ID: 1077083028

View in Genome Browser
Species Human (GRCh38)
Location 11:733896-733918
Sequence GGAATGTCCCGCCTTGGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077083028_1077083031 -8 Left 1077083028 11:733896-733918 CCACGACCAAGGCGGGACATTCC No data
Right 1077083031 11:733911-733933 GACATTCCAGCATCACTCATGGG No data
1077083028_1077083030 -9 Left 1077083028 11:733896-733918 CCACGACCAAGGCGGGACATTCC No data
Right 1077083030 11:733910-733932 GGACATTCCAGCATCACTCATGG No data
1077083028_1077083033 14 Left 1077083028 11:733896-733918 CCACGACCAAGGCGGGACATTCC No data
Right 1077083033 11:733933-733955 GCCTAAGAGCCAGTCACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077083028 Original CRISPR GGAATGTCCCGCCTTGGTCG TGG (reversed) Intergenic
No off target data available for this crispr