ID: 1077090891

View in Genome Browser
Species Human (GRCh38)
Location 11:777727-777749
Sequence GCGCAGTCTGAGCGCGCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077090882_1077090891 15 Left 1077090882 11:777689-777711 CCAATAGGTAGGGTCGCGAGGGT 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1077090891 11:777727-777749 GCGCAGTCTGAGCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 60
1077090884_1077090891 -8 Left 1077090884 11:777712-777734 CCTCCCCGGCCGCATGCGCAGTC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1077090891 11:777727-777749 GCGCAGTCTGAGCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 60
1077090877_1077090891 26 Left 1077090877 11:777678-777700 CCTGGCAGGGGCCAATAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077090891 11:777727-777749 GCGCAGTCTGAGCGCGCGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077090891 Original CRISPR GCGCAGTCTGAGCGCGCGCG GGG Intronic