ID: 1077094314

View in Genome Browser
Species Human (GRCh38)
Location 11:792858-792880
Sequence AGGGCGCATTGGTGAGGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077094314_1077094320 -8 Left 1077094314 11:792858-792880 CCCCGCCCTCACCAATGCGCCCT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1077094320 11:792873-792895 TGCGCCCTGCATCCTGCAGCTGG 0: 1
1: 0
2: 1
3: 19
4: 184
1077094314_1077094324 11 Left 1077094314 11:792858-792880 CCCCGCCCTCACCAATGCGCCCT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1077094324 11:792892-792914 CTGGATCTTCAGCATCTCCATGG 0: 1
1: 0
2: 1
3: 27
4: 365
1077094314_1077094325 12 Left 1077094314 11:792858-792880 CCCCGCCCTCACCAATGCGCCCT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1077094325 11:792893-792915 TGGATCTTCAGCATCTCCATGGG 0: 1
1: 0
2: 2
3: 13
4: 187
1077094314_1077094326 17 Left 1077094314 11:792858-792880 CCCCGCCCTCACCAATGCGCCCT 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1077094326 11:792898-792920 CTTCAGCATCTCCATGGGCGTGG 0: 1
1: 0
2: 1
3: 11
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077094314 Original CRISPR AGGGCGCATTGGTGAGGGCG GGG (reversed) Exonic
900741124 1:4331557-4331579 AGGGCTCAGCGGGGAGGGCGTGG - Intergenic
901483031 1:9539341-9539363 AGCGCTCATTGGTTAGGACGCGG - Intergenic
902612084 1:17603300-17603322 AGGGCGCCTTGGAGGGGGTGGGG + Intronic
903952572 1:27004901-27004923 AGGGAGCATTTGCGGGGGCGGGG - Intergenic
903974054 1:27137831-27137853 GGGGCACATTGGGGAGGGAGGGG - Intronic
904405655 1:30286458-30286480 ACAGCTCACTGGTGAGGGCGAGG - Intergenic
904458634 1:30662427-30662449 ACAGCTCACTGGTGAGGGCGAGG - Intergenic
905629860 1:39512407-39512429 ATGGAGCAGCGGTGAGGGCGGGG + Intronic
905667899 1:39773783-39773805 ATGGAGCAGCGGTGAGGGCGGGG - Intronic
916003130 1:160635368-160635390 CGGGCGCATGGGTGAGTGAGTGG + Intronic
921324541 1:213977892-213977914 AGGGGGCAGTGGTGAGGGGAGGG - Intergenic
922571054 1:226634928-226634950 GGGCCGCAGTGGGGAGGGCGAGG - Intronic
922575664 1:226659324-226659346 AGGGAGCCTTGGTGAGGCCCTGG - Intronic
924527192 1:244863490-244863512 AGGGCGCCGCGGTGAGGGTGGGG - Intronic
1064645244 10:17453895-17453917 AGCGCGCATCGCTGTGGGCGAGG - Intronic
1066281502 10:33922569-33922591 AGGGCACAGTGGTGAAGGGGAGG + Intergenic
1071997771 10:91163709-91163731 GAGGCGCGTTGGGGAGGGCGCGG + Intronic
1073080495 10:100856992-100857014 AGGGAGCAGTCGTGAGGGAGTGG - Intergenic
1073137695 10:101228923-101228945 AGGCCGCACTGGGCAGGGCGCGG + Exonic
1073451981 10:103615461-103615483 AGGGCGCGATGGAGAGTGCGAGG + Intronic
1074833044 10:117263272-117263294 AGGACCCAGTGCTGAGGGCGGGG + Intronic
1076521207 10:131082453-131082475 AGGCAGCATGGGTCAGGGCGGGG + Intergenic
1076890727 10:133281949-133281971 AGGGCGCCTGGGCGAGGGCAGGG - Intronic
1077094314 11:792858-792880 AGGGCGCATTGGTGAGGGCGGGG - Exonic
1078192339 11:9101765-9101787 AGAGCGCATTGGTTAGGCAGGGG - Intronic
1078659573 11:13276634-13276656 AGGGTGGAGTGGTGGGGGCGGGG - Intronic
1081915318 11:46726790-46726812 CGGGCGCATTGTGGAGGGCTCGG + Exonic
1083474487 11:62907080-62907102 AGGGAGCAGTGGTAAGGGAGGGG + Intergenic
1083580908 11:63824807-63824829 AGGGTGCATTGGTGAGACTGGGG - Intronic
1084184664 11:67465132-67465154 CAGGAGCAGTGGTGAGGGCGGGG + Intronic
1084268889 11:68018817-68018839 AGGGCGCAATGATGAGGACCAGG - Exonic
1089196435 11:116696357-116696379 AGGGAGCAGTGGAGAGGGCGGGG - Intergenic
1091449460 12:563327-563349 AGGGCGCAGGGGTGTGGGCAGGG - Exonic
1092180773 12:6445237-6445259 AGGGGGCCTTGGTAAGGGCCAGG + Intronic
1096779172 12:53982336-53982358 AGGGAGCATTTGTGCGGGCCTGG - Intergenic
1097046128 12:56189126-56189148 AGGGCGCAGCAGTGGGGGCGGGG + Intronic
1102650600 12:114439612-114439634 ATGGCGCATTGGCGAGCGCCCGG + Intergenic
1105012082 12:132762361-132762383 AGGGCCCCTTGGTGAAGGAGCGG - Intergenic
1106183524 13:27388067-27388089 AGGGAGCATGGGAGAGGGAGAGG + Intergenic
1106477101 13:30108340-30108362 AGGGCGCAGTGAGGAGGGAGGGG - Intergenic
1107781906 13:43912520-43912542 AGGGCACAATGGTGAGAGGGTGG - Intergenic
1118753697 14:68823584-68823606 AGCGCGCATGGGTGAGTGAGTGG + Intergenic
1121280340 14:92692941-92692963 AGGGCTCATTGGTGGAGGAGAGG + Intergenic
1122075360 14:99231749-99231771 AGGGGGCACTGGGGAGGGCCCGG + Intronic
1122800772 14:104228515-104228537 AGGTGGCAGTGGTGAGGGAGGGG - Intergenic
1122846686 14:104504111-104504133 AGGGCTCTGTGGTGTGGGCGGGG - Intronic
1124372962 15:29113893-29113915 AGGGGGCATTGCTGAGCGAGGGG + Exonic
1125477958 15:40060364-40060386 AGGGAGCAGGGGTGAGGGGGAGG - Intergenic
1129108461 15:73324077-73324099 GGACCGCATTGGTGAGGGGGAGG - Exonic
1136186329 16:28590905-28590927 GGGGCGCATGGATCAGGGCGCGG - Exonic
1138527431 16:57617143-57617165 AGGGAGCATTTGTGAGGTCAGGG - Intronic
1142155467 16:88530973-88530995 AGGCCGCAGAGGGGAGGGCGCGG + Intronic
1146398597 17:32487116-32487138 GGCGCGCATTGCGGAGGGCGCGG + Exonic
1147903716 17:43808686-43808708 AGGGCGCTTATGTGAGGGAGTGG + Intronic
1148835927 17:50465741-50465763 AGGGGTTATTGGTAAGGGCGAGG + Exonic
1152216569 17:79036223-79036245 AGGGCGCAGTGGTGCAGTCGTGG + Intronic
1152878344 17:82801061-82801083 AGGCGCCATTGATGAGGGCGGGG + Intronic
1157552432 18:48590817-48590839 AGGTCTCAGTGGTGGGGGCGGGG - Intronic
1158649499 18:59273227-59273249 AGGGCGCTTTGGAGACGGAGAGG + Exonic
1160983947 19:1828830-1828852 AGCGCCCATTGGTCAGGGCAAGG - Intronic
1161121202 19:2527776-2527798 TGGGCGCACTGGTGGGGGGGGGG - Intronic
1166218915 19:41353184-41353206 AGGGCGCAGTGGTGGAGGGGAGG + Exonic
1166529376 19:43533525-43533547 AGGGCGCAGGGGTTCGGGCGCGG + Intronic
1167077307 19:47257409-47257431 ATGGCCCATGGGTGGGGGCGGGG + Intronic
1167348374 19:48960933-48960955 AGGGCGCGGTGGTGGGGGTGAGG - Exonic
1167367388 19:49061899-49061921 AGGGGGCAATGTTGAGGGTGGGG + Exonic
1168401193 19:56087134-56087156 AGGGCGGACTGGTCAGGGCCAGG - Intergenic
1168724446 19:58573043-58573065 TGAGCGCAGAGGTGAGGGCGGGG - Exonic
927848206 2:26482603-26482625 GGGGAGCACAGGTGAGGGCGTGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
933810026 2:86027370-86027392 AAGGACCCTTGGTGAGGGCGTGG - Exonic
936090532 2:109498966-109498988 AGGGCGCAGTGTGGAGGGCCTGG + Intronic
946415985 2:219539920-219539942 GAGGCGCAGTGGTGAGGGTGCGG + Exonic
947495385 2:230632391-230632413 ACGGCCCATTTGTGAGGGGGTGG + Intergenic
947739092 2:232476791-232476813 AGGGGACATTGGTGAATGCGGGG - Intergenic
948637702 2:239349869-239349891 AGGCCGCACTGGTGAGGGCAGGG - Intronic
1169265852 20:4167008-4167030 AGGGGACATTGCTGGGGGCGGGG + Intronic
1170445341 20:16421031-16421053 AGGGGTCATGGGTGAGGGCTAGG + Intronic
1172187293 20:33038975-33038997 AGGGTGCAGTGGTGATGGGGAGG - Intronic
1172203788 20:33147500-33147522 AGGGGACATTGGTGGGGGCCAGG + Intergenic
1172664696 20:36591071-36591093 AGAGCACATTGGTGGGGGCTGGG - Exonic
1175787575 20:61721707-61721729 AGGGGGCATTGGTGAGGCTTGGG + Intronic
1175992536 20:62796814-62796836 AGGGCGCGTGGGAGGGGGCGGGG - Intronic
1176230052 20:64027969-64027991 AGGGCGCCTGGGAGAGGGAGGGG + Intronic
1179982441 21:44903353-44903375 CGGCCGCATTGGTGAGGCCCAGG - Exonic
1181061678 22:20284884-20284906 AGGGCCCAGTGGATAGGGCGGGG + Intergenic
1182368400 22:29793802-29793824 ATCAAGCATTGGTGAGGGCGTGG + Intronic
1182500580 22:30743825-30743847 AGGGTGCGGAGGTGAGGGCGGGG + Intronic
1183352982 22:37344057-37344079 AGGGGGCATGGGTGGGGGCATGG - Intergenic
1183956253 22:41382191-41382213 GGCGCGCCTCGGTGAGGGCGGGG + Exonic
1184464458 22:44660640-44660662 AGGGCTCAGGGGTGAGGCCGAGG + Intergenic
1185059414 22:48598393-48598415 AGGGGGCAGTGGTGAGGGGCTGG + Intronic
1185135473 22:49069197-49069219 TGCACGCATTGGTGAGGACGGGG - Intergenic
1185419516 22:50727726-50727748 AGGGCGGAGTGGGGAGGGTGTGG + Intergenic
950363526 3:12466739-12466761 AGCAAGCATTGGTGAGGGTGTGG + Intergenic
951906465 3:27712572-27712594 AGGGACCATTGCTGAGGGCCTGG + Intergenic
952501137 3:33963123-33963145 AGAGCACATTGGTAAGGGAGGGG + Intergenic
953902966 3:46853663-46853685 GGGGCCCCTTGGTGAGGGCAGGG - Intergenic
954687018 3:52376603-52376625 AGGGAGCACTGGTGTTGGCGGGG - Intronic
968450014 4:671155-671177 TGGGCTCATTGGGGTGGGCGTGG + Intergenic
968746827 4:2364763-2364785 TGGGCGCCTTGACGAGGGCGCGG - Intronic
968997558 4:3955410-3955432 AGGGCGCCATGGCGTGGGCGGGG + Intergenic
975530213 4:75392716-75392738 GGGCCGCTTTGGTGAGGGAGTGG - Intergenic
979785763 4:124713047-124713069 AGGGCCCAGTGGTGACGGGGAGG - Intergenic
982590734 4:157306183-157306205 AGGGAGCAATGGTGAGGGTAAGG - Intronic
983583764 4:169334792-169334814 AGGCAGCATGGCTGAGGGCGAGG - Intergenic
984895708 4:184537659-184537681 CAGGCGCAGTGGTGAAGGCGGGG + Intergenic
990995639 5:61729838-61729860 AGAGCTCAGTGGTGAGGGCTGGG + Intronic
992089041 5:73301684-73301706 AGAGCGCACTGGAGAGGGAGAGG + Intergenic
999140508 5:149358241-149358263 AGGGCGGCTGGGTGAGGGAGGGG + Intronic
999717179 5:154370625-154370647 AGGGAGCATCGTTGAGGGAGGGG + Intronic
1002377073 5:178796460-178796482 AGGGCTCATTGGTGGGGGTGCGG + Intergenic
1006145857 6:31959204-31959226 AGAGCGACTTGGTGAGGGGGAGG + Exonic
1006312611 6:33271574-33271596 AGGGCCCGCTGGTGAGAGCGCGG - Exonic
1006321433 6:33321829-33321851 AGGCCGCATTGGGGAGTGGGTGG + Exonic
1006599113 6:35214129-35214151 AGGCCGGCTTGGAGAGGGCGGGG + Intergenic
1007399200 6:41594112-41594134 AGGACGCTTGGGCGAGGGCGGGG - Intronic
1011427586 6:87247238-87247260 AGGGGGCGGTGGTGAGGGGGTGG - Intronic
1017199616 6:151738506-151738528 AGCGAGCATTGGTGAGGGTGTGG - Intronic
1019181235 6:170188382-170188404 AGGGCGCTCTGGTAAGGGCAAGG - Intergenic
1020005737 7:4783076-4783098 AGGGGGCCTGGGTGAGGGCACGG - Intronic
1020041098 7:5002286-5002308 AGGCAGGATTGGTGAGGGTGGGG - Intronic
1021628822 7:22623515-22623537 TGGGGGCATTGGGGAGGGAGGGG - Intronic
1023287135 7:38631489-38631511 AGCGCGGAGGGGTGAGGGCGGGG + Exonic
1026955780 7:74375806-74375828 AGGGCACAATGGTGGGGGCCGGG - Intronic
1031966373 7:128031016-128031038 AGGGGGAAGTGGTGGGGGCGGGG + Exonic
1038239414 8:25794848-25794870 AGGGCACACTGGTGGGGGCGGGG - Intergenic
1039752132 8:40488320-40488342 TGGGCGCAGTGATGAGGGAGAGG - Intergenic
1043529109 8:81130202-81130224 AAGGAGCATGGGTGAGGGTGAGG + Intergenic
1049192976 8:141298979-141299001 TGGGGGCACTGGTGAGGGAGAGG - Intronic
1049406443 8:142453677-142453699 AGGGGGCAAGGGGGAGGGCGTGG + Intronic
1056659743 9:88535094-88535116 AGGGCGCAGGAGTGTGGGCGGGG + Exonic
1061665632 9:132159643-132159665 AGGGAGTATTGGTGAGGTGGGGG + Intergenic
1061679475 9:132235900-132235922 AGGGCACAGTGGTGAGGGAGCGG + Intronic
1061802490 9:133120210-133120232 AGGGTGACTAGGTGAGGGCGGGG - Intronic
1062435884 9:136546392-136546414 GGGGCGGAATGGGGAGGGCGAGG + Intergenic
1062483509 9:136763220-136763242 GGGGCGGAGGGGTGAGGGCGGGG + Intronic
1188417820 X:29957744-29957766 AGGGTTCATTGGGGAGGGTGAGG + Intergenic
1190811004 X:53883394-53883416 AGGGCTGGTTGGGGAGGGCGGGG - Intergenic
1192041171 X:67623169-67623191 AGGGCGGATTTATGGGGGCGGGG - Intronic
1195711405 X:107776100-107776122 AGGGCACAAGGGTGCGGGCGGGG - Intronic
1195782244 X:108479066-108479088 AGGGCCCATTGGTGATGACAGGG + Intronic
1200151086 X:153951807-153951829 AGGGCGAATTGGTGCTGGGGTGG - Intronic
1200158856 X:153994174-153994196 AGGGAGCACTGGTGAGGAGGCGG - Intergenic