6
4: 146
Right 1077079817 11:720281-720303 CCGGCTGCAGCCCGGATGTGCGG 0: 1
1: 0
2: 0
3: 23
4: 170
1077079805_1077079814 20 Left 1077079805 11:720230-720252 CCCAGCGCCACGGGGGACAGGGA 0: 1
1: 0
2: 0
3: 6
4: 146
Right 1077079814 11:720273-720295 GGCAGCCACCGGCTGCAGCCCGG 0: 1
1: 0
2: 1
3: 33
4: 340
1077079805_1077079811 -4 Left 1077079805 11:720230-720252 CCCAGCGCCACGGGGGACAGGGA 0: 1
1: 0
2: 0
3: 6
4: 146
Right 1077079811 11:720249-720271 GGGAGCACAGTGGGTAGAGGCGG 0: 1
1: 0
2: 4
3: 48
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077079805 Original CRISPR TCCCTGTCCCCCGTGGCGCT GGG (reversed) Intronic
900652313 1:3735717-3735739 TGCCTGTCCCCCTTGGCCCCAGG - Exonic
901766560 1:11503560-11503582 TCTCTTTCCCCCCTGGAGCTGGG - Intronic
902710663 1:18237503-18237525 CTTCTGTCCCCCGTGGCGCAGGG + Intronic
903275691 1:22219924-22219946 TACCTGCCTCCCGTGGCTCTGGG - Intergenic
904008803 1:27378358-27378380 GCCCTTTCCCCCTTGGCGCGGGG + Intergenic
905168912 1:36098698-36098720 CCCCTGTCCCCCTTGGGGCCTGG + Exonic
905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG + Intergenic
905891622 1:41521830-41521852 TCTCTGTCCCCTGAGGCGATCGG + Intronic
907269144 1:53280483-53280505 GCCCAGTTCCCCGTGGGGCTTGG - Intronic
911144759 1:94541668-94541690 TCCGTGGCGCCCGTGGGGCTGGG + Exonic
915510482 1:156384442-156384464 CCCCTGTGCCCTGTGGCACTGGG + Intronic
915981090 1:160420347-160420369 TCCCTTTCCCCTGTGCCCCTTGG + Intronic
920387388 1:205578624-205578646 CCCCTGACCCCCTTGGCTCTTGG - Intronic
921776854 1:219111682-219111704 TCCCAGTCCCCAGTGGCTCCAGG + Intergenic
924502928 1:244653400-244653422 TTCCTCTCGCCCGTGGGGCTCGG + Intronic
1063165207 10:3455433-3455455 TCCCTGTTCACCGTGCCCCTTGG + Intergenic
1065380328 10:25083728-25083750 TCCTTGTGCCCCCTGGCACTTGG + Intergenic
1068128017 10:52865407-52865429 CCCCTGTCCGAGGTGGCGCTGGG - Intergenic
1069823890 10:71243620-71243642 TCCCTGTTCCCCGGGGGGCTTGG + Intronic
1076680809 10:132170282-132170304 TCCCTGTCCCCAGCCGCCCTCGG - Intronic
1077033224 11:479633-479655 ACCCCGTCCCTCTTGGCGCTGGG - Intronic
1077079805 11:720230-720252 TCCCTGTCCCCCGTGGCGCTGGG - Intronic
1077323277 11:1952006-1952028 TCCCTGCCCCCTGTGGGTCTTGG + Intronic
1077494914 11:2882263-2882285 TCCCTGCCCCCGGTGGAGGTGGG + Intergenic
1083745762 11:64735710-64735732 TCTCTGTTCCCCGGGGCTCTGGG - Intronic
1083949419 11:65945856-65945878 TCCCTGACCCACCTGGCTCTAGG - Intronic
1084512006 11:69611892-69611914 TCCCTGTCCCTCTTGCCGCGAGG - Intergenic
1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG + Intronic
1085313243 11:75528464-75528486 TCCATGACCCCTGAGGCGCTGGG + Intergenic
1085880460 11:80462250-80462272 TCCCTGTCCCTCCTGCCCCTGGG - Intergenic
1088702607 11:112426737-112426759 TCCCTGACCCCCGTGCCTCCTGG + Intergenic
1089294744 11:117460900-117460922 TCCCTCTCCCCCTTGGCCTTAGG + Intronic
1202806265 11_KI270721v1_random:7201-7223 TCCCTGCCCCCTGTGGGTCTTGG + Intergenic
1091901261 12:4145819-4145841 TCCCTATCCCCTGTAGCTCTAGG - Intergenic
1091920965 12:4304127-4304149 GCCCTGTCCCCTGTGGCCCATGG - Exonic
1092129154 12:6096416-6096438 TCCCTGTGCCCCATGGCACCTGG + Intronic
1092537364 12:9402832-9402854 CCTCTTTCCCCCGTGGCTCTTGG + Intergenic
1104038358 12:125114063-125114085 TCCCTGTCCCTCATGAGGCTGGG + Intronic
1104763529 12:131312439-131312461 TCCGTGCCCACCGTGGTGCTGGG - Intergenic
1104815973 12:131645638-131645660 TCCGTGCCCACCGTGGTGCTGGG + Intergenic
1105322722 13:19344476-19344498 CCCCTGTCCCCGAGGGCGCTGGG - Intergenic
1105874893 13:24542239-24542261 CCCCTGTCCCCGAGGGCGCTGGG + Intergenic
1108441326 13:50456266-50456288 TCCTTGTCCACTGTGGCTCTTGG + Intronic
1110567239 13:76968530-76968552 CCCCTGACCCACGTGGCTCTCGG + Intergenic
1119432290 14:74576123-74576145 ACCCTGTGCCCCTTGGCCCTGGG - Intronic
1119612861 14:76078586-76078608 TCTCTGTCCCACGTGGGGCCTGG - Intronic
1121803607 14:96795797-96795819 TCCCTGTGCCCCCTGGCTTTGGG - Intergenic
1122599657 14:102914963-102914985 TCCCTGGCCCCTGTGGCACTTGG + Intergenic
1122943056 14:104991668-104991690 TCACTGTCACCAGTGGCCCTTGG + Intronic
1122980882 14:105191974-105191996 TCCCAGCCCCCCATGGAGCTGGG + Intergenic
1124026733 15:25973809-25973831 TCCCTGTCCCCAGTGTGGCCAGG - Intergenic
1124914634 15:33957908-33957930 TCCCTGAACCCAGTGGCACTTGG + Intronic
1129613763 15:77082092-77082114 TCCCTGTCCCCAGTACTGCTGGG - Intronic
1130073677 15:80670673-80670695 TCCCTGTCTCCTGTATCGCTGGG - Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132870010 16:2111772-2111794 TCCCTGCCCTCCGTGGCTGTGGG - Exonic
1133217418 16:4301376-4301398 TCTCAGTCTCCCGTGGAGCTGGG + Intergenic
1134593317 16:15475057-15475079 TCACTTTCCCCCTTGGTGCTGGG + Intronic
1139632110 16:68237091-68237113 TCCCTTTGCCCAGTGGAGCTTGG + Intronic
1141407700 16:83808271-83808293 ACCTTGACCCCCGGGGCGCTCGG + Intronic
1141831014 16:86510090-86510112 TCCCCGCCGCCCGCGGCGCTCGG - Intergenic
1142567564 17:850575-850597 TCACTGTCTCCAGTGGGGCTGGG + Intronic
1145883765 17:28369207-28369229 TCCCTGTCCACCCTGTCCCTGGG + Intronic
1145939264 17:28733961-28733983 TCCCTGTCCTCCGTATCCCTAGG + Exonic
1147429698 17:40363802-40363824 GCCCACTCCCCCATGGCGCTGGG + Exonic
1151482639 17:74379496-74379518 TCCCTGGCCTCCTTGTCGCTGGG + Intergenic
1151784081 17:76266429-76266451 TTCCTGTTCCCTGTAGCGCTGGG - Intronic
1157555317 18:48609762-48609784 TCCCTGTCCCTGGTGCCTCTAGG + Intronic
1159065652 18:63565361-63565383 CCCCTGTCCTCCGTGAAGCTGGG + Intronic
1160420570 18:78741084-78741106 TCTCTGTCCCCCGTGGCTCCGGG - Intergenic
1160488110 18:79311918-79311940 TCTCTGTCCCCGGTGTGGCTGGG + Intronic
1160566314 18:79788497-79788519 TCCTTCTCCACGGTGGCGCTGGG + Intergenic
1161352076 19:3799132-3799154 TCCCTGCCCTCCATGGCGCCTGG + Intronic
1161384339 19:3983018-3983040 GCCCTGTCCCCCGTGTCCCCAGG - Exonic
1161687015 19:5707913-5707935 TCCCTGTCCCCTGTAGCTATGGG + Intronic
1163334188 19:16660718-16660740 CCCCTGTTCCCCGTGGAGATAGG - Intergenic
1166980921 19:46631638-46631660 TCCCTGTCCCCCGTCTCCCCCGG + Intergenic
1167348892 19:48963044-48963066 TCCCTGTCCCCCCTCTCTCTGGG + Intergenic
926483389 2:13427253-13427275 TCCCTGGCCCCCGTGCCTCCTGG - Intergenic
926521108 2:13915099-13915121 TCCCTCTTCCCCATGGCCCTTGG - Intergenic
927208308 2:20623869-20623891 CACCTGTCCCCAGCGGCGCTTGG - Intronic
932646722 2:73510675-73510697 TCCCTGACCCCCGTGCCTCCTGG - Intronic
933788576 2:85864831-85864853 TCCCAGTCTCCCTTGGAGCTAGG + Intronic
936006945 2:108897566-108897588 ACCCTGTCTCCCATGGGGCTGGG + Intronic
936242020 2:110795997-110796019 ACACTGTCTCCCGTGGGGCTGGG + Intronic
937305695 2:120869163-120869185 TCCCTGTCCCCACTGGGGCCAGG - Intronic
937789758 2:125945705-125945727 TCCCTGTCCCCCAGGGTGCAGGG - Intergenic
947841132 2:233208615-233208637 TCTCTCTCCACCGTGGCCCTTGG - Intergenic
948486742 2:238286161-238286183 TCCCTGACCACCGGGGAGCTAGG - Intronic
948718347 2:239880661-239880683 TCCCTCTCCCCAGGGGCACTTGG - Intergenic
1175860702 20:62148672-62148694 CCCACCTCCCCCGTGGCGCTTGG - Intronic
1175949353 20:62574959-62574981 TGCCTGTCCCCCGGGCAGCTTGG - Intergenic
1176100288 20:63361501-63361523 TCCCCGTCCCCCTGGGCGCGCGG - Intronic
1177515034 21:22138482-22138504 TCCCAGGCCGCCGTGGCGCGGGG + Intergenic
1180994718 22:19959793-19959815 TCCCCATCCCCCATGGCTCTTGG + Intronic
1183553215 22:38505678-38505700 TCCCGATCCCCCGCGGGGCTGGG + Intronic
1183628738 22:39020698-39020720 TCCCTGTCCCCATGGCCGCTGGG + Intronic
1183632215 22:39040457-39040479 TCCCTGTCCCCATGGCCGCTGGG + Intergenic
1183638037 22:39076858-39076880 TCCCTGTCCCCATGGCCGCTGGG + Intronic
1184474339 22:44712430-44712452 TCCCTGTCCTCGCTGGCGCAGGG - Intronic
1185270994 22:49929305-49929327 TCCCCGTCCCCCGTGTCCCGCGG - Intergenic
959479422 3:106853565-106853587 TCCCTGACCCCTGTGCCTCTTGG + Intergenic
963078157 3:141367266-141367288 ACTCTGTACCCCGTGGCTCTCGG + Intronic
968473375 4:791930-791952 TCCCTGTGCCTCGTGCCCCTCGG + Intronic
968565072 4:1307777-1307799 TTCCTGTCCCTCCTGGAGCTGGG - Intronic
968636937 4:1685391-1685413 CCCCTGGCCACCGTGGGGCTCGG + Intergenic
969687064 4:8681602-8681624 TCCCCACCCCCCATGGCGCTGGG - Intergenic
978994418 4:115131744-115131766 TCCCTGCCTCCTGTGGTGCTGGG - Intergenic
980310903 4:131127726-131127748 GCCCTCACCCCCGTGGCTCTAGG - Intergenic
981273237 4:142868396-142868418 TCCCTGACCCCCGTGTCTCCTGG + Intergenic
985801894 5:2010021-2010043 TCCCTGTCCAGCCTGGTGCTGGG + Intergenic
991324519 5:65415927-65415949 TCCCTGTGCCCAGGGGCACTGGG + Intronic
992388912 5:76312568-76312590 TACCCCTCCTCCGTGGCGCTCGG + Intronic
994185026 5:96807549-96807571 TCCCTGTCCCTCCGGGCGCGTGG - Intronic
1001942520 5:175750724-175750746 TCCCTGCCGCCCGGGGTGCTGGG - Intergenic
1002593561 5:180307133-180307155 TGCCTGTCCTCCGTGGGGGTGGG + Intronic
1006091710 6:31632322-31632344 CCTCTGTCCCCTGTGGCGCGCGG + Exonic
1006151489 6:31992458-31992480 TCCCTAGCCCTGGTGGCGCTGGG + Exonic
1006157790 6:32025196-32025218 TCCCTAGCCCTGGTGGCGCTGGG + Exonic
1006809556 6:36811069-36811091 TCCCCGTTCCCCGAGGAGCTGGG - Intronic
1007227454 6:40325124-40325146 TCACTGTCCCACTTGGCTCTTGG - Intergenic
1016314496 6:142771294-142771316 TCCTTGTCCCCCGCTGAGCTCGG - Exonic
1017853018 6:158322001-158322023 TGCCAGTCCCCAGTGGCTCTGGG - Intronic
1018686505 6:166308045-166308067 TTCTTGTCCCCCGCGGCGCAGGG + Exonic
1021279795 7:18703766-18703788 TCCCTGTCCCCCAGGGCCCTGGG + Intronic
1022471980 7:30687716-30687738 TCCCTGTCTCCCTTGGCGGATGG - Intronic
1025020523 7:55476334-55476356 CCCCTGGCACCCGTGGGGCTGGG - Intronic
1033781845 7:144680266-144680288 TCTCTGTCCCTCATGGAGCTAGG - Intronic
1034238547 7:149591903-149591925 ACCCTGTCCCCGGTGGGCCTGGG + Intergenic
1035104460 7:156430288-156430310 TCCCTCTCCCCAGTGGCGCCAGG + Intergenic
1037811547 8:22089630-22089652 TTCCTGCCCCCCGGGGCCCTAGG + Intronic
1038041356 8:23726857-23726879 ACTCTGTCCCCCATGGGGCTGGG + Intergenic
1039084630 8:33767602-33767624 TCCCTGTCTCACATGGCCCTAGG - Intergenic
1042532925 8:69833226-69833248 ACCCTGGTCCCCGGGGCGCTGGG - Intronic
1046985277 8:120381127-120381149 CCACTGTCCGCCGTGGCTCTGGG + Intronic
1047750482 8:127876742-127876764 CTCCTGTCCTCCGTGGCGCTTGG + Intergenic
1049289071 8:141791992-141792014 TCCCTGTCCCCTGATGAGCTGGG + Intergenic
1049362617 8:142219543-142219565 TCCCTGTGGCCCATGGCCCTGGG - Intronic
1049621475 8:143600126-143600148 GCTCTGGCCCCCGTGGGGCTGGG + Exonic
1050985077 9:12071945-12071967 TCCCAGTCTCCCGAGGAGCTGGG + Intergenic
1053042226 9:34884619-34884641 TCCCTCTCCTCTGTGGGGCTTGG - Intergenic
1054812776 9:69447868-69447890 TCCCTGCCCCCCAGGGAGCTTGG - Intronic
1060194373 9:121613947-121613969 GCCCTGTCCCTCATGGCTCTAGG + Intronic
1061042121 9:128146316-128146338 TCCCTGGACCCCGGGGCTCTTGG - Intergenic
1061473908 9:130850053-130850075 TCCCTGTGCCCCATGGCACATGG + Intronic
1061502664 9:131012869-131012891 TCCCAGCCCCCCGTGGCTCCTGG + Intronic
1061975585 9:134066907-134066929 TCCCTGCCCCCGGTGGGTCTCGG + Intronic
1187868370 X:23743776-23743798 TGCCTGTCCCCCGAGTAGCTGGG - Intronic
1192168819 X:68841945-68841967 TCCCTCTCCCACCTGGCACTGGG - Exonic
1192248781 X:69393949-69393971 CTCCTGTCCCCCATGGAGCTTGG - Intergenic
1195687570 X:107600588-107600610 GTCCTGGCCCCCCTGGCGCTCGG + Exonic
1198747730 X:139907244-139907266 TCCCTGTCTCCCTTGTGGCTAGG + Intronic
1199425341 X:147693960-147693982 TCACTGTCCCCTATGGGGCTGGG - Intergenic