ID: 1077080759

View in Genome Browser
Species Human (GRCh38)
Location 11:723767-723789
Sequence CTTTGGAAACAGGTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 454}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077080759_1077080769 7 Left 1077080759 11:723767-723789 CCCAGCCCCACCTGTTTCCAAAG 0: 1
1: 1
2: 0
3: 29
4: 454
Right 1077080769 11:723797-723819 AGAACAAGCCTATGGCACTAGGG 0: 1
1: 0
2: 1
3: 11
4: 97
1077080759_1077080770 8 Left 1077080759 11:723767-723789 CCCAGCCCCACCTGTTTCCAAAG 0: 1
1: 1
2: 0
3: 29
4: 454
Right 1077080770 11:723798-723820 GAACAAGCCTATGGCACTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 69
1077080759_1077080768 6 Left 1077080759 11:723767-723789 CCCAGCCCCACCTGTTTCCAAAG 0: 1
1: 1
2: 0
3: 29
4: 454
Right 1077080768 11:723796-723818 AAGAACAAGCCTATGGCACTAGG 0: 1
1: 0
2: 1
3: 11
4: 144
1077080759_1077080767 -1 Left 1077080759 11:723767-723789 CCCAGCCCCACCTGTTTCCAAAG 0: 1
1: 1
2: 0
3: 29
4: 454
Right 1077080767 11:723789-723811 GAGGACAAAGAACAAGCCTATGG 0: 1
1: 0
2: 1
3: 29
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077080759 Original CRISPR CTTTGGAAACAGGTGGGGCT GGG (reversed) Intronic
900923936 1:5691458-5691480 TTTTGGGAACAGGTGGTGTTTGG - Intergenic
901636462 1:10672500-10672522 CTTTGAAAACAGATTGGGCCCGG - Intronic
901757773 1:11451725-11451747 CTCTGGAGCCAGGTGGGCCTGGG + Intergenic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
902372687 1:16015993-16016015 CATGGGGAAGAGGTGGGGCTTGG + Intronic
902461265 1:16578982-16579004 GTTTGCAATCAGGTGGGGGTGGG - Intronic
902462050 1:16585278-16585300 GTTTGCAATCAGGTGGGGGTGGG - Intronic
902462816 1:16591636-16591658 GTTTGCAATCAGGTGGGGGTGGG - Intronic
902696752 1:18145462-18145484 CATGGGAACCAGGAGGGGCTGGG - Intronic
902697503 1:18150255-18150277 TTTTGGAACCAGGTTGAGCTGGG + Intronic
902775881 1:18674651-18674673 CTTTGGAGCCACGAGGGGCTAGG + Intronic
903291025 1:22314361-22314383 CTTTGGAAACAGGTGGATTGAGG + Intergenic
903318185 1:22525248-22525270 TTTGGGGAAAAGGTGGGGCTGGG + Intronic
903927589 1:26841657-26841679 CTTTGGAAAGAGCTGCTGCTGGG + Intronic
904389651 1:30173861-30173883 CTTTGGAAGGGGGTGGGGCAGGG - Intergenic
905591585 1:39168454-39168476 CTTTGGATCCAGGCAGGGCTGGG + Intronic
905866587 1:41380300-41380322 CTATGGAAACAGCAGGGGCTTGG - Intronic
906206697 1:43991026-43991048 CATGGGAGGCAGGTGGGGCTTGG + Exonic
906253923 1:44332830-44332852 CTTTGGAAGGAGGAGGGGCAAGG + Intronic
906688849 1:47779598-47779620 CTCTGGACACAGGAGGTGCTGGG + Intronic
908654334 1:66371986-66372008 CTTTGGAATCAGATGAAGCTGGG + Intronic
910355080 1:86344050-86344072 CTTGGGGAACAGGTGGTGTTTGG + Intergenic
910373755 1:86546767-86546789 TTTGGGTAACAGGTGGGGTTTGG - Intergenic
910387201 1:86697994-86698016 TTTGGGTAACAGGTGGGGTTTGG + Intergenic
910876511 1:91883947-91883969 CTTAGGAAACAGCTTGGGGTTGG - Intronic
911585443 1:99684892-99684914 CTGTGGAATCAGGTGGACCTGGG - Intronic
912388861 1:109287718-109287740 TTTGGGGAACAGGTGGGGTTTGG + Intergenic
912525736 1:110281324-110281346 CTTTGGAAACAGGTGTAGGGTGG - Intronic
912575790 1:110672100-110672122 CTGTGGAAACGGCAGGGGCTGGG + Intergenic
912952316 1:114128408-114128430 CTTAGGGAAAAGTTGGGGCTGGG - Intronic
913641026 1:120812284-120812306 GTTTGCAATCAGGTGGGGGTGGG + Intronic
914084386 1:144439618-144439640 GTTTGCAATCAGGTGGGGGTGGG - Intronic
914277456 1:146138025-146138047 GTTTGCAATCAGGTGGGGGTGGG - Intronic
914364584 1:146966862-146966884 GTTTGCAATCAGGTGGGGGTGGG + Intronic
914365350 1:146973149-146973171 GTTTGCAATCAGGTGGGGGTGGG + Intronic
914487097 1:148120290-148120312 GTTTGCAATCAGGTGGGGGTGGG - Intronic
914538503 1:148588973-148588995 GTTTGCAATCAGGTGGGGGTGGG - Intronic
914587431 1:149075444-149075466 GTTTGCAATCAGGTGGGGGTGGG - Intronic
918040575 1:180912124-180912146 GCTTGGAAATAGGTGAGGCTCGG + Intergenic
918340670 1:183565731-183565753 CTTTGGAACTAGGAGGAGCTGGG + Exonic
919460942 1:197876058-197876080 CTTTTTAAAGAAGTGGGGCTGGG - Intergenic
921843360 1:219852961-219852983 TTTTGGAAACAGGTGGTTTTTGG - Intronic
923818043 1:237402635-237402657 ATTGGGAAACAGGCTGGGCTTGG + Intronic
1063182846 10:3621623-3621645 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1063217308 10:3936566-3936588 CTTTGCCTTCAGGTGGGGCTGGG + Intergenic
1066331256 10:34425685-34425707 CTGTGAAAATAGGTGGCGCTGGG + Intronic
1067479292 10:46584867-46584889 CTCGGGAAACAGGAGGGGCAGGG - Intronic
1067543568 10:47175643-47175665 GTTTGGAGACAGGCAGGGCTAGG - Intergenic
1067615447 10:47756934-47756956 CTCGGGAAACAGGAGGGGCAGGG + Intergenic
1067745236 10:48930564-48930586 CTCTGGGAAGAGGTGGGACTAGG + Intronic
1067946036 10:50688477-50688499 CTCTGGGAACAAGTGCGGCTGGG + Intergenic
1068983234 10:63083394-63083416 TTTTGGGAACAGGTGGTGTTTGG - Intergenic
1069293760 10:66817185-66817207 TTTGGGAAACAGGTGGTGTTTGG - Intronic
1070629298 10:78073339-78073361 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1071147048 10:82588096-82588118 CTTTGGAACCAGGAGGTCCTGGG - Intronic
1071468743 10:85963578-85963600 CTTTGGAATCAGGTTGGGCGTGG - Intronic
1073150605 10:101308851-101308873 AGCTGGAAACATGTGGGGCTTGG + Intergenic
1073393464 10:103198549-103198571 CTTTGGAACAAGGTGTGGGTGGG - Intergenic
1073559963 10:104488165-104488187 CTTTGGAAGCAGCCAGGGCTTGG + Intergenic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075506595 10:123028372-123028394 CTTTGAAAACAGGCTGGGCATGG + Intronic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1076197481 10:128529772-128529794 CCTTGGAAGCAGGTGAGCCTCGG + Intergenic
1076544183 10:131232832-131232854 GATTGGAAACAGGTGGGGTTGGG - Intronic
1076561117 10:131364897-131364919 CTTTGGACACAGGTGGGGTCAGG + Intergenic
1077080759 11:723767-723789 CTTTGGAAACAGGTGGGGCTGGG - Intronic
1077494479 11:2880254-2880276 CCTTTAAAACAGGAGGGGCTAGG - Intergenic
1077674124 11:4182285-4182307 CCTTGGACACATGTGGTGCTTGG - Intergenic
1077881962 11:6357952-6357974 CTGAGGAAAGAGGTGGGGATAGG + Intergenic
1078868078 11:15316973-15316995 CTTTGGAATCAGATAGGCCTGGG + Intergenic
1078903218 11:15660929-15660951 CTATGGGAAGAGCTGGGGCTGGG - Intergenic
1079854912 11:25590800-25590822 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1080290842 11:30669903-30669925 CTGTAGCAAAAGGTGGGGCTAGG - Intergenic
1080886173 11:36370128-36370150 CATAGGAAACAGGTGGGGTGGGG - Intronic
1081649014 11:44810897-44810919 AATTGAAAACAGGTTGGGCTTGG - Intronic
1081656267 11:44859527-44859549 CTTTGGAGGCAGGTGGACCTTGG - Intronic
1082832013 11:57625509-57625531 CTCTGGAGACTGGTGGAGCTAGG + Intergenic
1083774947 11:64889990-64890012 TATAAGAAACAGGTGGGGCTGGG + Intergenic
1083813370 11:65117813-65117835 CTAGGGAAAGGGGTGGGGCTTGG - Intergenic
1084449097 11:69222292-69222314 CTTTAAAAACATTTGGGGCTGGG + Intergenic
1086298070 11:85394024-85394046 TTTGGGGAACAGGTGGAGCTTGG - Intronic
1086844891 11:91736555-91736577 TTTGGGAAACAGGTGGTGCTTGG - Intergenic
1088872179 11:113900282-113900304 ATTTGGAATCATGAGGGGCTAGG - Intergenic
1089077173 11:115747516-115747538 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1090667759 11:128926111-128926133 CTTGGGACACAGAAGGGGCTTGG - Intergenic
1090736341 11:129614814-129614836 CTTTGCAGACAAGTGGGGCTGGG - Intergenic
1090804125 11:130191883-130191905 CTTTCGGAGGAGGTGGGGCTGGG + Intronic
1090850059 11:130564148-130564170 CTTTGGTAGCAGGTGAGGCAAGG + Intergenic
1091023499 11:132122182-132122204 CTTTGGGAAGATGTAGGGCTGGG + Intronic
1091437153 12:481674-481696 CTTTGCCAACAGCTGTGGCTGGG + Intronic
1091880739 12:3975474-3975496 CTTTCGTTACCGGTGGGGCTTGG - Intergenic
1092218439 12:6697886-6697908 CTGTGAAAGCAGGTGGGCCTTGG + Intronic
1092303339 12:7273807-7273829 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
1092705885 12:11284073-11284095 CTTGGGGAACAGGTGGTGTTTGG + Intergenic
1092710619 12:11333361-11333383 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1093555636 12:20470467-20470489 CTTTGTAATCAGGTGGTTCTAGG - Intronic
1094779160 12:33770574-33770596 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1097466073 12:59926233-59926255 ATTGGGAAACAGGTGGTGTTTGG - Intergenic
1098755755 12:74361367-74361389 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1099549937 12:84031316-84031338 CTTTGAAAACAGGTAAGCCTGGG - Intergenic
1100284529 12:93152647-93152669 CTGTGGAGACATGTGGGGCCAGG - Intergenic
1100520200 12:95367427-95367449 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1100696221 12:97096933-97096955 CTTTGGAAACTGGCAGGCCTGGG - Intergenic
1101822269 12:108193023-108193045 CTTTGAAATCAGGTGGCACTGGG + Intronic
1102214727 12:111152617-111152639 CATTGCAAACAGGTGGCCCTCGG - Intronic
1102784497 12:115593256-115593278 CATTGGGAACAGGTGGTGTTTGG + Intergenic
1102984345 12:117266133-117266155 TTTGGGGAACAGGTGGTGCTTGG + Intronic
1103130496 12:118464319-118464341 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1103190741 12:118999756-118999778 CTCTGGAATCAGATGGGACTGGG - Intronic
1103196406 12:119047357-119047379 TTTGGGGAACAGGTGGTGCTTGG + Intronic
1106175708 13:27329417-27329439 CTTTGGAATCAGATGGATCTGGG + Intergenic
1106247155 13:27960408-27960430 CTCTGGGAAGAGATGGGGCTTGG - Intergenic
1106899354 13:34338700-34338722 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1108151309 13:47537643-47537665 CTGGGGAAACAGGTGGTGTTTGG - Intergenic
1108563498 13:51670751-51670773 TTTGGGGAACAGGTGGTGCTTGG + Intronic
1109196818 13:59386906-59386928 TTTTGGGAACAGGTGGTGTTTGG + Intergenic
1110288804 13:73780263-73780285 TTTGGGAAACAGGTGGTGTTTGG + Intronic
1112899174 13:104338389-104338411 CTGTGGAGTAAGGTGGGGCTGGG - Intergenic
1113049234 13:106190148-106190170 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1113424255 13:110194929-110194951 CTTTGGAGCCAAGTGGGGGTGGG - Intronic
1113532387 13:111037730-111037752 CCTGGGAAGCAGGTGGGCCTGGG + Intergenic
1113605035 13:111598944-111598966 GCTTGGAAACAGGAGTGGCTCGG + Intronic
1113703164 13:112403448-112403470 TTTGGGAAACAGGTGGTGTTTGG + Intronic
1113913918 13:113859977-113859999 CTTTGGGAACAGCTGGGGAAGGG - Intronic
1114652071 14:24291545-24291567 CTTTGGCAACAGGTGAAGTTTGG - Exonic
1114743844 14:25125363-25125385 CTTTGGAGACAGATGGGCTTGGG - Intergenic
1115586253 14:34816381-34816403 TTTTAGAAACATCTGGGGCTGGG - Intronic
1116064443 14:39964716-39964738 TTTGGGAAACAGGTGGGGTTTGG - Intergenic
1116330567 14:43592368-43592390 TTTGGGAAACAGGTGGGTTTTGG + Intergenic
1116409561 14:44605958-44605980 CTTTGTGAACAAGTGGGACTTGG - Intergenic
1116905720 14:50401641-50401663 CTTTGGAAACAGGCAGAGTTGGG - Intronic
1117646836 14:57862069-57862091 CTTTGGAAAGGGGTGGGGGGTGG - Intronic
1117694097 14:58340778-58340800 CTTAAGACACAGGTGGGGCCGGG - Intronic
1119107774 14:71940332-71940354 CTTTGGACAAAGGGGAGGCTGGG - Intronic
1119277589 14:73373165-73373187 CCTAGGAAACAGCTGGGCCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121113106 14:91325863-91325885 CATTGAAAACAGATTGGGCTCGG - Intronic
1121238236 14:92409064-92409086 CTATAGAAAGAGGTGGGACTGGG + Intronic
1121349218 14:93160356-93160378 TTGTAGAAACAGGTGGTGCTGGG - Intergenic
1122127294 14:99586237-99586259 CTTGGGAGACAGATGGGGCCTGG - Intronic
1122725422 14:103747544-103747566 TTTGGGAAACAGGTGGTGTTTGG + Intronic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1125102816 15:35934467-35934489 TTTTGGAAACAGGTGGTTTTTGG - Intergenic
1125683090 15:41545128-41545150 CTTTGGAGACAGGGGTGGCAGGG - Intergenic
1125858137 15:42971008-42971030 GATTAAAAACAGGTGGGGCTGGG - Intronic
1126221185 15:46215440-46215462 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1126349257 15:47727660-47727682 CTTTGCAAACTGGGGGGGTTGGG - Intronic
1127022441 15:54763446-54763468 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1128231519 15:66038839-66038861 CTTTGGATCCAGGTGCTGCTCGG - Intronic
1128744727 15:70105571-70105593 CTTTGGAGACAGAGGGGCCTGGG - Intergenic
1129110272 15:73333177-73333199 CTTTGGGAGGAGGAGGGGCTGGG - Intronic
1129677771 15:77641710-77641732 CTGTGGAGTCAGGTGGTGCTGGG + Intronic
1129832452 15:78679612-78679634 CTATGGAAACAGGTGTGGCAGGG + Intronic
1130335967 15:82957674-82957696 GATTGGAAACAGCAGGGGCTAGG - Intronic
1131800052 15:96059315-96059337 CTTTGGAATCAGGTAGAACTGGG - Intergenic
1132019476 15:98348036-98348058 CTTTGGAGACAGGTGTGCCCAGG + Intergenic
1132646917 16:1003420-1003442 CTGTGGCAGCAGGTGGGGCCCGG - Intergenic
1133685889 16:8165266-8165288 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1134503236 16:14785413-14785435 CTTCGGAGCCAGGTGGGCCTGGG - Intronic
1134577329 16:15343485-15343507 CTTCGGAGCCAGGTGGGCCTGGG + Intergenic
1134725116 16:16413008-16413030 CTTCGGAGCCAGGTGGGCCTGGG - Intergenic
1134817923 16:17221526-17221548 CTTTGGAAGCAGGTTAGTCTGGG - Intronic
1134942316 16:18298850-18298872 CTTCGGAGCCAGGTGGGCCTGGG + Intergenic
1135238577 16:20782268-20782290 TTTGGGAAACAGGTGGTGTTTGG + Intronic
1135657465 16:24263595-24263617 CTTTGGGAGCAGGTGGACCTGGG + Intronic
1135917369 16:26617076-26617098 ATTAGGAAACAGGTGGGGTTTGG + Intergenic
1137473138 16:48780733-48780755 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1137849473 16:51724674-51724696 CTCTGGAATCAGATGGGCCTGGG - Intergenic
1138063836 16:53919951-53919973 TTTGGGAAACAGGTGGTGTTTGG - Intronic
1138372130 16:56535537-56535559 ATTGGGGAACAGGTGGGGTTTGG + Intergenic
1138597265 16:58035686-58035708 CTCTGGGGACAGGTGGAGCTAGG - Intronic
1138781663 16:59795941-59795963 CTTTAGATACAGGTGGGCATTGG + Intergenic
1139234598 16:65324143-65324165 TTTGGGAAACAGGTGGTACTTGG - Intergenic
1139245885 16:65443210-65443232 TTTGGGTAACAGGTGGTGCTTGG + Intergenic
1139408588 16:66739935-66739957 CTTTGGAATCAGATGGGAGTGGG + Intronic
1141358108 16:83368544-83368566 TTTTGGGAACAGGTGGTGTTTGG + Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144127527 17:12217137-12217159 GTTTGGAAACAGATTGGGGTTGG + Intergenic
1144756876 17:17685270-17685292 CTTTGGAAACAGTGGGTCCTTGG - Intronic
1144834378 17:18149219-18149241 GTTTGGGAACAGCTGGGACTCGG + Exonic
1146248102 17:31309151-31309173 CTTTGGAATCAGGTGGCCCTGGG - Intronic
1146471415 17:33127974-33127996 CTTTGGAGAAAGGCAGGGCTGGG - Intronic
1146638150 17:34521096-34521118 GTTTGGTAACAGCGGGGGCTGGG - Intergenic
1146741395 17:35286932-35286954 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1148085558 17:44991814-44991836 CTTCTGAAGCAGGTGGAGCTGGG - Intergenic
1148610687 17:48962666-48962688 CTTTGAAAACAGGATTGGCTAGG - Intronic
1148821865 17:50364525-50364547 CTTTGGTAACAAGAGGGGCTGGG + Intergenic
1148914724 17:50966246-50966268 CATGGGAAACAGGTGGAGATGGG - Exonic
1149250933 17:54768414-54768436 CTTTGGAATCAGGCAGGTCTAGG + Intergenic
1149392567 17:56206748-56206770 CTTTGGCAAGAGATGGGGATGGG + Intronic
1149545467 17:57500324-57500346 CTTTGGGGGCAGGTGGGACTTGG + Intronic
1149564259 17:57630168-57630190 CTTTGGGAACTGGGGGGGCGGGG + Intronic
1150418527 17:65007453-65007475 CTTTGGAAACAGGTCTTTCTGGG - Intergenic
1152638187 17:81438780-81438802 CTGAGGAAGCCGGTGGGGCTAGG - Intronic
1152744592 17:82032924-82032946 CTTGGGAAAAAGGTGGGACCTGG - Intronic
1154264057 18:12864277-12864299 CTTTGGAAAAAGGTGGTGTGTGG - Intronic
1155270840 18:24139771-24139793 CTTTGGGAACGTGTGGGGCCAGG - Intronic
1155361766 18:25010269-25010291 TTTTGGGAACAGGTGGTGTTTGG - Intergenic
1158795248 18:60838260-60838282 CTCCTGAAATAGGTGGGGCTTGG - Intergenic
1161564077 19:4989988-4990010 CTTTAGAAACAGTTTGGGCCAGG + Intronic
1163262681 19:16200563-16200585 CTTTGGAAACAGGAGGTCCGTGG - Intronic
1163691511 19:18741143-18741165 GTTTGGACAGAGATGGGGCTTGG + Intronic
1163796123 19:19338970-19338992 CTCTGTTAACAGGAGGGGCTTGG + Intronic
1164696879 19:30251605-30251627 TTTTGGGAACAGGTGGTGTTTGG + Intronic
1165098901 19:33426740-33426762 CTGAGGAAACAGGAGGAGCTGGG + Intronic
1165668426 19:37654768-37654790 CTCTGGAAACTGGCAGGGCTGGG + Exonic
1165927489 19:39335934-39335956 CTATGGGAAGAGCTGGGGCTGGG - Intronic
1166574580 19:43825886-43825908 TTTGGGAAACAGGTGGTGTTTGG - Intronic
1166616081 19:44247949-44247971 TTTGGGAAACAGGTGGTGTTTGG + Intronic
1166925036 19:46261296-46261318 ATTTAGAAAAAGATGGGGCTGGG + Intergenic
1167003115 19:46757380-46757402 CTTCGGAGCCAGGTGGGCCTGGG + Exonic
1167247552 19:48382889-48382911 GTTTGGCAACCAGTGGGGCTGGG + Exonic
1167418776 19:49390709-49390731 CCTGGGGCACAGGTGGGGCTAGG + Intronic
1167487945 19:49774157-49774179 AGCTGGAAACGGGTGGGGCTGGG - Intronic
1167559726 19:50218634-50218656 TTTGGGAAACAGGCGGGGTTTGG + Intronic
1167598553 19:50440287-50440309 ATTGGGAAACAGGTGGTGTTTGG - Intronic
1168398848 19:56071474-56071496 GTTTGGCAAGAGGTTGGGCTAGG - Intergenic
1202677702 1_KI270711v1_random:22722-22744 GTTTGCAATCAGGTGGGGGTGGG - Intergenic
1202678478 1_KI270711v1_random:29068-29090 GTTTGCAATCAGGTGGGGGTGGG - Intergenic
925634624 2:5931100-5931122 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
925989938 2:9246578-9246600 ATTTTCACACAGGTGGGGCTGGG - Intronic
926406567 2:12559036-12559058 GTTTGGCCACTGGTGGGGCTCGG - Intergenic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
928052799 2:28018017-28018039 TTTGGGAAACAGGTGGTGTTTGG + Intronic
928380397 2:30812936-30812958 CTTTGGAGCCAGGTTGGACTGGG - Intronic
931828759 2:66028801-66028823 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
932170289 2:69549071-69549093 CTTTCTAAACAGGTAAGGCTGGG + Intronic
935579642 2:104745660-104745682 ATTTTAAAACAAGTGGGGCTTGG + Intergenic
935788580 2:106570796-106570818 CTGAGGGAAAAGGTGGGGCTCGG + Intergenic
936087967 2:109482400-109482422 CTTTGGCAACAGATGGAGCTGGG - Intronic
937483661 2:122291114-122291136 CTTGGGGAACAGGTGGTGTTTGG - Intergenic
938140237 2:128789466-128789488 CTTTGGACTCACGTGGAGCTGGG - Intergenic
938816539 2:134910320-134910342 CTTTGGAATCTGGTGGTGTTGGG - Intergenic
939139069 2:138331716-138331738 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
941229962 2:162899553-162899575 ATTTGGGAACAGGTGGTGTTTGG + Intergenic
942386721 2:175450709-175450731 CTTTGCAAACAGGTGTGACATGG - Intergenic
946323438 2:218968219-218968241 ATTTGGAAACAGCTTGGGGTTGG - Intergenic
946879909 2:224166590-224166612 CATTGGAAACAGATAGGCCTGGG + Intergenic
946999528 2:225437815-225437837 CTATGGAGTCAGATGGGGCTAGG - Intronic
947337827 2:229105483-229105505 CTTTGTAAATGGGTGGGGCTAGG + Intronic
947724689 2:232389389-232389411 CTTTGGAAATAGGTATTGCTTGG - Intergenic
948577243 2:238962625-238962647 TTTTGGGAACAGGTGGTGTTTGG - Intergenic
948858649 2:240742473-240742495 CTGTGGGAACAGGTGGGTCATGG - Intronic
1169860912 20:10151286-10151308 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1170107909 20:12771923-12771945 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1170156788 20:13276196-13276218 CTGTGGAAACTGGTGGGAGTGGG - Intronic
1170818940 20:19739646-19739668 CTTTGGAAGGAGCTGGAGCTGGG + Intergenic
1171085573 20:22235500-22235522 ATTTGGAAACAGGTTTGGTTTGG + Intergenic
1171721511 20:28568400-28568422 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1172574450 20:35996911-35996933 CTTTGGAACCAGTTGTGCCTGGG - Intronic
1172728476 20:37066102-37066124 CTTTGGTAAAAGGAGGGGTTTGG - Intronic
1173023260 20:39285316-39285338 CTTGGGAAAGAGTTGGGGCATGG + Intergenic
1174038465 20:47682776-47682798 CTGTGGAAACAGGTGTGGTGGGG - Intronic
1174267081 20:49339830-49339852 CTCTGGAATCAGGTGGCGTTTGG - Intergenic
1174311634 20:49660269-49660291 CTTTGGTAACAGGTGGAACAGGG - Intronic
1175971114 20:62687255-62687277 CTTTGGAACAACGTGGGGCCAGG - Intergenic
1176342826 21:5714200-5714222 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1176475080 21:7146351-7146373 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1176502001 21:7610256-7610278 CTTTTAAAACAGGTGGAGCCAGG + Intergenic
1176537147 21:8112269-8112291 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1176588730 21:8618794-8618816 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1178614208 21:34116351-34116373 TTTTGGGAACAGGTGGTGTTTGG + Intronic
1178947253 21:36958995-36959017 CTGTGGAACCAGGGGGAGCTGGG + Intronic
1179369039 21:40786976-40786998 CTTTGGAATCAGGCAGGGCTGGG - Intronic
1179888861 21:44325940-44325962 CCCTGGAAACAGGTGAGGCCCGG - Exonic
1180251576 21:46593674-46593696 ATTGGGAAACAGGTGGTGTTTGG - Intergenic
1180271556 22:10595790-10595812 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1180295050 22:10927021-10927043 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1180674996 22:17580913-17580935 CTCTGGACACCTGTGGGGCTGGG + Intronic
1182265926 22:29115400-29115422 CTTGGGGAACAGGTGGTGTTTGG - Intronic
1183771961 22:39934394-39934416 CTTTTGAATCAGGTAGGGCTGGG - Intronic
1184742640 22:46438000-46438022 CTTTGGACCCAGGTGGGGGCTGG + Intronic
1185202878 22:49518703-49518725 ATCTGGAAAGCGGTGGGGCTGGG + Intronic
1185320863 22:50199827-50199849 CTCTGGAATCTGGTGGGACTGGG - Intergenic
949138592 3:602975-602997 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
949142670 3:653930-653952 GTTAGGAAACAGGCTGGGCTTGG + Intergenic
949190757 3:1245651-1245673 TTTGGGAAACAGGTGGTGTTTGG - Intronic
949317450 3:2772499-2772521 CTTTGGAATCAGGTTAGGGTTGG + Intronic
950056544 3:10029606-10029628 TTTTGGGAACAGGTGGTGTTCGG + Intronic
950748249 3:15108030-15108052 CTTTGGAGAAAGGGGTGGCTTGG - Intergenic
950824888 3:15808115-15808137 CTTCGGAGACAGATGGGTCTGGG - Intronic
951062823 3:18230003-18230025 CTTTGTAAACAGTTAGGACTGGG - Intronic
951252621 3:20411706-20411728 TTTTCAAAATAGGTGGGGCTGGG - Intergenic
951302217 3:21011883-21011905 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
951636113 3:24778986-24779008 TTTTGGCAACAGGTGGTGTTTGG + Intergenic
951749793 3:26021853-26021875 TTTTGGGAACAGATGGGGTTTGG + Intergenic
952282263 3:31935190-31935212 CTTTGGCAACAGGGGAGTCTGGG + Intronic
952385160 3:32835827-32835849 CTTTGGAAAGAAGTGGGACGGGG - Intronic
952910636 3:38181638-38181660 CTTTTGAAACAGGCCGGGCATGG - Intronic
952984355 3:38764242-38764264 TTTGGGAAACAGGTGGTGTTGGG + Intronic
953277221 3:41513929-41513951 TTTAGGGAACAGGTGGTGCTTGG - Intronic
954472470 3:50709528-50709550 TTTTTTAAACAGGTGGGGCTGGG + Intronic
954492786 3:50922791-50922813 TGTTGGGAACAGGTGGGGTTTGG + Intronic
954708418 3:52493415-52493437 GTTGTGAAACAGGTGGGGTTGGG - Intergenic
955450286 3:59058859-59058881 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
956129348 3:66039187-66039209 CATTTCAAACAGGTGGGGGTTGG + Intergenic
956376863 3:68622675-68622697 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
957404427 3:79758746-79758768 CTTAGGAGACAGGTGGGGAAAGG + Intronic
959868463 3:111299660-111299682 CTCTGGACCCAGCTGGGGCTAGG - Intronic
961551211 3:127671618-127671640 GTGTGGGGACAGGTGGGGCTGGG + Intronic
962141305 3:132793559-132793581 CTTTGGCTACAGGAGAGGCTAGG - Intergenic
962749851 3:138425862-138425884 CTTAGGAAAGAGGTGTGGCCAGG + Intergenic
962841307 3:139235251-139235273 CTTTGGAGATGGATGGGGCTGGG - Intronic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
966289661 3:178341261-178341283 CTTTGGACACAGGTGGATATGGG + Intergenic
966842097 3:184098200-184098222 ATTTGGAGACAGGTGGACCTGGG + Intronic
967226617 3:187298171-187298193 GTAAGGAAGCAGGTGGGGCTGGG + Intergenic
967868910 3:194213324-194213346 CTTTGGGAAAATGCGGGGCTGGG - Intergenic
968661322 4:1799947-1799969 CTCAGGATACAGGAGGGGCTGGG + Intronic
969478825 4:7436161-7436183 CTTAGGGAACAGGTGAGCCTGGG + Intronic
969687110 4:8681795-8681817 GTTTGGACAGTGGTGGGGCTGGG + Intergenic
969846757 4:9925443-9925465 CTGTGGAAAGGGGTGGGCCTTGG + Intronic
970320115 4:14867229-14867251 CTTTGATAACAGGTGAAGCTCGG - Intergenic
970326784 4:14933896-14933918 CTTTAGAGACAGGTAGGTCTGGG - Intergenic
970413794 4:15836641-15836663 CTTTGGAATCAGGGAGGCCTAGG - Intronic
970458781 4:16252094-16252116 TTTGGGGAACAGGTGGTGCTTGG + Intergenic
971018868 4:22515306-22515328 CTTTGCAAACTAGTGGAGCTGGG + Intronic
971446568 4:26756849-26756871 CATTTGAAACAGGTGGCTCTAGG + Intergenic
971577025 4:28287428-28287450 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
973072455 4:45880926-45880948 TTTTGGGAACAGGTGGTGTTTGG + Intergenic
974105339 4:57463444-57463466 CTTTGGAATTAGATGGGCCTGGG + Intergenic
975170905 4:71230976-71230998 CTTTGGCAAAAGCTTGGGCTAGG + Intronic
975301365 4:72795221-72795243 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
977000895 4:91500788-91500810 TTTGGGAAACAGGTGGTGTTTGG + Intronic
977413823 4:96703621-96703643 CTTTGGATCCAGGTGGGGGATGG - Intergenic
977907130 4:102490021-102490043 TTTGGGTAACAGGTGGGGTTTGG - Intergenic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
978711115 4:111782343-111782365 CATTGGAAACAAGTGTGGGTAGG + Intergenic
980644631 4:135627315-135627337 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
980669162 4:135981397-135981419 GTTTGGAACCAGGTGGGGCACGG - Intergenic
980968346 4:139545536-139545558 CTTTACAAAAAGGTGGGGTTGGG + Intronic
982885763 4:160780753-160780775 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
983577405 4:169273254-169273276 CTTTGAAAACGGGTGTGGCCAGG - Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
984759813 4:183353904-183353926 CTTTGGAAACTGGGGAAGCTGGG - Intergenic
985240217 4:187923154-187923176 ATTGGGAAACAGGTGGTGCTTGG + Intergenic
985250177 4:188016091-188016113 CTTAAAAAACAGGTGGGGCGCGG + Intergenic
986583458 5:9290076-9290098 TTTTGGAAACAGGTGGTGTTTGG + Intronic
986644483 5:9903351-9903373 TTTGGGGAACAGGTGGTGCTTGG + Intergenic
987229695 5:15881061-15881083 TTTTGGGAACAGGTGGTGATGGG + Intronic
987440161 5:17945808-17945830 TTTGGGGAACAGGTGGGGTTTGG + Intergenic
987788539 5:22534225-22534247 ATTGGGAAACAGGTGGTGTTTGG + Intronic
989232170 5:39099186-39099208 CTGTGGAATCAGGTGAGACTGGG + Intergenic
989338148 5:40342970-40342992 CTTGGGGAACAGGTGGTGTTTGG - Intergenic
989665385 5:43847800-43847822 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
990518228 5:56550875-56550897 ATTTGGAAACAGGTGGTGCCAGG - Intronic
991658452 5:68926726-68926748 TTCTGGCAAGAGGTGGGGCTGGG - Intergenic
992497439 5:77307764-77307786 CTGTGGAAACACATGTGGCTAGG + Intronic
992546416 5:77818111-77818133 CTTTGAAAATAGCTGAGGCTGGG - Intronic
993582049 5:89675000-89675022 TTTAGGAAACAGGTGGTGTTTGG - Intergenic
994625983 5:102219670-102219692 TTTTGGAATCAGGTGGTGTTTGG + Intergenic
994753310 5:103764714-103764736 CTTTGGAGACCGTTGGGGCAGGG + Intergenic
995381112 5:111534395-111534417 CTTTGGAGACAGGCTGGACTTGG + Intergenic
995645195 5:114303961-114303983 CCTTGGAAAAAGTTTGGGCTGGG + Intergenic
995713327 5:115056459-115056481 CTTTGGAAACAGGAAGATCTGGG + Intergenic
996671785 5:126126530-126126552 CATTTCAAACAAGTGGGGCTTGG - Intergenic
996883977 5:128334077-128334099 TTTTGCATGCAGGTGGGGCTAGG - Intronic
998607671 5:143651695-143651717 CTTTGGAATCAGGTAGAGCTGGG + Intergenic
1001190947 5:169630640-169630662 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
1001376238 5:171261337-171261359 TTTTGGAAATAGGTGAGTCTAGG - Intronic
1002070388 5:176675945-176675967 CTTCAAAAGCAGGTGGGGCTAGG + Intergenic
1002678141 5:180935737-180935759 CCATGGAGCCAGGTGGGGCTGGG - Intronic
1002864518 6:1109041-1109063 CTTGGGAGTCAGGTGGGGGTGGG + Intergenic
1003296933 6:4838180-4838202 TTTTGGGAACAGGTGGTGTTTGG + Intronic
1003392421 6:5725306-5725328 CTTTGGAGGCAGGTTGGGCAAGG + Intronic
1003433256 6:6060017-6060039 TTTTGGGAACAGGTGGTGTTTGG + Intergenic
1003712481 6:8608162-8608184 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1003815421 6:9834970-9834992 CTTTGGCATCAGGCCGGGCTAGG - Intronic
1004570293 6:16838316-16838338 CTTTGGAGTCAGGTAGGCCTGGG + Intergenic
1004850470 6:19693446-19693468 CCATGCAAACAGGTGGGACTTGG - Intergenic
1004854246 6:19733265-19733287 CCCTGGGACCAGGTGGGGCTTGG - Intergenic
1006095731 6:31655557-31655579 CTTGGGAAACAACTGGGACTTGG + Exonic
1006279764 6:33041421-33041443 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
1006959941 6:37918777-37918799 TTTTGAAAATAGGTGGGGTTGGG - Intronic
1007703472 6:43777717-43777739 CTTTGGGAACAGGTGGTCCCAGG + Intronic
1008171734 6:48216103-48216125 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1008401873 6:51072563-51072585 TTTTGGGAACAGGTGGTGTTTGG + Intergenic
1008479885 6:51974822-51974844 TTTGGGAAACAGGTGGTGTTTGG - Intronic
1010046706 6:71452624-71452646 TTTTGGAAGCAGGTGGACCTAGG - Intergenic
1011652987 6:89524178-89524200 TTTTGGGAACAGGTGGTGTTTGG + Intronic
1012302515 6:97606787-97606809 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1012591991 6:100993159-100993181 CTTAAGAAACATTTGGGGCTTGG - Intergenic
1013822849 6:114176157-114176179 TTTTGGAAAGGGGTGGGGGTGGG - Intronic
1016918244 6:149265001-149265023 CTTTGGAAACTGCAGTGGCTTGG + Intronic
1018629998 6:165814144-165814166 ATTTGGAAACACATGGGGCCAGG + Intronic
1018631782 6:165827680-165827702 TTTTGGGAACAGGTGGTGTTTGG + Intronic
1018719850 6:166564307-166564329 CCCTGGAAACAGGTGGGCCGAGG - Intronic
1018905177 6:168071830-168071852 CTTGAGCAACAGGAGGGGCTGGG - Intronic
1020064789 7:5179263-5179285 CTTTGCAAACAAATGGTGCTGGG + Intergenic
1020374946 7:7474408-7474430 ATTTGGGAACAGGTGGTGATAGG - Intronic
1020431262 7:8118758-8118780 CTCTGGGGACAGGTGGGTCTTGG - Intronic
1020536910 7:9410530-9410552 TTTTGGGAACAGGTGGTGTTTGG + Intergenic
1021844966 7:24755673-24755695 CTTTGGAGTCAGGTGGACCTCGG - Intronic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1026069265 7:67103348-67103370 CATTGGGAAAATGTGGGGCTAGG - Intronic
1026707635 7:72708965-72708987 CATTGGAAAAATGTGGGGCTAGG + Intronic
1028402450 7:90438769-90438791 TTTTGGGAACAGGTGGTGTTTGG - Intronic
1031895213 7:127340326-127340348 CTTTGAAAATATTTGGGGCTGGG - Intergenic
1032404943 7:131649262-131649284 GTTTGGAAACCAGTGGGGTTTGG + Intergenic
1034002303 7:147428802-147428824 TTTTGGGAACAGGTGGTGTTTGG + Intronic
1035076017 7:156178136-156178158 TTTTGGGAACAGGTGGTGTTTGG - Intergenic
1036053072 8:5221751-5221773 CCCTGGAAACATGCGGGGCTTGG + Intergenic
1036133895 8:6141113-6141135 TTTTGGGAACAGGTGGTGTTTGG - Intergenic
1036703857 8:11031973-11031995 GCTTGGAAACAGCTGTGGCTAGG - Intronic
1037767262 8:21779937-21779959 CTTTGGGAAGGGGAGGGGCTGGG - Intronic
1038143821 8:24875409-24875431 ATTAGGAAACAGGTGGTGTTTGG - Intergenic
1038154592 8:24976771-24976793 TTTTGGGAACAGGTGGTGTTTGG - Intergenic
1038397705 8:27259145-27259167 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1038721738 8:30042756-30042778 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1038734640 8:30157633-30157655 CTTTGTAAACATGTGGGGACAGG + Intronic
1039456821 8:37712700-37712722 CTTTGGGAACAGGTGGGTGGAGG + Intergenic
1039553073 8:38457297-38457319 CCTTGGGAACAGGATGGGCTGGG - Intronic
1040670623 8:49685736-49685758 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1040687610 8:49894175-49894197 ATTAGGAAACAGGTGGTGTTTGG + Intergenic
1041128195 8:54666838-54666860 CTCTGAGAACAGATGGGGCTTGG - Intergenic
1041249009 8:55916879-55916901 TTTTAAAAACAGATGGGGCTGGG + Intronic
1041829643 8:62139434-62139456 TTTTGTATAAAGGTGGGGCTGGG - Intergenic
1041934942 8:63323770-63323792 CTTTGGAATGAGGTGGAGTTTGG - Intergenic
1042900900 8:73726396-73726418 TTTGGGAAACAGGTGGTGTTTGG - Intronic
1043448661 8:80344157-80344179 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1044898171 8:96915240-96915262 CTTTGGACACAGGAGAGGCACGG - Intronic
1046678618 8:117141570-117141592 TTTTGGGAACAGGTGGTGTTTGG + Intronic
1047611380 8:126524058-126524080 ATTGGGAAACAGGTGGTGTTTGG - Intergenic
1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG + Intergenic
1050266663 9:3897859-3897881 CTCTGGAATCAGATGGGGGTGGG + Intronic
1051190146 9:14502757-14502779 TTCGGGAAACAGGTGGTGCTTGG + Intergenic
1051585523 9:18722897-18722919 ATGTGGAACCAGGTGGGGCAGGG - Intronic
1051796034 9:20871610-20871632 ATTTGGGAACAGGTGGTGTTTGG - Intronic
1051807998 9:21017767-21017789 GTTTCCAAAAAGGTGGGGCTGGG - Intronic
1052413068 9:28147422-28147444 CTTTGGAAACCTGTGGAGCGAGG + Intronic
1052432284 9:28381994-28382016 CTTTGGATACAGATGGACCTAGG + Intronic
1052811287 9:33062978-33063000 CTTTGGAGACAGATGGTCCTAGG + Intronic
1052847321 9:33348461-33348483 CTTGGGGAACAGGTGGTGTTTGG - Intronic
1053380032 9:37641272-37641294 CTTTTGAAACTGGTGGAGTTTGG - Intronic
1053471477 9:38348644-38348666 ATTGGGAAACAGGTGGTGTTCGG + Intergenic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1054702053 9:68422748-68422770 ATTGGGAAACAGGTGGTGTTTGG + Intronic
1055186663 9:73464713-73464735 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1056182944 9:84103111-84103133 CCTTGGAAACAGGGGGGAATAGG - Intergenic
1057481062 9:95446326-95446348 TTCTGGAAAGAGGTGGGGGTGGG + Exonic
1057915651 9:99053325-99053347 GTTTGCAAACAGGCTGGGCTTGG - Intronic
1058286909 9:103189798-103189820 TTTTGGGAACAGGTGGTGTTTGG - Intergenic
1058445601 9:105052139-105052161 CTTTGCAGATGGGTGGGGCTAGG + Intergenic
1059169326 9:112110679-112110701 CCTTGTAGACAGGTGGGGCACGG - Intronic
1059336691 9:113573506-113573528 CTTTGGAAGCAGGAGGGCCTGGG - Intronic
1059441560 9:114310197-114310219 TTTGGGGAACAGGTGGGGTTTGG - Intronic
1060025786 9:120170007-120170029 CTTTGGAGATAGGCAGGGCTGGG - Intergenic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060901965 9:127266438-127266460 CTTTGGAATCAGGTAGGCCTGGG + Intronic
1062039681 9:134398538-134398560 CTGTGTAAACAGGAAGGGCTGGG + Intronic
1062144177 9:134979665-134979687 CTGTGGAAACAGGAAGGGCCTGG + Intergenic
1062442210 9:136575897-136575919 CCTTGGATTCAAGTGGGGCTGGG - Intergenic
1203458415 Un_GL000220v1:11750-11772 CTTTTAAAACAGGTGGAGCCAGG - Intergenic
1203618737 Un_KI270749v1:97373-97395 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1186207350 X:7214569-7214591 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1186387016 X:9120282-9120304 CTTTGGAAACAGGTAAATCTGGG + Intronic
1187509819 X:19907697-19907719 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1188005060 X:25011356-25011378 GGTTGGAAAGAGGTGGGGGTGGG + Intronic
1188039953 X:25360244-25360266 CTTTGGGAACAGGTGTTGTTTGG + Intergenic
1188616063 X:32160523-32160545 GTTTGCAAGCAGGTGGGGCATGG - Intronic
1188890050 X:35599133-35599155 TTTGGGAAACAGGTGGTGTTTGG - Intergenic
1191626755 X:63278462-63278484 GTTTGGCAGCAGGTGGGGCAAGG - Intergenic
1192034406 X:67546689-67546711 CTTTTGACACAAGTGGGACTGGG - Exonic
1192259363 X:69495223-69495245 CTTTGGAATCAGGCAGGCCTGGG - Intergenic
1192430584 X:71108914-71108936 CTTTGGAACCAGCTGGATCTAGG - Intronic
1192602745 X:72481904-72481926 TTTTAGAAGCAGGTAGGGCTGGG - Intronic
1193208199 X:78773817-78773839 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
1194764153 X:97829668-97829690 ATTTGGAAATAGCTGGGGCGTGG - Intergenic
1194914935 X:99694632-99694654 CTTAAGAAACAGGTGGTCCTAGG - Intergenic
1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG + Intronic
1196362436 X:114879479-114879501 TTTTGGAAACAGGTGGTATTTGG + Intronic
1196478346 X:116114164-116114186 TTTTGGGAACAGGTGGTGTTTGG - Intergenic
1196579625 X:117363385-117363407 TTTTGGGAACAGGTGGTGTTTGG - Intergenic
1197269050 X:124406040-124406062 CTTTGCAAACAGCTGGGTATTGG + Intronic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1197524374 X:127544574-127544596 CTCTGGAAACAACTGGGCCTAGG - Intergenic
1197544546 X:127808751-127808773 CTTTGGAAACACCTGGGGCCTGG + Intergenic
1199001445 X:142642517-142642539 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1199090983 X:143692114-143692136 ATTGGGAAACAGGTGGTGTTTGG + Intergenic
1199120606 X:144048663-144048685 TTGGGGAAACAGGTGGTGCTTGG - Intergenic
1199459789 X:148071830-148071852 CTTTGGGAGCAGGTTGGGTTGGG + Intergenic
1201579213 Y:15493466-15493488 TTTGGGAAACAGGTGGTGTTTGG + Intergenic
1201935275 Y:19405250-19405272 TTTGGGAAACAGGTGGTGTTTGG - Intergenic