ID: 1077091102

View in Genome Browser
Species Human (GRCh38)
Location 11:778627-778649
Sequence CCGCGCCCGGCGGAGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 184}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077091102_1077091108 7 Left 1077091102 11:778627-778649 CCACTGGCCTCCGCCGGGCGCGG 0: 1
1: 0
2: 4
3: 19
4: 184
Right 1077091108 11:778657-778679 CGCTTGTTATCCCAACACTTTGG 0: 2
1: 332
2: 15805
3: 161958
4: 292660
1077091102_1077091116 24 Left 1077091102 11:778627-778649 CCACTGGCCTCCGCCGGGCGCGG 0: 1
1: 0
2: 4
3: 19
4: 184
Right 1077091116 11:778674-778696 CTTTGGGAGGCCCAGGCGGGTGG 0: 800
1: 60242
2: 169850
3: 182773
4: 122878
1077091102_1077091110 11 Left 1077091102 11:778627-778649 CCACTGGCCTCCGCCGGGCGCGG 0: 1
1: 0
2: 4
3: 19
4: 184
Right 1077091110 11:778661-778683 TGTTATCCCAACACTTTGGGAGG 0: 118
1: 23000
2: 322751
3: 260042
4: 138241
1077091102_1077091109 8 Left 1077091102 11:778627-778649 CCACTGGCCTCCGCCGGGCGCGG 0: 1
1: 0
2: 4
3: 19
4: 184
Right 1077091109 11:778658-778680 GCTTGTTATCCCAACACTTTGGG 0: 5
1: 721
2: 28052
3: 261445
4: 274834
1077091102_1077091115 21 Left 1077091102 11:778627-778649 CCACTGGCCTCCGCCGGGCGCGG 0: 1
1: 0
2: 4
3: 19
4: 184
Right 1077091115 11:778671-778693 ACACTTTGGGAGGCCCAGGCGGG 0: 202
1: 12165
2: 168695
3: 259721
4: 204478
1077091102_1077091114 20 Left 1077091102 11:778627-778649 CCACTGGCCTCCGCCGGGCGCGG 0: 1
1: 0
2: 4
3: 19
4: 184
Right 1077091114 11:778670-778692 AACACTTTGGGAGGCCCAGGCGG 0: 202
1: 11974
2: 164355
3: 182679
4: 106344
1077091102_1077091112 17 Left 1077091102 11:778627-778649 CCACTGGCCTCCGCCGGGCGCGG 0: 1
1: 0
2: 4
3: 19
4: 184
Right 1077091112 11:778667-778689 CCCAACACTTTGGGAGGCCCAGG 0: 288
1: 16780
2: 223938
3: 266387
4: 169708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077091102 Original CRISPR CCGCGCCCGGCGGAGGCCAG TGG (reversed) Intronic
900362165 1:2294424-2294446 CCCCGCACGGGGGAGGCCAGCGG - Intronic
900393452 1:2443682-2443704 CCGCGCCGGGAGGGGGCCGGGGG - Intronic
900408793 1:2503757-2503779 CCGCGCCCGGGGGATGCCTCGGG + Intronic
900460909 1:2801780-2801802 CAGCGCCCCGCTGTGGCCAGAGG + Intergenic
902592923 1:17487922-17487944 CCACGCCCGGCCTAGGCTAGGGG + Intergenic
902990853 1:20186184-20186206 CCAGGCCTGGCGGAGGCCAAGGG - Intronic
905108425 1:35577445-35577467 CCGCACTCGGCGGAGGCCGAAGG - Intronic
905182271 1:36174846-36174868 CCGGGCCCGGCAGGAGCCAGTGG - Intronic
907540879 1:55214901-55214923 CCGGGCCCGGCGGGGGCCCGCGG - Exonic
907689222 1:56645552-56645574 CCGCGCCCGCCGGAGGCCCGGGG - Intronic
911079008 1:93909568-93909590 CCACGCCCGCCGCAGGCCAAGGG - Intergenic
915439418 1:155935522-155935544 CCGCGCCCTGCCGAGGCTAAAGG + Intergenic
916414095 1:164576633-164576655 CTGCTCCCGGCGGCGGCCCGAGG + Intronic
923152574 1:231246877-231246899 ACGCGCCCGGCCGAATCCAGTGG - Intronic
1062855366 10:777411-777433 CCACGCCGGGGGGAGGCCTGTGG - Intergenic
1062855403 10:777508-777530 CCACGCCGGGGGGAGGCCTGTGG - Intergenic
1062855440 10:777608-777630 CCACGCCGGGGGGAGGCCTGTGG - Intergenic
1062855458 10:777657-777679 CCACGCCGGGGGGAGGCCTGTGG - Intergenic
1062855476 10:777706-777728 CCACGCCGGGGGGAGGCCTGTGG - Intergenic
1062855494 10:777755-777777 CCACGCCGGGGGGAGGCCTGTGG - Intergenic
1062855512 10:777804-777826 CCACGCCGGGGGGAGGCCTGTGG - Intergenic
1062855530 10:777853-777875 CCACGCCGGGGGGAGGCCTGTGG - Intergenic
1062855548 10:777902-777924 CCACGCCGGGGGGAGGCCTGTGG - Intergenic
1062855566 10:777951-777973 CCACGCCAGGGGGAGGCCTGTGG - Intergenic
1065533665 10:26697856-26697878 GCGCGCCCGGCGGGGCTCAGAGG + Intronic
1065660276 10:27998913-27998935 CGGCGCCCGGGGGAGGGCACGGG - Intronic
1067452470 10:46390759-46390781 CCGGGCCAGGTGCAGGCCAGGGG + Intronic
1067584762 10:47468996-47469018 CCGGGCCAGGTGCAGGCCAGGGG - Intronic
1069191304 10:65494631-65494653 CCGCGCCCGGCCCGGACCAGTGG + Intergenic
1072454197 10:95561617-95561639 CCGTTACCGGCGGAGGCCGGCGG - Intergenic
1074586013 10:114768257-114768279 CCGCGCCCGGCGGGTCCCTGCGG - Intergenic
1077077575 11:708447-708469 CTGCCCCTGGGGGAGGCCAGAGG + Intronic
1077091102 11:778627-778649 CCGCGCCCGGCGGAGGCCAGTGG - Intronic
1077613021 11:3656222-3656244 CCGCGCCCGGCCCAGGGAAGTGG + Intronic
1078128861 11:8594988-8595010 CTGCGCCCGGCCTAGTCCAGTGG - Intergenic
1078527201 11:12110379-12110401 CCGCACAGGGCGGAGACCAGGGG - Intronic
1080540353 11:33258176-33258198 CCGCGCCTGGCCGGGGCCCGGGG + Intronic
1083039099 11:59668998-59669020 CGGCGTACGGCGGCGGCCAGGGG - Intergenic
1083457392 11:62788110-62788132 CCGCGCCCGGCGGATCTCTGAGG - Intronic
1083657182 11:64235111-64235133 CCGCCCCCGGCGGTGCCCAGGGG - Intronic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1083911648 11:65713348-65713370 CCGGCCTCGGCGCAGGCCAGCGG + Exonic
1083939503 11:65888158-65888180 CCCCGCCCCGCCGACGCCAGAGG + Intronic
1083997225 11:66278429-66278451 CCGCGCCGGGCGGCGGCCCGGGG - Exonic
1085784809 11:79440094-79440116 CAGCGCCCGACGGGGGCCTGGGG + Intronic
1087713749 11:101583531-101583553 CCGCTCCCGGGGGAGCCGAGTGG + Exonic
1089557191 11:119321030-119321052 TCCCGCCCGGCGGAGGCAGGGGG + Intronic
1089729411 11:120511389-120511411 CGGCGCCCGGCAGAGGCTAGGGG - Intergenic
1091446434 12:546381-546403 CAGCACCCGGCCAAGGCCAGAGG - Intronic
1096717370 12:53499531-53499553 CCGGGTCCGGTGGAGGGCAGCGG - Intronic
1096741152 12:53695164-53695186 CCGGGCCCTGCGGAGGCCGAAGG - Intergenic
1097794031 12:63843873-63843895 CCCCGCCTGGCGGAGCCCCGAGG + Intergenic
1103071879 12:117951196-117951218 CCGCGCCCGGCGGCAACCAGTGG + Intronic
1104977738 12:132559860-132559882 CCGCGCCCGCCGCCGGCCCGGGG - Intronic
1105756174 13:23466442-23466464 CCGCGCCCGGAGGAAGCCCACGG - Intergenic
1112494764 13:99896042-99896064 CCGAGCCCTGCGGAGCCCCGAGG + Exonic
1115850051 14:37583957-37583979 CCGCGCCCCCCCGAGCCCAGGGG + Intergenic
1117143251 14:52810853-52810875 CCATGCCCGGCGGAGCACAGGGG + Intergenic
1118621429 14:67618007-67618029 CCGCGCCCAGCGGAAGCAAGAGG + Intergenic
1118725780 14:68628296-68628318 CCGCGCCCCGGGGCGGCCCGAGG - Intronic
1119779989 14:77271050-77271072 CCCCGCCGGGCGGAGGCACGGGG - Exonic
1120881315 14:89417075-89417097 GCGCGCCCGGCGGACGCCGCAGG - Intronic
1121313123 14:92945840-92945862 CAGCGCCGGGCAGAGGCCTGGGG - Intronic
1121569547 14:94937014-94937036 CCGGGCCAGGCGCAGGCCACTGG + Intergenic
1121776180 14:96592675-96592697 CGGCGCGGGGCGGAGGGCAGGGG - Intergenic
1122089579 14:99329311-99329333 CCGCGCCCGGCCAAGGAAAGAGG - Intergenic
1123007913 14:105333305-105333327 CCCCGCCTGGGGCAGGCCAGGGG - Intronic
1125503357 15:40252861-40252883 CCGCGCCGGGCGGGCGCCCGCGG - Exonic
1125524806 15:40368140-40368162 CCGCGGCCTGCGGAGGGCGGCGG + Exonic
1125723280 15:41855354-41855376 CTGCGGAGGGCGGAGGCCAGGGG - Exonic
1127815283 15:62603180-62603202 CCGCGCCCGGCCGAGGCGTTTGG + Intronic
1129524274 15:76204105-76204127 CCTCGCCCGGCCCAGCCCAGCGG + Exonic
1130014595 15:80176749-80176771 GCCCGCCCGGGGGAGGCCACTGG + Intronic
1130261332 15:82355915-82355937 CTGCGACCGTCGGAGGCGAGCGG + Intergenic
1130279903 15:82513103-82513125 CTGCGACCGTCGGAGGCGAGCGG - Intergenic
1130471278 15:84229289-84229311 CTGCGACCGTCGGAGGCGAGCGG - Intergenic
1130478772 15:84343860-84343882 CTGCGACCGTCGGAGGCGAGCGG - Intergenic
1130492998 15:84444271-84444293 CTGCGACCGTCGGAGGCGAGCGG + Intergenic
1130593573 15:85233916-85233938 CTGCGACCGTCGGAGGCGAGCGG - Intergenic
1131517578 15:93089246-93089268 CCGCGCTCGGCGGCGGGCGGGGG - Intergenic
1132498832 16:275867-275889 CTGCGCCCGGGGGCGGCCGGGGG + Exonic
1132600068 16:769261-769283 CCGGGCCCTGCGGAGGGCTGGGG - Intergenic
1132932960 16:2468102-2468124 GCGCGCTCGGCGGAGGCGAAGGG + Intergenic
1136220181 16:28823440-28823462 CCGCTCCCGGCAGCGGCCACAGG - Exonic
1136535074 16:30894247-30894269 CCGCTCTCGGCGGCGGGCAGGGG - Exonic
1141760500 16:86025858-86025880 CCACCCCCGGGGGAGGACAGAGG + Intergenic
1141839933 16:86567891-86567913 CCGCCCCCGGCGGCGTCCAAGGG + Exonic
1142319886 16:89374523-89374545 CAGCGGCCGGCAGAGGCCATCGG - Intronic
1142421440 16:89972829-89972851 CCGCGGCCGGCGCAGGCGAATGG - Intergenic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1142848254 17:2692315-2692337 CCAAGGCCGGCGGAGGCCTGCGG - Intronic
1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG + Intergenic
1144806615 17:17972178-17972200 CGGCGCCCGGCGGAGGCCCGCGG + Intronic
1146797879 17:35795550-35795572 CGGCTCCCGGCGAAGGGCAGCGG - Exonic
1146955592 17:36934941-36934963 GAGCGACCGGCGGAGGCCGGCGG + Intergenic
1147168340 17:38604904-38604926 CCTCCCCCTGCAGAGGCCAGGGG - Intronic
1147393312 17:40122784-40122806 CCGCCCTGGGAGGAGGCCAGCGG - Intronic
1148568375 17:48646972-48646994 GCGCGCCGCGGGGAGGCCAGAGG + Intergenic
1149461558 17:56833783-56833805 CCGCGCCGCGCGGGGCCCAGGGG - Exonic
1151854408 17:76710792-76710814 GCGCCCCCGGCCGAGGCCACCGG - Exonic
1152175137 17:78782287-78782309 CCGAGCCGGGCTGAGGCGAGCGG - Exonic
1153794448 18:8609629-8609651 CCGCGCGCGGCGGAGGCCGAGGG + Exonic
1156350569 18:36298087-36298109 CCGCGCCCAGCCCAGCCCAGGGG - Intronic
1157446336 18:47749278-47749300 CGGCGCGCGGCGGCCGCCAGGGG - Intergenic
1160801279 19:970867-970889 CCCCGCCCGGCTGTGGTCAGAGG + Intronic
1160824193 19:1071722-1071744 TCAGGCCCGGCGGCGGCCAGCGG + Intronic
1160887109 19:1355155-1355177 CCCCGCCCGGCGGAACCGAGGGG - Intronic
1161398145 19:4055530-4055552 CCGCGCCAGGCCGAGGCCAGGGG - Intronic
1161516764 19:4700731-4700753 CTGCGCCCTCCGGAGGCCAATGG + Intronic
1162744897 19:12792709-12792731 CTGCTCCCGGAGGAGGCCGGCGG - Exonic
1163848195 19:19649364-19649386 CAGAGCAGGGCGGAGGCCAGAGG - Intronic
1165495005 19:36147474-36147496 CCGTGCCCAGCCGAGGCCAAGGG - Intronic
1167539164 19:50074374-50074396 CCTCCCCCGGGGGAGGGCAGAGG + Intergenic
1168544717 19:57240794-57240816 CCGGGCCCGGCGCAGGGAAGGGG + Intronic
1168659426 19:58154705-58154727 CCGCCCCAGGCGGAGGTCGGGGG + Intronic
928122946 2:28596971-28596993 CCGCGCCTGGCCCAGGCCAATGG - Intronic
928170153 2:28998284-28998306 CCGCTCCAGGATGAGGCCAGGGG - Intronic
929033886 2:37672551-37672573 CCGGCCCCGGCGGAGGGGAGGGG - Intronic
929537823 2:42794652-42794674 CACCACCCAGCGGAGGCCAGGGG - Intergenic
929539579 2:42809977-42809999 CCCCGGCCGGGCGAGGCCAGGGG - Intergenic
931719544 2:65056912-65056934 CCACGCCCGGGAGAGGCCTGAGG - Intronic
934678280 2:96265424-96265446 GCGCGCCCCGCGGAGGTCGGCGG - Exonic
934954716 2:98608235-98608257 CCTGGCTCGGCGGAGGGCAGCGG - Intronic
937046087 2:118852786-118852808 CTGCGCCCGGCGCGGGCCTGTGG - Intergenic
937357258 2:121205844-121205866 CCGGGCCTGGGGGTGGCCAGGGG - Intergenic
941104916 2:161341172-161341194 GCGCCCCCGGCCGAGGCCACCGG - Intronic
942459105 2:176157416-176157438 CCGCGCCCGCCGGGGGCCGGGGG - Intronic
942578637 2:177392885-177392907 CCGCGCCGGGCGGAGGCTGCGGG + Exonic
944433215 2:199659346-199659368 CCGCGCCCGGCGGCGGCTGGGGG - Intergenic
946500290 2:220240023-220240045 CAGAGCCCAGCAGAGGCCAGAGG - Intergenic
948577797 2:238965460-238965482 CCGGGCCCGGTGGAGGCAGGAGG - Intergenic
948596282 2:239081732-239081754 CCGCGCCGGGCAAAGGACAGTGG + Intronic
1168878066 20:1184986-1185008 CCGGACCAGGCGGAGGCCCGGGG + Intronic
1169327423 20:4686897-4686919 CCGCGCCCTGCGGAGCCCGCTGG - Intronic
1170303946 20:14917217-14917239 CCCCTCCCAGCGGAGGCCTGAGG + Intronic
1172903980 20:38355425-38355447 CCAAGCTCGGGGGAGGCCAGAGG - Intronic
1173243491 20:41317808-41317830 CCCCGCCCCGCGGCCGCCAGAGG - Intergenic
1175108072 20:56628594-56628616 CCGCGGCTGGCTGAGGCCAGGGG - Intergenic
1175784991 20:61706721-61706743 CCGAGCCCGCTGCAGGCCAGTGG + Intronic
1175859497 20:62142887-62142909 ACGCGCCCGGCCGGGGCCAGGGG + Intronic
1179828884 21:43983624-43983646 CCTCGCTCGGCGTGGGCCAGGGG - Exonic
1180843759 22:18970802-18970824 CCGCGCCAGGCTGGGGCCAAGGG + Intergenic
1181696047 22:24593179-24593201 CCGCGCCGGAGCGAGGCCAGTGG + Intronic
1183486384 22:38089460-38089482 CCGCCCCCCGCGGGGGCCCGGGG - Intronic
1184086788 22:42270361-42270383 CCGCCCCCGGCGGAGGCCGAGGG - Intronic
1185055512 22:48576668-48576690 CCGCGCTCGGCTGAGGCTCGTGG + Intronic
1185321393 22:50201640-50201662 CCGCGCCGGGCGGAGGGAAGGGG - Intronic
949260374 3:2098368-2098390 CCGCGTCTCCCGGAGGCCAGAGG + Intergenic
949598929 3:5577797-5577819 CCGCGCCCGGCCGGGGTTAGTGG + Intergenic
951543737 3:23806370-23806392 CCGGGCCCCTCGGTGGCCAGTGG - Intronic
961236884 3:125375056-125375078 CCGGGCCCGGGGGAGGGCGGGGG - Intronic
963081864 3:141402294-141402316 CCGCCCCCGGCGCGGGGCAGAGG - Intronic
964870272 3:161306222-161306244 CCGCGCCCAGCTGTGCCCAGCGG + Intergenic
967245650 3:187483909-187483931 CCGCACCCGGCCCAGACCAGGGG - Intergenic
968636936 4:1685391-1685413 CCGAGCCCCACGGTGGCCAGGGG - Intergenic
968652800 4:1766854-1766876 CCGCGCCCGCCGGAGCCAGGAGG - Intergenic
968756399 4:2418380-2418402 CCGGGCCCGGCTGAGGCGCGGGG + Exonic
969330336 4:6470981-6471003 CGGAGCCCCGCGGAGGCCCGGGG - Intronic
969702160 4:8773659-8773681 GCCCGCCTGGTGGAGGCCAGAGG + Intergenic
973931067 4:55793688-55793710 CCGCGCCCGCCCGGGGCGAGGGG - Intergenic
974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG + Intergenic
976751875 4:88457385-88457407 CAGCGCGCGGTGGAGGCCCGCGG - Exonic
979278195 4:118836199-118836221 CCCCGCCCCGCGGCGGCCGGTGG - Intronic
984734802 4:183099180-183099202 CCGCGACCCTCGGCGGCCAGAGG + Intergenic
997395057 5:133553100-133553122 CCGCGCCCCCTGGAGGTCAGAGG - Intronic
1002524649 5:179808135-179808157 ACCCGCCCGGGGGAGGCCCGAGG + Intronic
1003354538 6:5354801-5354823 CCGCGCCCGGCCTATGCTAGTGG + Intronic
1003898269 6:10628728-10628750 CCACGCCCGGCCCAAGCCAGAGG - Exonic
1004069892 6:12288498-12288520 AAGCGCACAGCGGAGGCCAGGGG + Intergenic
1005049045 6:21666698-21666720 CCCCGCCCTTCGGAGGGCAGAGG + Intergenic
1005648866 6:27867662-27867684 CCGCGAGCGGCGGCGGCCAGAGG - Intergenic
1006337489 6:33428102-33428124 CCGCCCCCCGGGGGGGCCAGGGG - Intronic
1007272840 6:40651220-40651242 CCCAGCCCAGGGGAGGCCAGAGG + Intergenic
1007701909 6:43770757-43770779 CCCCGGCCGGCGGCGGACAGTGG + Exonic
1007774607 6:44217984-44218006 CCCCTCCCGCCTGAGGCCAGAGG - Intergenic
1010926726 6:81753333-81753355 CCGCGCACGCCCGAGGCCCGTGG - Intergenic
1013211787 6:107993427-107993449 CCTCGCCCGGCCGATGGCAGGGG + Intergenic
1016328180 6:142926828-142926850 CCGCGCCCGGCGGCCGCCGCAGG - Intronic
1017446373 6:154510423-154510445 CCGTGCCGAGCCGAGGCCAGGGG - Exonic
1023049072 7:36235496-36235518 CCGGGCCCAGCCAAGGCCAGAGG - Intronic
1026935770 7:74254447-74254469 TCGCGCCCGGCGGAAGCCAGGGG - Intronic
1027189134 7:75987811-75987833 CTGGGCCGGGCGGAGGACAGAGG + Intronic
1028622199 7:92836686-92836708 CAGCGCCGGCCGGAGCCCAGCGG - Intergenic
1029735731 7:102464896-102464918 CCGCGCCGGGCGGGGGCACGAGG + Intergenic
1033219495 7:139518930-139518952 CCGCGCCCGGCCTAGGGCGGGGG + Intergenic
1034147013 7:148883417-148883439 CCGCGACCGCCGGAGCTCAGGGG + Intronic
1034188335 7:149195868-149195890 CCGCGCCCAGGCGAGGCCCGAGG + Intronic
1035206746 7:157298594-157298616 CAGCGCCCCCCAGAGGCCAGAGG + Intergenic
1035266817 7:157693693-157693715 CGGCTCCGGGCAGAGGCCAGAGG + Intronic
1041689756 8:60678224-60678246 GCGCGGCCGGCGGCGGCCGGGGG - Intergenic
1043063000 8:75528994-75529016 CCGCGCCCGGCAGAGATCTGAGG - Intronic
1044698839 8:94948977-94948999 CCGGGCCCGGCGGCGGCGAGGGG + Intronic
1047247897 8:123160588-123160610 CTGAGCCCGGCGGCCGCCAGGGG + Intergenic
1049707467 8:144049528-144049550 CAGCGACCGGCCGAGGCCATTGG + Intergenic
1049746883 8:144266763-144266785 GGGCGCCCGGCGGAGGGCGGGGG + Exonic
1049765480 8:144353416-144353438 CAGCGCCAGGGGGTGGCCAGTGG + Exonic
1054826541 9:69579257-69579279 CTGCTCCCGGTGCAGGCCAGGGG - Intronic
1058439208 9:104991742-104991764 CCGCGGCGGGCGGCGGGCAGCGG + Intergenic
1060599515 9:124868892-124868914 CCCGGCCCCGCTGAGGCCAGGGG + Exonic
1062381287 9:136288106-136288128 CGGAGCCCGACGGTGGCCAGTGG + Intronic
1062558850 9:137130162-137130184 CCGCGCCCGGGTGAGGCCCTGGG - Intergenic
1062600244 9:137316091-137316113 CCGCGCCCCGCCGAGGCTGGGGG - Intronic
1185456332 X:312689-312711 ACTCGCCCGGGGGAGGGCAGGGG - Intronic
1185485142 X:476392-476414 CCGCCCCCCGCAGAGGTCAGGGG - Intergenic
1193990848 X:88305246-88305268 CCGCGCCTGGCCGAGGCGGGTGG - Intergenic
1195894577 X:109732945-109732967 CCGGCCCCAGCGGAGGCGAGCGG + Intronic
1198276361 X:135098542-135098564 TCGCGCTCGGCGGCGGCCCGAGG - Intergenic
1200092930 X:153644253-153644275 CCCGGCCCGGCGGAGGCCCGGGG + Intronic