ID: 1077087342

View in Genome Browser
Species Human (GRCh38)
Location 11:760546-760568
Sequence GTGTTGATCAGGACAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077087342 Original CRISPR GTGTTGATCAGGACAGAGGA AGG (reversed) Intronic
901038278 1:6349342-6349364 GGGTTGGTCAGGGCAGAGGTGGG + Intronic
902116409 1:14125239-14125261 GTCATGATCAGGACAGGGGCAGG - Intergenic
902437166 1:16405768-16405790 GTGTGGACCAGAGCAGAGGATGG - Intronic
903150624 1:21405461-21405483 CTGTTCATCAGGACAATGGAAGG - Intergenic
905877069 1:41438764-41438786 CTGGTGATCAGGATATAGGAGGG - Intergenic
906253398 1:44329113-44329135 TGGTTCATCTGGACAGAGGAAGG - Intronic
907115027 1:51960607-51960629 GTGTTGCTAAGGACAGGGGTGGG - Intronic
908771285 1:67599222-67599244 GTGCTGACCAGGACAGAGCCTGG + Intergenic
908974422 1:69880364-69880386 GGGATGATCAGGGCAGAAGATGG + Intronic
909919554 1:81364167-81364189 TTTTTGAGCAAGACAGAGGAAGG + Intronic
911631579 1:100189522-100189544 CTGTAGATCAGGACAGAGGTGGG + Exonic
913543571 1:119844565-119844587 GGTTTAATCAGGACTGAGGAAGG + Intergenic
915876190 1:159614041-159614063 GTGGTGATCAGAACAAAGGGTGG + Intergenic
916508006 1:165445348-165445370 GTGTAGGTCAGGAGAGAGGCGGG + Intronic
919905166 1:202073505-202073527 GCGTTGAACAAGACACAGGACGG + Intergenic
920177020 1:204108406-204108428 GGGTTAATTAGGACAGATGATGG + Intronic
921286198 1:213611539-213611561 GTGTTATCCAGGAAAGAGGAGGG + Intergenic
922158449 1:223059488-223059510 AATTTCATCAGGACAGAGGATGG + Intergenic
922189944 1:223309494-223309516 GTGGTGCTCAGGACTGGGGAGGG + Intronic
922702714 1:227771191-227771213 GTGTTCATCACGACACAGGCAGG + Intronic
923187445 1:231587852-231587874 GTGATCATCAGTACAGATGATGG - Intronic
1063368010 10:5502952-5502974 GTCGTGATCAGCACAGAAGAGGG + Intergenic
1063967211 10:11355471-11355493 GTTCTGAGCAGGACAGAAGAAGG - Intergenic
1064276812 10:13913897-13913919 CTGTAGCTCAGGATAGAGGACGG + Intronic
1066550280 10:36548271-36548293 GAGTTGAGCAGGACAAAAGAGGG - Intergenic
1067097079 10:43308583-43308605 GTGCTGACCAGGGCAGGGGAGGG - Intergenic
1067922378 10:50472911-50472933 GTGGGGAGCAGGATAGAGGAAGG - Intronic
1069977875 10:72230089-72230111 GTGTTGACCAGGACATCAGACGG + Intronic
1071009172 10:80917535-80917557 ATGATGAGCAGGACAGAGGCAGG - Intergenic
1072547283 10:96449464-96449486 TTGTTGATAAGGACAGGGGAGGG - Intronic
1072577250 10:96711566-96711588 CTGTTGAAAAGGACAGAGGCAGG + Intronic
1074848988 10:117423655-117423677 GTAATGAGCAGGACAGATGAGGG + Intergenic
1077087342 11:760546-760568 GTGTTGATCAGGACAGAGGAAGG - Intronic
1077168536 11:1154373-1154395 GTGCTGATGAAGGCAGAGGAGGG - Intergenic
1077556142 11:3227052-3227074 GACTTGCTCAGGACAGAGGCGGG + Intergenic
1078050896 11:7963836-7963858 GTGTTGAGAGGGAAAGAGGAAGG - Intronic
1078460719 11:11513363-11513385 GAGTTGCTCAGAACAGAGCAAGG - Intronic
1078472968 11:11606505-11606527 GTGATGATTCGGATAGAGGAGGG - Intronic
1079170666 11:18092126-18092148 GTGTTCATCAAGACAAAGAAAGG + Intronic
1079723678 11:23851550-23851572 GTGTAGACAAGGAAAGAGGATGG - Intergenic
1080225027 11:29950461-29950483 TGGTTGCTCAGGGCAGAGGAGGG - Intergenic
1081771665 11:45654043-45654065 GTCTTGATGAGGACCAAGGAGGG - Intronic
1081918236 11:46748232-46748254 GTGTAGAAAAGAACAGAGGAAGG + Intronic
1083823701 11:65186626-65186648 CTGGTGAACTGGACAGAGGATGG - Intronic
1083996145 11:66273682-66273704 GTGTAGACATGGACAGAGGAGGG - Intronic
1084044804 11:66562364-66562386 TAGGTGATCAGCACAGAGGAGGG - Intronic
1087528778 11:99352769-99352791 GTGTTGAAAAGGGAAGAGGAAGG + Intronic
1088830287 11:113530984-113531006 GTGTTGCCCAGCACAGAGCATGG + Intergenic
1089625576 11:119748814-119748836 GTGGTGAGAAGGACAGAGAAGGG + Intergenic
1090414842 11:126533904-126533926 CTGGTGTTCAGGACAGAGGGTGG - Intronic
1097048545 12:56206099-56206121 TGGAGGATCAGGACAGAGGAAGG - Exonic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102573256 12:113840526-113840548 GGATGGAGCAGGACAGAGGATGG - Intronic
1103885524 12:124197486-124197508 GTGTTTCTCAGGATAAAGGATGG - Intronic
1104833673 12:131772734-131772756 GTGTTAATCAGCTCAGTGGAGGG + Intronic
1109955796 13:69564088-69564110 GTATTCATCAGGACAATGGAAGG + Intergenic
1111590205 13:90336790-90336812 GAGGTGATCAGGACAGGTGAGGG + Intergenic
1111749720 13:92313691-92313713 GTGTTGATGAGAACAGACGAGGG - Intronic
1115365205 14:32549962-32549984 ATGTGGATCAGGCAAGAGGAAGG + Intronic
1115843601 14:37501671-37501693 GTGTTGATCGACACAGAAGATGG + Intronic
1116239605 14:42323961-42323983 GTGGTGATCAGCAGAGAGGCAGG - Intergenic
1117095621 14:52294707-52294729 GTGTTGAACACTGCAGAGGAAGG - Intergenic
1122071202 14:99206488-99206510 GTCTTGGGCAGGACAGAGCAGGG - Intronic
1128155054 15:65386680-65386702 GAGCAGGTCAGGACAGAGGAAGG + Intronic
1128319612 15:66683829-66683851 GTATTGATCAGGTTTGAGGAAGG + Intronic
1129496878 15:75991494-75991516 ATGTTCACCAGGACAGAGGTTGG - Intronic
1130073556 15:80669400-80669422 GTGGTGATCAGGACCCAGGATGG + Intergenic
1130923691 15:88369371-88369393 ATGTTAATCAGGAGAGGGGAGGG - Intergenic
1131821331 15:96277510-96277532 ATGTTGAACAGGATACAGGATGG - Intergenic
1132773335 16:1577567-1577589 GTGTTCTTAAGGACAGATGAGGG - Intronic
1133071422 16:3249132-3249154 GGGGTGCTCAGGAAAGAGGAGGG + Intronic
1133215935 16:4292563-4292585 GGGCTGACCAGGCCAGAGGAGGG + Intergenic
1133477769 16:6139943-6139965 GTCTTGATGAGAGCAGAGGAAGG + Intronic
1135548262 16:23379886-23379908 GAGAAGCTCAGGACAGAGGAGGG + Intronic
1138659912 16:58510793-58510815 GAGTTGAACAGGACACAAGAAGG - Intronic
1138750740 16:59417136-59417158 GTGTGGATAGGGACAGAGAATGG - Intergenic
1141434995 16:83994873-83994895 GTGTTGTTCAGGCCCAAGGAGGG + Intronic
1141488169 16:84354903-84354925 CTGGGGATCAGGACAGATGAGGG - Intergenic
1141736844 16:85859752-85859774 GGGTTGTCTAGGACAGAGGAAGG + Intergenic
1143421953 17:6800348-6800370 GTCTTCATGAGGAGAGAGGAAGG - Intronic
1145242902 17:21250037-21250059 GTGGGGACCAGGACAGAGCAGGG - Intronic
1145252539 17:21304434-21304456 TTGTTGATAAGGACATTGGAGGG - Exonic
1145772779 17:27505365-27505387 GGGTTAATGAGGACAGAGAAGGG - Intronic
1146178032 17:30679398-30679420 GAGTTGGGGAGGACAGAGGAGGG + Intergenic
1146617562 17:34369168-34369190 CTTTTGCTCAGGACAGAGGATGG + Intergenic
1147567585 17:41547267-41547289 GTACAGAGCAGGACAGAGGAAGG - Intergenic
1147815299 17:43205472-43205494 ATGTTCATCAGGAAAGAGGGAGG + Intronic
1147960889 17:44167007-44167029 GGATTGATCAGGACTGAGCAGGG - Intergenic
1148232766 17:45947221-45947243 GTGGTGGGCAGGAGAGAGGAGGG + Intronic
1148894276 17:50831037-50831059 GTGTGGAACAGGACACGGGAGGG - Intergenic
1149525368 17:57351366-57351388 GTGTTGATGAGGACTGGGGAGGG - Intronic
1149769007 17:59305279-59305301 GTGTTGAATAGCACAGAGAATGG - Intergenic
1150718526 17:67593988-67594010 GGATTGCTCATGACAGAGGATGG + Intronic
1151527625 17:74681732-74681754 GTGGTGGTCAGGACAGGTGATGG - Intronic
1151586016 17:75008978-75009000 GTGGTGATCAGGAGGGAAGAAGG - Intergenic
1152153635 17:78618474-78618496 GTGTTGGTCAGCACTCAGGAGGG + Intergenic
1152175404 17:78783504-78783526 GTGTTGCTCAGGCTAGAGTACGG + Intergenic
1152247378 17:79192116-79192138 GAGTGGATCAGGAAAGGGGAGGG - Intronic
1153756873 18:8293064-8293086 GTGAGGATCAGGTGAGAGGATGG + Intronic
1155961311 18:31997643-31997665 GTGTTGATCTGGAAAGTTGAAGG + Intergenic
1157102101 18:44740354-44740376 GTGGTTATCAGGACAGCTGAGGG + Intronic
1160050244 18:75426704-75426726 GTGGGGATCAAGACAGAGGAAGG + Intronic
1160797567 19:953000-953022 GGGTTGGCCAGGACAGAAGAGGG - Intronic
1161178688 19:2864794-2864816 CTGATGATCAGGACAAAGTAGGG + Intergenic
1161871742 19:6875838-6875860 GAGAAGATCAGGACAGAGCAAGG + Intergenic
1162396918 19:10422667-10422689 GGGGTGATCAGAACAGAGGTGGG - Intronic
1163090641 19:15017547-15017569 ATATTGATCAGAGCAGAGGAAGG + Intronic
1165803791 19:38568194-38568216 ATGTAGCTCTGGACAGAGGATGG - Intronic
1166167411 19:41001412-41001434 GTGTGCATCAGGGCTGAGGAAGG + Intronic
1167780361 19:51594908-51594930 GTTGTAACCAGGACAGAGGAGGG - Intergenic
925207849 2:2022335-2022357 ATGTTAACCAGCACAGAGGATGG - Intronic
926051974 2:9751083-9751105 GACTAAATCAGGACAGAGGAAGG - Intergenic
927247291 2:20967676-20967698 GTGTTGTTCAGGACAGTCCAGGG - Intergenic
927458482 2:23277506-23277528 GTGATGATGAGGGCAGAGGTTGG + Intergenic
928235503 2:29535974-29535996 GTGTAAATCGGGAGAGAGGAAGG - Intronic
928659739 2:33489843-33489865 TTGTTGATGAGGACAGAACAAGG + Intronic
929299605 2:40288038-40288060 GTGAGGATCAGGACAGCAGAAGG - Intronic
929884835 2:45869356-45869378 GTTTTAACCAGGACAGAGAATGG - Intronic
931039658 2:58283350-58283372 GTGTTCATGAGGGCAGGGGATGG - Intergenic
931242536 2:60466288-60466310 GAGTTGAGCAGTTCAGAGGAGGG - Intronic
933335177 2:80949092-80949114 TTGTTGCTCGGGACAGAGAAGGG + Intergenic
933832368 2:86221465-86221487 CAGCTGATTAGGACAGAGGAAGG - Intronic
936675970 2:114714416-114714438 GAGCTGATGATGACAGAGGAGGG + Intronic
938776142 2:134543219-134543241 GTCCTGGTCAGGACAGTGGAGGG + Intronic
939184246 2:138841627-138841649 AAGTTAATGAGGACAGAGGAAGG - Intergenic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
940033092 2:149285671-149285693 GTGGAGGTCAGGATAGAGGAGGG - Intergenic
941079161 2:161040480-161040502 GTGTTTCTGAGGCCAGAGGATGG - Intergenic
944187306 2:196963302-196963324 GTGTTCAACAGGACAGGGAAGGG + Intergenic
944487169 2:200219007-200219029 GTGTTCATCAAAACAGAGAATGG + Intergenic
946321169 2:218955367-218955389 AGGGAGATCAGGACAGAGGATGG + Intergenic
946995804 2:225389682-225389704 GTGATGTTCAGGAAAGAGGTTGG + Intergenic
948040693 2:234899316-234899338 GTGTGGTGCAGGACAGAGGGTGG - Intergenic
1171433855 20:25104302-25104324 GTGGTGGAAAGGACAGAGGAGGG - Intergenic
1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG + Intergenic
1173396732 20:42687228-42687250 GTCTTGATCCTGACACAGGAAGG - Intronic
1174541507 20:51293288-51293310 ATGATGATCAGGATTGAGGATGG - Intergenic
1178336355 21:31747009-31747031 GTGTGAATCAGGAGAGAGGGTGG + Intergenic
1179135309 21:38675295-38675317 GTGTGGTTCAGTTCAGAGGAGGG - Intergenic
1179886668 21:44317067-44317089 GCGGTGATCAGGACCAAGGACGG - Intronic
1183251392 22:36732846-36732868 GTGTTTCCCAGGACTGAGGAGGG - Intergenic
1183797455 22:40131534-40131556 GAATTAATCAGGAGAGAGGAGGG - Intronic
1184410111 22:44321496-44321518 GTGTGGGTGATGACAGAGGATGG - Intergenic
1185019577 22:48366363-48366385 GTGTTGGCCATCACAGAGGAAGG + Intergenic
1185142351 22:49109553-49109575 GTGGTGCTGAGGACAGAGGTGGG + Intergenic
950358354 3:12430715-12430737 GAGATGAACAGGAGAGAGGAAGG + Intronic
952116463 3:30187596-30187618 TTGTTGATCAGAACAGGGAAAGG + Intergenic
952189634 3:31009125-31009147 CTGATGATCAGAACAAAGGAAGG - Intergenic
953029904 3:39172519-39172541 TTTTTTATCAGGACAGAGGTGGG + Intergenic
953722947 3:45372240-45372262 GTGATGATTAGGAAAGAGGGAGG + Intergenic
953863274 3:46563425-46563447 GGGTGGATAAGCACAGAGGAGGG - Intronic
954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG + Intronic
956009803 3:64818399-64818421 GTGGTTATCAGGAGAGAGAAGGG - Intergenic
956090907 3:65666134-65666156 ATGTTGATCAGTCCAGAGCAGGG + Intronic
956261954 3:67353427-67353449 GTTTTGATAAGGACAGAGAAGGG - Intergenic
956643145 3:71433367-71433389 GTGTCTATCAGAACAGAGCAAGG + Intronic
960715218 3:120568563-120568585 GTGTAAATCAGGATATAGGATGG + Intergenic
960806959 3:121593250-121593272 GTGTTGATAAATACAGGGGAAGG + Exonic
962297689 3:134206787-134206809 GTGTTGATCATTACTGAGGCTGG + Intronic
966157220 3:176929842-176929864 GAGTTGGTCAGGACCCAGGAGGG + Intergenic
968088971 3:195888360-195888382 GTGGTCCTGAGGACAGAGGACGG + Intronic
968547273 4:1205678-1205700 GTGTTGATCAGGGGAGATGCTGG + Intronic
969487146 4:7478628-7478650 GTGGTGACCAGGTCAGAGCAGGG - Intronic
973337324 4:48969949-48969971 GGGGTGATGAGGGCAGAGGATGG - Intergenic
973560864 4:52134003-52134025 GAGTTCTTCAGGACAGATGAGGG - Intergenic
974026067 4:56734292-56734314 GAGAGTATCAGGACAGAGGAAGG - Intergenic
975481464 4:74885259-74885281 TTCTTTAGCAGGACAGAGGAGGG - Intergenic
976046095 4:80949900-80949922 GTGTAGAGCAGTACAGACGAGGG + Intronic
979579078 4:122334482-122334504 GTCTTGCTCTGGACAGTGGAAGG - Exonic
980257610 4:130402591-130402613 TGGTTGTTCAGAACAGAGGATGG + Intergenic
982905603 4:161066152-161066174 GTAGTGATCAGGCCAGAGTAAGG + Intergenic
983077759 4:163345725-163345747 GTGTTTTTCAGGAAAAAGGAAGG + Exonic
984829308 4:183956963-183956985 GTGGTGTTCTGGACACAGGAAGG + Intronic
985921774 5:2983214-2983236 GTGCTGGCCAGGGCAGAGGAGGG + Intergenic
986735116 5:10662632-10662654 GTTTTGAGCAGGACAGTGGCAGG - Intergenic
992843276 5:80717649-80717671 GTGTTGGTCAGGACACAGAGAGG - Intronic
993252084 5:85540521-85540543 GTGTTTCTTATGACAGAGGAAGG + Intergenic
994306306 5:98209283-98209305 GTGTTCATCAGGAAAGACTAAGG - Intergenic
995021373 5:107370842-107370864 AACTTGATCAGGGCAGAGGATGG + Intergenic
997802933 5:136885051-136885073 GTGTAGATCATGACAGATGCAGG - Intergenic
998365265 5:141626489-141626511 GTGTTGAGCAGAACAGAGGGGGG - Intronic
998384647 5:141749784-141749806 GTGGTGAGGAGGACAGAGGCTGG + Intergenic
999788232 5:154911651-154911673 GAGTTGATCAGGATTGAGCAAGG - Intronic
1000055600 5:157603439-157603461 GTGATGCTGAGGGCAGAGGAAGG + Intergenic
1001248854 5:170129447-170129469 TTGTTGCTTAGGACTGAGGAGGG + Intergenic
1001595819 5:172898121-172898143 GTGTTGAGCAGGAGAGTGGGTGG - Intronic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002905488 6:1445552-1445574 GTGCTGATCAGAACGGAAGAAGG + Intergenic
1003267243 6:4576513-4576535 GTGTCCATCCTGACAGAGGAAGG + Intergenic
1004206082 6:13592693-13592715 GGGTTACCCAGGACAGAGGAAGG - Intronic
1006247494 6:32752092-32752114 TTGTTAATCAGGATATAGGAAGG + Intergenic
1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG + Exonic
1006795285 6:36728525-36728547 ATGTTTATCAGCAGAGAGGAAGG + Intronic
1006973919 6:38078703-38078725 GTGTTGACCGGGACTGAGGTTGG - Intronic
1007461193 6:42020426-42020448 GTGTTGATCAGGTCCCCGGAAGG + Intronic
1008519202 6:52346794-52346816 GTTTAGACTAGGACAGAGGAAGG + Intergenic
1011207724 6:84918347-84918369 GTGTGTATCAGGGGAGAGGATGG + Intergenic
1011777543 6:90748454-90748476 GGGTTGGTCTGGTCAGAGGAGGG + Intergenic
1011844121 6:91541349-91541371 GTGTACATCTGGACAGAAGAGGG + Intergenic
1015389699 6:132667762-132667784 GGGATGAACAGGAAAGAGGAAGG - Intergenic
1017364477 6:153618539-153618561 GTGTTAACCAGGACACAAGAAGG + Intergenic
1018282606 6:162203783-162203805 GAGTTGATTAGGAGAGAGAAAGG - Intronic
1021813317 7:24424556-24424578 GTGGTGATCATGGAAGAGGAGGG + Intergenic
1022754851 7:33276755-33276777 TTGTTGATCAGGACAAAAGCAGG - Intronic
1023754335 7:43402064-43402086 GTGGTGAGCTGGAAAGAGGATGG - Intronic
1024611185 7:51065673-51065695 GTGCTGATGACGACAGAGGCTGG - Intronic
1026175372 7:67991887-67991909 CTGTTGATCTGGGCAGAGGCTGG - Intergenic
1027780796 7:82517561-82517583 GTGTTCATTAGGACACAGGGTGG + Intergenic
1029519481 7:101051047-101051069 GTGTGGATCATGGCAGAAGAGGG + Intronic
1030322834 7:108187450-108187472 GTGTCAATCAAGACAGGGGAGGG - Intronic
1030849335 7:114463354-114463376 GTGTTGAACAGCAAAGAGTATGG - Intronic
1031118060 7:117689750-117689772 ATGTGAATCAGGACAGAGAAAGG + Intronic
1032495505 7:132358819-132358841 GGCTTGCTCAGGACAGAGCAGGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1036565048 8:9931327-9931349 GTGTAGATTATGCCAGAGGATGG + Intergenic
1036826169 8:11977801-11977823 GTGTTGTTCAGGGCAGCGGAGGG + Intergenic
1037746126 8:21646405-21646427 GTGTTGATCAGGGCATAGGTGGG - Intergenic
1038507283 8:28095451-28095473 GTGGTGGTCATGGCAGAGGAAGG - Intronic
1041198527 8:55426015-55426037 GTGTTGGTGAGGAACGAGGAGGG - Intronic
1042163690 8:65923902-65923924 GTTTTGAGCTGGGCAGAGGAAGG + Intergenic
1042978486 8:74498817-74498839 GTGGGGAGCAGGACAGAGAAAGG - Intergenic
1043052080 8:75396739-75396761 GTGGTGAGAAGGAAAGAGGAGGG - Intergenic
1047849628 8:128842535-128842557 GAGCTCCTCAGGACAGAGGATGG + Intergenic
1048942363 8:139412479-139412501 TTGTAGATCTAGACAGAGGAGGG - Intergenic
1052228755 9:26121490-26121512 TCCTTGAACAGGACAGAGGATGG + Intergenic
1053303302 9:36966727-36966749 TTGATGAGCAGGAGAGAGGAAGG + Intronic
1054979250 9:71184824-71184846 GTGTTGCTTAGGCCAGAGGAAGG + Intronic
1056363474 9:85881409-85881431 GTGATGGTGAGGACAGGGGATGG - Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058552467 9:106129481-106129503 GTGTTGGTGAGGGCAGAGTAGGG + Intergenic
1058640584 9:107079824-107079846 GTGTAGAACAGGACAGATGTGGG + Intergenic
1058745871 9:107990051-107990073 ATAGTAATCAGGACAGAGGAGGG + Intergenic
1059310430 9:113385151-113385173 GTGTTGATGATGACAGAACAAGG + Intergenic
1059756045 9:117294403-117294425 TTGTTGAAGAGGAGAGAGGAGGG + Intronic
1062509470 9:136897017-136897039 CTGATGTTGAGGACAGAGGAAGG - Intronic
1186036441 X:5428721-5428743 GTGTTAATCAGCTCAGTGGAAGG + Intergenic
1192265940 X:69538326-69538348 GGGTGGAACAGGACAGTGGAGGG - Intergenic
1197969187 X:132097119-132097141 GTGAGGATCTGGAGAGAGGATGG - Intronic
1199656432 X:149999616-149999638 GTGCTGAACAGGTCAGAGGAAGG - Intergenic
1199676636 X:150195102-150195124 GTGTGGAGCAGGAAAAAGGAGGG + Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200248854 X:154541675-154541697 GTGGTCCTCAGGAAAGAGGAGGG - Intronic