ID: 1077083942

View in Genome Browser
Species Human (GRCh38)
Location 11:738216-738238
Sequence GGGCCCTGCCCCACACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077083942_1077083945 -8 Left 1077083942 11:738216-738238 CCCTGGGGTGTGGGGCAGGGCCC No data
Right 1077083945 11:738231-738253 CAGGGCCCCTTCAGAAATGTGGG No data
1077083942_1077083949 17 Left 1077083942 11:738216-738238 CCCTGGGGTGTGGGGCAGGGCCC No data
Right 1077083949 11:738256-738278 TTGTGACCCACAGTCAGACAAGG No data
1077083942_1077083944 -9 Left 1077083942 11:738216-738238 CCCTGGGGTGTGGGGCAGGGCCC No data
Right 1077083944 11:738230-738252 GCAGGGCCCCTTCAGAAATGTGG No data
1077083942_1077083950 21 Left 1077083942 11:738216-738238 CCCTGGGGTGTGGGGCAGGGCCC No data
Right 1077083950 11:738260-738282 GACCCACAGTCAGACAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077083942 Original CRISPR GGGCCCTGCCCCACACCCCA GGG (reversed) Intergenic
No off target data available for this crispr