ID: 1077094513

View in Genome Browser
Species Human (GRCh38)
Location 11:793620-793642
Sequence CTGTGGGGCAGGGGGTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 8, 3: 63, 4: 534}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077094504_1077094513 16 Left 1077094504 11:793581-793603 CCTTCTCGGGGGTGACGAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 1145
Right 1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG 0: 1
1: 0
2: 8
3: 63
4: 534
1077094499_1077094513 28 Left 1077094499 11:793569-793591 CCAGCTTGATGGCCTTCTCGGGG 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG 0: 1
1: 0
2: 8
3: 63
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077094513 Original CRISPR CTGTGGGGCAGGGGGTCAGC TGG Intronic
900122507 1:1054813-1054835 CTGTGCTGCAGGGGGCCTGCCGG + Exonic
900183781 1:1323944-1323966 CTGAGGGTCTGGGGGTCTGCTGG + Intronic
900183841 1:1324104-1324126 CTGGGGGGCTGAGGGTCTGCGGG + Intronic
900183882 1:1324200-1324222 CTGGGGGGCTGAGGGTCTGCGGG + Intronic
900404640 1:2487093-2487115 CTGTGTGGCATGGGGGCAGGTGG + Intronic
900670031 1:3846359-3846381 ATTTGGGGCAGGAGGGCAGCTGG + Intronic
900670373 1:3849637-3849659 ATTTGGGGCAGGAGGGCAGCTGG + Intronic
900680979 1:3915978-3916000 CTGTGGGGCAGGAGCCCACCTGG + Intergenic
900727656 1:4228301-4228323 CTGTGTGGCAGGGTGGGAGCAGG + Intergenic
900759357 1:4460704-4460726 CTGAGGTCCAGGGAGTCAGCGGG + Intergenic
901491436 1:9598290-9598312 CTGTTGGGCAGAGGGGAAGCAGG + Intronic
901642151 1:10698041-10698063 TGTTGGGGCAGGGGGTCAACAGG + Intronic
901664846 1:10820262-10820284 GAATGGGGCAGAGGGTCAGCGGG - Intergenic
902615129 1:17619448-17619470 CTGTGGGGGAGTGGGGCAGGTGG + Intronic
902775360 1:18671124-18671146 CTGTGGGGCAGGAAGGCAGCAGG + Intronic
902786957 1:18738942-18738964 ATGTGGGGCAAGTGGTTAGCGGG - Intronic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
902905361 1:19552684-19552706 CTGAGGGGTAGAGGGTCACCAGG - Intergenic
902997446 1:20237832-20237854 TTGTGGAGCAGGGGGTCAGTGGG - Intergenic
903738285 1:25543928-25543950 CTGCGGGGCAGGGGGTCGGCCGG + Intronic
903795714 1:25927556-25927578 CTGGGAGTCAGGGGGTCAGGGGG + Intergenic
903886202 1:26542530-26542552 CTATGGGGCAGGGGTTGACCAGG - Intronic
904289244 1:29473551-29473573 CTGTGGAGGAAGGGGTCAGGAGG - Intergenic
904441677 1:30535829-30535851 TTGGAGGGCAGGGGGTCAGTAGG + Intergenic
904599880 1:31667450-31667472 CTTGGGGGCAGGGGGGCAGCAGG + Intronic
904645155 1:31960028-31960050 CTGGGGGGCAAGGAGTCAGCAGG - Intergenic
904771535 1:32884065-32884087 CTGAGGGGCAGCTGGGCAGCGGG - Intergenic
904842070 1:33379314-33379336 GTGGGGGGCAGGGGGGCAGTGGG - Intronic
904909325 1:33922186-33922208 CTGTGAGGCAGGGAATCAGCAGG + Intronic
905031396 1:34886286-34886308 CTGGGGGGCAGGGGGTCGGGAGG + Intronic
905254470 1:36671310-36671332 CTCTGGGCCAGTGGGGCAGCAGG - Intergenic
905413730 1:37790620-37790642 CAGTGGAGGAGGGGGTCAGTAGG + Intergenic
906034385 1:42741337-42741359 CTGTGGGGGAGGAAGCCAGCAGG - Intergenic
906607962 1:47184435-47184457 CAGTGGGGCATGGGCTCAGTGGG - Intronic
906730473 1:48076524-48076546 CTGTTGGGCAGCTGGTCAGCCGG + Intergenic
907029137 1:51153429-51153451 CTGTGGGGACTGAGGTCAGCAGG - Intergenic
907469692 1:54665289-54665311 CTGGGGGGTAGGGGGTTGGCAGG - Intronic
908767102 1:67564138-67564160 TTGTGGGGCAGGGAGTAAGCAGG + Intergenic
915917644 1:159950647-159950669 CCATGGGGCAGGGGGTTAGGGGG - Intergenic
915972636 1:160365426-160365448 CTGGGGGGCAGGGGATCAGGTGG - Intergenic
916168907 1:161986155-161986177 AGGTGGGGCAGGGGTTCTGCTGG - Intronic
917623134 1:176818593-176818615 CAGGGGGGCAGTGGGTCAGATGG - Intronic
918068736 1:181119569-181119591 CTGTTGGGCAGGGTGGCTGCAGG + Intergenic
919593922 1:199538175-199538197 CTGTGGGGCAGGGAGCAAGATGG - Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919825561 1:201500693-201500715 CTGTGGGGAAGAGGCTCAGCTGG + Intronic
920228954 1:204457751-204457773 GGGAGGGGCAGGGGGGCAGCTGG + Exonic
920376906 1:205513726-205513748 CTGTGGGGAAGGGGTTCGGAGGG - Intronic
920444280 1:206003607-206003629 CTATGGGTCAGGGGGCCTGCAGG + Intergenic
920451174 1:206062351-206062373 CTCTGGGGCTGGGGGTGATCTGG - Intronic
920822706 1:209396216-209396238 TTGAGGGGCCAGGGGTCAGCAGG + Intergenic
922618273 1:226976124-226976146 CTGTGGGGCTGCGGGACTGCGGG + Intronic
922743845 1:228031994-228032016 CTGTGCTGCATGGGGTCAGAGGG + Intronic
923229567 1:231972332-231972354 CAGAGGGGCAGGGGCTCACCTGG + Intronic
923652923 1:235890493-235890515 CAGAGGGGCAGGGGGTAAGTGGG - Intergenic
923837199 1:237625281-237625303 CTGTGGGGCATGGTGTAGGCAGG + Intronic
1062846908 10:714742-714764 CAGTGGGGGAGGGGGTCACCTGG - Intergenic
1063030077 10:2225710-2225732 CTGTGAGGCAGGAAGTCTGCAGG - Intergenic
1065093453 10:22258667-22258689 CTGAGGGGCAGGTGGTCAGATGG - Intergenic
1065250254 10:23803549-23803571 CTATGGGGCATGAGGACAGCAGG - Intronic
1067058221 10:43064612-43064634 GTGTGGGGGTGGGGGTCACCGGG + Intergenic
1067535328 10:47105197-47105219 CTGTGGACCAGGAGTTCAGCTGG - Intergenic
1067684035 10:48456719-48456741 CTGCGGGGCAGGGATGCAGCCGG - Intronic
1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG + Intronic
1067946594 10:50693231-50693253 CAGGGGGTCAGGGGGTCAGGGGG - Intergenic
1069605526 10:69736729-69736751 CTGGGGAGCAGGGGCGCAGCAGG - Intergenic
1069621659 10:69841060-69841082 AAGTGGGGCAGGGGGGCAGTGGG - Intronic
1069771749 10:70904846-70904868 GGGTGAGGCAGGGCGTCAGCAGG + Intergenic
1069774629 10:70919260-70919282 CCGGGGGGCAGAGGGGCAGCAGG + Intergenic
1069902200 10:71712830-71712852 CTCTGGGGCAGGTGGTGGGCTGG + Exonic
1070753655 10:78978255-78978277 CAGTGGGGCACTGGGTCTGCCGG - Intergenic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1072251266 10:93584066-93584088 CAGTTGGGCAGGGTGTCAGGTGG - Intronic
1072309849 10:94144408-94144430 CTCTAGGGCAAGGGGGCAGCAGG - Intronic
1072450007 10:95532293-95532315 CTGAGGTGCAGGGGGTGTGCAGG - Intronic
1072693177 10:97584729-97584751 CTGTGAGGCAGGGGCTAAGCAGG + Exonic
1072758255 10:98035408-98035430 CTGTGGGGCAGGGGGAAGCCTGG + Intergenic
1073470691 10:103720441-103720463 CAGTGGGGGAGGTGGGCAGCAGG - Intronic
1074078524 10:110150539-110150561 CTGAGGGGAAGGCGGACAGCTGG - Intergenic
1074432245 10:113404030-113404052 GTGTGGGGGAGGGGGCCACCAGG - Intergenic
1075022443 10:118961603-118961625 AGGAGGGGCAGGGGGTCAGGTGG - Intergenic
1075069988 10:119314212-119314234 CTGAGCGGCAGGCGGCCAGCAGG + Intronic
1075322442 10:121502914-121502936 GTGTGGGGCATGGAGTCAGTGGG - Intronic
1075609095 10:123836927-123836949 CTCTGGGACAGGGGCTCACCTGG - Intronic
1076193773 10:128500567-128500589 CTGGGGGGCAGAGGGGCAGGAGG + Intergenic
1076794389 10:132791571-132791593 CTGGGGGGAAGAGGGGCAGCAGG + Intergenic
1076854856 10:133111111-133111133 CTGGCGGGCAGGTGGCCAGCAGG - Intronic
1076930796 10:133530461-133530483 GGGTGGGGCAGGGGTGCAGCTGG - Intronic
1077016821 11:401818-401840 CAGTGGAGCCGGGGGTGAGCGGG - Intronic
1077016853 11:401888-401910 CAGTGGAGCCGGGGGTGAGCGGG - Intronic
1077016897 11:401981-402003 CAGTGGAGCCGGGGGTGAGCGGG - Intronic
1077016929 11:402051-402073 CAGTGGAGCCGGGGGTGAGCGGG - Intronic
1077016961 11:402121-402143 CAGTGGAGCCGGGGGTGAGCGGG - Intronic
1077016991 11:402190-402212 CAGTGGAGCCGGGGGTGAGCGGG - Intronic
1077017023 11:402260-402282 CAGTGGAGCCGGGGGTGAGCGGG - Intronic
1077017067 11:402353-402375 CAGTGGAGCCGGGGGTGAGCGGG - Intronic
1077017099 11:402423-402445 CAGTGGAGCCGGGGGTGAGCGGG - Intronic
1077017131 11:402493-402515 CAGTGGAGCCGGGGGTGAGCGGG - Intronic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077172562 11:1174473-1174495 CTGCAGGGAAGGGGGTCATCGGG - Intronic
1077303097 11:1856124-1856146 CTGTGGGACAGGGTGGCGGCAGG - Intronic
1077914394 11:6601793-6601815 GTGTGTGTCGGGGGGTCAGCTGG - Intronic
1078310991 11:10241987-10242009 CTGTGGGCAAGTGGGTCTGCAGG - Intronic
1078528921 11:12121385-12121407 CTTTGGAGGAGGTGGTCAGCTGG - Intronic
1078576216 11:12504740-12504762 CTGTGTGTCATGGGGTCAGGAGG + Intronic
1079103743 11:17557610-17557632 ATGTGGGGCATGGGGTAGGCAGG + Intronic
1080284830 11:30597999-30598021 CTCTGGGGCAGGGTTTTAGCAGG - Intergenic
1081574165 11:44309147-44309169 CTGCGGGGCTGCGGGACAGCAGG - Intronic
1081710273 11:45211573-45211595 TTGGGGGACAGGGGGACAGCAGG + Intronic
1082563235 11:54643806-54643828 TCGTGGGGTAGGGGGTCAGGGGG + Intergenic
1083039029 11:59668773-59668795 CTGCGGGGCAGGGGGCGGGCTGG - Intronic
1083211950 11:61193772-61193794 CTGGGGGGCAAGGCGGCAGCAGG + Intergenic
1083253246 11:61481783-61481805 CTGTGGGGCAGGGCCCCAGGGGG - Exonic
1083266363 11:61548643-61548665 GTGTGGGGAAGGGTGCCAGCGGG + Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083430826 11:62612867-62612889 GAGTAGGCCAGGGGGTCAGCCGG - Exonic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1084083591 11:66844412-66844434 CATTGGGGCAGGGAGTCAGCGGG + Intronic
1084278574 11:68070593-68070615 CTGAAGTGCAGGGTGTCAGCTGG - Intronic
1085297913 11:75441311-75441333 CTGTGGGGCAGGGGAGAGGCAGG + Intronic
1085482822 11:76836939-76836961 GTGTGGGGCAGAGGGTTAGAGGG - Intergenic
1089046090 11:115503501-115503523 CTGTGGGGCGGGCGGGCTGCGGG + Intronic
1089178280 11:116563753-116563775 CTGCGTGGCAGGGGGTCGGGAGG + Intergenic
1089303357 11:117512081-117512103 CTGTGGGGCCAAGGGTCAGTGGG - Intronic
1089304427 11:117517697-117517719 CAGAGGAGCAGGGGGACAGCAGG - Intronic
1089564694 11:119364384-119364406 CTGCCTGGCCGGGGGTCAGCGGG - Intronic
1089678314 11:120105385-120105407 CTGTGGGGCAGGGGGCTGGAAGG + Intergenic
1089783568 11:120892093-120892115 CTGGGGGGCAGGGGTTCATGTGG + Intronic
1090879455 11:130820873-130820895 CTGAGGGTGAGGAGGTCAGCTGG - Intergenic
1091307044 11:134542940-134542962 CTGTGGGTCAGAGGGTAAGGGGG + Intergenic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1091582192 12:1796814-1796836 CTTGGGTGCGGGGGGTCAGCAGG + Intronic
1092583790 12:9876209-9876231 CCGTGGAGCAGGGGGTGGGCCGG + Intergenic
1092880697 12:12885679-12885701 GTGTGGGGCGGGGGGGCGGCAGG + Intergenic
1096181733 12:49554849-49554871 CTGGGGGTCAGGGGCTGAGCAGG + Intronic
1096618651 12:52848744-52848766 CTGGGGGTCAGGGGGTAGGCTGG - Exonic
1096768498 12:53914873-53914895 GTGTGGGGCAGGGGGTATACGGG - Intergenic
1096791215 12:54046396-54046418 CTGTGGGGGAGGGGGCCTGGGGG + Intronic
1096972756 12:55681161-55681183 CTGTGGGGAATGGGGTAAGTTGG - Intergenic
1097016415 12:55990455-55990477 GTTTGGGGCAGGGGGTAAGGGGG + Intronic
1097182576 12:57179724-57179746 CTGCAGGGCAGTGGGTCAGGAGG - Intronic
1100358145 12:93851224-93851246 CTGTGGGGCAGTGGGCAAGGTGG + Intronic
1100668693 12:96785673-96785695 CTGAGGGGCAAGGGATCACCAGG - Intronic
1102580486 12:113883365-113883387 ATGTGGGTCAGGGTGTCTGCTGG + Intronic
1102699097 12:114823754-114823776 GAGTAGGGCAGGGGGTGAGCAGG - Intergenic
1102883482 12:116504117-116504139 CTGTGGTTTATGGGGTCAGCTGG + Intergenic
1103145199 12:118589612-118589634 CTGTGGGGAGTGTGGTCAGCAGG + Intergenic
1103446708 12:120999605-120999627 CTGTGGGGCTGGCGCTGAGCCGG - Exonic
1103506123 12:121443253-121443275 CTGTGGGGTGGGAGGTCAGTTGG - Intronic
1103673260 12:122635637-122635659 CTGTGGGGCAGGGTGAGAGGAGG + Intergenic
1103796993 12:123510050-123510072 CGGCAGGGCAGGGTGTCAGCAGG + Intronic
1103920867 12:124398544-124398566 CTGTTGGGAAAGGGGTCACCTGG + Intronic
1103965895 12:124639119-124639141 CAGGGGAGGAGGGGGTCAGCTGG + Intergenic
1103971228 12:124674091-124674113 CTGCTGGGAAGGGGGACAGCAGG + Intergenic
1104198782 12:126567309-126567331 CTGTGGGGCAGGGGGTGGGTGGG - Intergenic
1104329741 12:127833651-127833673 CTGCGGGGCAGGGAGTGAGGTGG + Intergenic
1104383787 12:128331084-128331106 CTGGGGGGCAGGGGGAAAGAGGG - Intronic
1104729180 12:131095552-131095574 CTGTGGGGCTGAGGGTGGGCCGG + Intronic
1104970936 12:132530415-132530437 CTGTGGGTCAGGGGGAGGGCCGG + Intronic
1104979643 12:132568087-132568109 CTGTGGGGCGGGGTGTCCACGGG + Intronic
1106500973 13:30328359-30328381 CCATGGGGCAGGGGGGCAGGGGG - Intergenic
1106814494 13:33392250-33392272 CTGCTGGGCATGGGGTCACCAGG - Intergenic
1108741285 13:53341349-53341371 CTGTGGGGCAGACGAGCAGCAGG - Intergenic
1109217740 13:59609049-59609071 TTGAAGGGCAGAGGGTCAGCTGG + Intergenic
1113780491 13:112974014-112974036 CAGTGGGGGATGGGGTCAGAGGG - Intronic
1114390264 14:22300464-22300486 CAGTGGTGCAGAGGGTCAGAGGG - Intergenic
1114480986 14:23034467-23034489 CGGTGGGGCCGGGGGTAAGTCGG - Intronic
1115909510 14:38240099-38240121 CTGTGAGGCAGGGGGCCTGATGG + Intergenic
1116776942 14:49192276-49192298 TTGGAGAGCAGGGGGTCAGCAGG - Intergenic
1116957111 14:50935978-50936000 CTTTGGGGCAGGGAGCTAGCTGG - Intronic
1119327717 14:73771322-73771344 CTGTCGGGCAGAGCTTCAGCAGG + Intronic
1121415166 14:93774324-93774346 CTGAGGGGCAGGGCAGCAGCAGG + Intronic
1121620653 14:95345854-95345876 GTGTGGGGCGGGGGGTGAGGGGG + Intergenic
1122786390 14:104166122-104166144 CTGAGGGGCAGGGTGGCAGCGGG + Intronic
1122914806 14:104853882-104853904 CTTTGAGGCAGGTGGTCCGCAGG + Intergenic
1122952154 14:105050966-105050988 CTGTGTGGCAGGGGGATGGCAGG - Exonic
1123476003 15:20592911-20592933 CTGTGAGGCAGGGAGGCTGCTGG + Intergenic
1123642008 15:22407452-22407474 CTGTGAGGCAGGGAGGCTGCTGG - Intergenic
1124139363 15:27063875-27063897 GTGTGGGGAAGTGGGTGAGCAGG - Intronic
1124181283 15:27477657-27477679 GTGTGGGGCAGGGGGTATACAGG + Intronic
1125429868 15:39582907-39582929 CTCTGGGGCTGGGGTGCAGCAGG - Intronic
1125732037 15:41897958-41897980 GTGTGGGGTAGGGAGACAGCTGG + Exonic
1126565260 15:50090206-50090228 CTGTGGGGTAGGGGAACAACGGG + Intronic
1128570119 15:68727640-68727662 CTGTGGGGTACGGGGTGAGGAGG - Exonic
1128717412 15:69918766-69918788 CTGTGGGGCAGGGGGAGTGGTGG + Intergenic
1129030139 15:72611922-72611944 CTGGGGAGCAGGGGGCCACCAGG + Intergenic
1129107371 15:73319209-73319231 GGGTGGGGAAGGGGGTCACCCGG + Intergenic
1129465278 15:75721364-75721386 CTGTGGGGAAGGTGGTCTGTGGG + Intergenic
1130038186 15:80380440-80380462 CTGTAGGGCAGTGGGACAGGGGG + Intronic
1130076893 15:80696595-80696617 CTGTGGGGCAGGAAGTTAGCTGG + Intronic
1131117495 15:89804003-89804025 CTGTGGGGGGAGGGGTCAGCTGG + Intronic
1131425891 15:92345208-92345230 TTGTGGGGCAAGGGGTGGGCAGG + Intergenic
1131513682 15:93063830-93063852 CTGTGGAGGTGGGGGTCAGTTGG + Intronic
1132205476 15:99983455-99983477 CTGTGGGGAAGGATGTCATCAGG - Intronic
1132481845 16:170274-170296 CTGTGGGGCAGGGGCTGGGCTGG - Intergenic
1132574108 16:656880-656902 CCGTGGGGCTGGTGGCCAGCTGG - Intronic
1132586284 16:706918-706940 GTGTGAGGCCTGGGGTCAGCGGG + Intronic
1132746830 16:1439678-1439700 CTGGGGGGCAGGAGGCCAGCAGG - Intronic
1133232176 16:4372002-4372024 CTGTGGGGCTGGGGGGCTGCGGG + Intronic
1133388886 16:5393088-5393110 CTGTGGCTCAGGGCCTCAGCAGG + Intergenic
1133812787 16:9174113-9174135 CTGTTGGGAAGGGAGGCAGCTGG - Intergenic
1134232103 16:12437408-12437430 CTGTGAGGCAATGGGTCAGGGGG + Intronic
1134629695 16:15748003-15748025 AGGTAGGGCAGGGGGTGAGCGGG - Intronic
1135771909 16:25224313-25224335 CAGTGGGGCAGAGAGACAGCTGG - Intronic
1135973625 16:27090267-27090289 CTGCTGGGCAGGAGGTCAGGGGG - Intergenic
1136147156 16:28322340-28322362 GAGAGGGGCAGGGGGTCAGGCGG - Exonic
1136186491 16:28591567-28591589 CTGTGGGGCAGGCAGACAGGAGG - Intronic
1136188976 16:28604291-28604313 CTGTGGGGCAGGCAGACAGGAGG - Intergenic
1136229241 16:28877242-28877264 CAGTGGGGAAGAGGGACAGCAGG - Intergenic
1136242104 16:28951022-28951044 CTGTGGGGAAGCGGGGCCGCTGG + Exonic
1136417476 16:30112794-30112816 CTGTGGGGGTGAAGGTCAGCGGG + Intronic
1136500943 16:30669460-30669482 CTGTAGAGCAAGGGGTGAGCAGG - Exonic
1136501162 16:30670217-30670239 CTGTGGGGAAAGGGGACTGCAGG + Exonic
1137056998 16:35750731-35750753 GTGGGGGCCAGGGGGTCAGGAGG - Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1138520966 16:57570634-57570656 CTGTGGGGCAGAGAGGGAGCTGG + Intronic
1138572351 16:57884090-57884112 CTGGGGCGCAGGGGCGCAGCGGG + Exonic
1138581811 16:57946416-57946438 CCATGGTGCAGGGGTTCAGCTGG + Intronic
1139997539 16:70995098-70995120 CTGTGGCTCAGGGGGCAAGCAGG - Intronic
1141452920 16:84117401-84117423 CCGTGGGGCCGGGGGTCAGGAGG - Intergenic
1141635537 16:85312111-85312133 CGGTGGGCGAGGGGGCCAGCAGG - Intergenic
1142100386 16:88267747-88267769 ACTGGGGGCAGGGGGTCAGCAGG + Intergenic
1142223771 16:88867580-88867602 CTGTGGGGCGGGGGCTCCGTGGG + Intergenic
1142253999 16:89005373-89005395 CTGCGGGGAAGGAGGTGAGCTGG + Intergenic
1142359215 16:89618957-89618979 CGGGGGGGCAGGGGGGCTGCAGG - Intronic
1142968158 17:3593703-3593725 GTGTGGGACAGGCGGTCAGTGGG - Intronic
1143026680 17:3945229-3945251 CGGTCGGGCAGGGGGCCTGCAGG - Intronic
1143096906 17:4483081-4483103 CTGGGGGGCAGAGGCTGAGCAGG - Intronic
1143304133 17:5932739-5932761 CTGTGGGGCATGAGGTAACCAGG + Intronic
1143593133 17:7897948-7897970 CTGTGGGGCAGGAGGCCATGGGG - Intronic
1143707726 17:8711016-8711038 CTGTGGGGCTAGCTGTCAGCTGG - Intergenic
1144579160 17:16448242-16448264 GTCTTGGCCAGGGGGTCAGCAGG - Intronic
1144630853 17:16871683-16871705 CTGTGGGTGAGGGCGTCAGTTGG + Intergenic
1144787654 17:17840765-17840787 CAGGGGGGCAGGGGGGCAGGGGG - Intergenic
1144954555 17:19012550-19012572 ATGTGGGGCAAGGGGACAGACGG + Intronic
1145006847 17:19343127-19343149 CTGTGGGGGAGGGGCTAAACAGG + Intronic
1145287057 17:21513681-21513703 CTGTGGGTCAGAGCGTCACCAGG - Intergenic
1145390564 17:22452675-22452697 CTGTGGGTCAGAGTGTCACCAGG + Intergenic
1146060166 17:29600726-29600748 CAGGGGGGCTGGGGGTCACCTGG + Intronic
1146683338 17:34824251-34824273 CTGTGGGGTAGGGGGTTAAATGG - Intergenic
1147157055 17:38549220-38549242 CCAAGGGGCTGGGGGTCAGCAGG + Intronic
1147158306 17:38556563-38556585 GTGTGGGGCAGGGGGGCTGCAGG + Intronic
1147677925 17:42220110-42220132 CTGTGAGGCAGGCGGGCAGGAGG - Intronic
1147688123 17:42299462-42299484 CTGTGAGGCAGGCGGGCAGGAGG + Intronic
1147918290 17:43901275-43901297 CTGTGAGGCGAGGGGTAAGCAGG - Intronic
1148109575 17:45136996-45137018 CTGTAGGGGAGGGGGTCTGTTGG - Intronic
1148241821 17:46004202-46004224 CTGTGGGGCTGTGGGGCTGCAGG + Intronic
1148511628 17:48175856-48175878 CTGTGTGGCTGGGGCTCAGTGGG + Intronic
1148792520 17:50181397-50181419 CTGTGGGTCAGGGCTGCAGCGGG - Intergenic
1148841708 17:50502943-50502965 CTGTGGGGCAGGGAGAGAGCTGG - Intergenic
1148990988 17:51667251-51667273 CTGGGGAGCAGGGGGAGAGCTGG - Intronic
1149421174 17:56511751-56511773 CTCTAGGGCACGGGGTCAGGTGG + Intergenic
1149996477 17:61408515-61408537 CTGCGTGGCAGGGGAGCAGCTGG - Exonic
1150552493 17:66223669-66223691 CTGTGGGCAAGGTGATCAGCTGG - Intronic
1151077245 17:71287713-71287735 TGGTGGGGGAGGGGGTGAGCAGG + Intergenic
1151816114 17:76472171-76472193 CTGAGGGGCAGGGGGTCGGCTGG + Intronic
1152304654 17:79513523-79513545 CTGTGGGGATGGGGGTCCACAGG - Intronic
1152344539 17:79743122-79743144 TTGTGGGGCAGGGGGCCCACAGG - Intergenic
1152378706 17:79931187-79931209 CCGTGGGGCAGGGGGTCGGCGGG + Intergenic
1152561103 17:81079194-81079216 CTGGGGAGCAGGGGCCCAGCCGG + Intronic
1152628882 17:81400742-81400764 CTCTCGGGCAGGGAGTCAGAGGG - Intronic
1152717035 17:81905210-81905232 CTCTGGGGCAGGGCATCAGATGG - Intronic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152844874 17:82593564-82593586 CTGTGGGGCCGGGAGCCAGAAGG - Intronic
1152911883 17:83009935-83009957 CTGTGGGGGAGGGGGGCTGTGGG + Intronic
1152962906 18:90446-90468 ATGGTGGGCAGAGGGTCAGCAGG + Intergenic
1154299764 18:13182807-13182829 TTCTGGGGCAGGGAGTGAGCTGG + Intergenic
1154388137 18:13913908-13913930 CTGTGGGCCAGGTTGTCTGCAGG - Intronic
1155246138 18:23911178-23911200 CTGAAGGGCAGGGGGTGAGTAGG + Intronic
1156291844 18:35754592-35754614 CTGAGGGGCATGGGGCCTGCTGG + Intergenic
1156454717 18:37286549-37286571 CTGTGGGTCAGAGGGGCAGGGGG - Intronic
1160153967 18:76418890-76418912 CTGAAGGGCAGAGGGTCTGCAGG + Intronic
1160684053 19:425244-425266 AAGAGGGGCAGGGGGTCAGCTGG + Intronic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1160768161 19:817867-817889 CTGAGGCACAGGGGGTCTGCTGG - Intronic
1160805366 19:990193-990215 GGGTGGGGCAGGTGCTCAGCAGG - Intronic
1160972521 19:1775866-1775888 CGGTGGGGCAGGGGATCTGACGG - Exonic
1160982349 19:1822182-1822204 CTGTGTGGCAGGGGGGCTTCTGG + Intronic
1161803057 19:6426320-6426342 CTTTGGGGCCAGGGGTCATCAGG + Exonic
1162057670 19:8074382-8074404 CTGTGAGGCAGTGGGAGAGCAGG + Intronic
1162066089 19:8126256-8126278 CTCTGGAGTAGGGGGTGAGCTGG + Intronic
1162327483 19:10007590-10007612 GGCTGGGGCAGGGGGTCAGTGGG - Intronic
1162449172 19:10744221-10744243 CTGTGGGGCAGGGAGCCTGGGGG + Intronic
1162531711 19:11239864-11239886 TCCTGGGGCAGGAGGTCAGCCGG + Exonic
1163350000 19:16770607-16770629 CTGTGGGGCAGGGGGAGGGATGG - Intronic
1163416953 19:17192723-17192745 CTGGTGGGCACGGGGTCAGGTGG - Intronic
1163601580 19:18252268-18252290 CTGTGGAGCTGGGGCTCGGCTGG + Intronic
1163622646 19:18369971-18369993 TTGTGGGGCTGGAGTTCAGCTGG + Intergenic
1163702215 19:18791517-18791539 TGGTGGGGCAGGGAGTCAGGGGG + Intergenic
1163762872 19:19146609-19146631 CAGTGGAGCAGGGGTTCTGCAGG + Exonic
1163821216 19:19497643-19497665 CTGTGGGGCACAGGGTGTGCAGG - Intronic
1164404929 19:27936330-27936352 CTGTGGGGCAGGGCAGCAGCTGG + Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165530134 19:36392012-36392034 ATTTGGGCCAGGGGCTCAGCTGG + Exonic
1165712669 19:38023249-38023271 CGGTGGGGCCGGGGGTCAGGGGG + Intronic
1166067794 19:40370266-40370288 CTGTGGGGCAGGGAGTGGCCTGG - Intronic
1166339367 19:42128443-42128465 GTGTGGGGCAGGGAGTATGCAGG - Intronic
1167036359 19:46997401-46997423 CTGTGGGGAAGGGAGGCCGCAGG - Intronic
1167236417 19:48318665-48318687 CTGGGGAGGAGGGGGTCAGAGGG - Intronic
1167306609 19:48713535-48713557 ATAGGGGGCAGGGGGTCTGCGGG + Exonic
1167599109 19:50443688-50443710 CTGTGGGGCAGGGGGACAGGAGG - Intronic
1168651163 19:58093195-58093217 CAGTGGGGGAGGCGGTCAGTAGG - Intronic
925046062 2:773845-773867 CTGTGGGACAGTGTGTCTGCTGG - Intergenic
925919686 2:8630537-8630559 CTGAGGGGCGGGGGGGCAGGGGG + Intergenic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
926149915 2:10419711-10419733 CTGCAAGACAGGGGGTCAGCCGG - Intronic
927677212 2:25114847-25114869 CTCTGGGGCAGGGGATCTACAGG - Intronic
927879637 2:26681510-26681532 ATGTGGTGCAGGAGGTCATCTGG - Intergenic
929057304 2:37889447-37889469 CTGGGGTGCTGTGGGTCAGCAGG - Intergenic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932751138 2:74372397-74372419 CTGTGGGGCAGGGGAGAAGGTGG + Intronic
932768072 2:74483568-74483590 GTGAGGGGCAGGGGATCAGGAGG + Intronic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935581044 2:104756053-104756075 CTGTGGGCCACAGGGTCAGCAGG - Intergenic
937224163 2:120358649-120358671 CTGAGGCTGAGGGGGTCAGCAGG + Intergenic
937247806 2:120504692-120504714 CTGTGTGGAAAGGGGTCAGTCGG + Intergenic
937712101 2:124989923-124989945 CTGTGAGGTAGGAGTTCAGCAGG + Intergenic
938101640 2:128501554-128501576 CACTGGGGCACGGGGCCAGCTGG - Intergenic
938181633 2:129189886-129189908 GTGTGAGGCAGGGGGACAGAGGG + Intergenic
938344399 2:130556942-130556964 CAGAGGGGCAGGTGGCCAGCAGG - Intergenic
938345434 2:130563780-130563802 CAGAGGGGCAGGTGGCCAGCAGG + Intergenic
940030976 2:149260869-149260891 GTGTGGGGCGGGGGGTGAGGGGG + Intergenic
943472092 2:188306673-188306695 CAGTGAGGCAGGGAGTCATCTGG + Intronic
943482856 2:188443186-188443208 CTGTGGGGGTGGGGGTTGGCGGG + Intronic
943701896 2:190996029-190996051 ATGTGGGGCAGAGGGGCAGGAGG + Intronic
946219727 2:218216485-218216507 CTGTGGGACGTGGGGGCAGCTGG - Intergenic
947514009 2:230785380-230785402 CAGGGGGGCAGGGGGGCAGGGGG + Intronic
947543748 2:230996104-230996126 CTGTGGGGCCTGGGTCCAGCTGG + Exonic
948022079 2:234742312-234742334 CTGTGGTGCAGGGAGGCAGGAGG + Intergenic
948353726 2:237360776-237360798 CTGAGGGGCAGGGACACAGCAGG - Intronic
948554261 2:238796409-238796431 CTGTGTGGCAGGAGGACAGCTGG + Intergenic
948607761 2:239146866-239146888 CTGGGAGGCAGGGGGTAAACAGG - Intronic
948762198 2:240199178-240199200 CGGTGGGGGAGGGGGGAAGCAGG - Intergenic
949007553 2:241658305-241658327 TGGTGGGGCAGGGGGGCAGTGGG + Intronic
949019958 2:241735303-241735325 CTGCGGGCCAGGGGGCCAACCGG - Exonic
1168745200 20:233359-233381 CTGTGGGGCAGGGGCTGTGGGGG + Intergenic
1168856293 20:1011605-1011627 CTGGTGGGCTGGGGGACAGCAGG + Intergenic
1169074278 20:2751828-2751850 CTGTGGGCAAGGGGGTGAGGAGG + Intronic
1169674938 20:8142915-8142937 CTCAGGGGCAGGAGGGCAGCTGG - Intronic
1171106679 20:22440109-22440131 CTGTGGCACAGGGGAGCAGCAGG - Intergenic
1171248497 20:23632115-23632137 CTGTGGGCCATGGGGCCACCGGG + Intronic
1172033186 20:31995661-31995683 CTATGAGGCAGGGGGTCCCCAGG - Intronic
1172313464 20:33935386-33935408 CTGGGGAGCAGGGGGTCAGAGGG - Intergenic
1172444173 20:34984614-34984636 GGGTGGGGCAGGGTATCAGCGGG - Intronic
1172446986 20:34998420-34998442 CGGTGAGGCTGGGGCTCAGCTGG + Exonic
1172485247 20:35293992-35294014 CTCTGGGGAAGGGGGTGAGCAGG + Intergenic
1172773521 20:37394802-37394824 CTGTGGGCCTGGGGCTCAGCGGG + Intronic
1173604875 20:44324756-44324778 ATCTGGGGCACAGGGTCAGCAGG + Intergenic
1173644628 20:44625795-44625817 CTCTGAGGCAGTGGGTCAGTGGG - Intronic
1174180353 20:48670477-48670499 ATGCAGGGCAGGGGGTCAGCAGG - Intronic
1174455015 20:50642706-50642728 ATGTGGGGCAGAGGGTGAGAGGG - Intronic
1174471791 20:50767000-50767022 ATGTGGGGCAGAGGGTGAGGGGG + Intergenic
1175257677 20:57656925-57656947 CTGTCTGGCAGGGGGTCCCCAGG + Intronic
1175341349 20:58232160-58232182 GGGTGGGGCAGGGGGTGAGGTGG + Intergenic
1175400904 20:58699334-58699356 TTGGGTGGCAGGGGGTCGGCGGG + Intronic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1175910175 20:62401507-62401529 CTGTGGGGCCCGGGGCGAGCAGG - Intronic
1175949755 20:62577045-62577067 CTGAGGGTCTGGGAGTCAGCTGG - Intergenic
1175994242 20:62805170-62805192 CCCTGGGGCTGGGGGTCGGCCGG - Intronic
1176121207 20:63455376-63455398 CAGAGGGGCAGGGGGACACCTGG + Intronic
1176170012 20:63692478-63692500 CTGTGGGGCAGGGGGCTTGAGGG + Intronic
1176180477 20:63747346-63747368 GGGCGGGGCAGGGGGTGAGCAGG + Intronic
1176180527 20:63747463-63747485 GGGCGGGGCAGGGGGTGAGCAGG + Intronic
1176710409 21:10145680-10145702 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1178791973 21:35708900-35708922 CCGTGGGGCAGAGGCTGAGCTGG - Intronic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1179787366 21:43737502-43737524 CTGCGGAGCTGGAGGTCAGCGGG + Intronic
1179856290 21:44164132-44164154 CTGTGGGGCAGAGACACAGCAGG - Intergenic
1179902276 21:44400399-44400421 CTGTGGGGCTGCGGGGCTGCGGG + Intronic
1179926553 21:44538265-44538287 CTGTGGGAAAGGCCGTCAGCGGG - Intronic
1180844727 22:18974861-18974883 CTGCGGGGCAGCAGGGCAGCGGG + Intergenic
1181056744 22:20263851-20263873 CTGCGGGGCAGCAGGGCAGCGGG - Intronic
1181062136 22:20286609-20286631 CTGTGGGGTGGGGGTGCAGCTGG + Intergenic
1181264466 22:21622746-21622768 CTCTGGAGGAGGGGGTCAGCAGG - Exonic
1181499507 22:23307849-23307871 CTGTGAAGTAGGGGGGCAGCTGG + Intronic
1181595205 22:23909821-23909843 CTGTGAGGGAGGAGATCAGCAGG - Intergenic
1181693987 22:24583859-24583881 GTGGTGGGCAGGGAGTCAGCAGG + Intronic
1182791985 22:32960652-32960674 CTGAGGGGCATGGGGGAAGCTGG - Intronic
1183312906 22:37121000-37121022 GTTTGGGGCAGGGGATGAGCTGG - Intergenic
1183379705 22:37484773-37484795 CTGAGGTGCTGGGGGCCAGCTGG + Intronic
1183603115 22:38851394-38851416 CTGGGCTGCAGGGGGGCAGCAGG + Intergenic
1183884418 22:40865690-40865712 GTGGGGGGCGGGGGGGCAGCGGG + Intronic
1184539017 22:45107447-45107469 CTGTAGGGCAGGGGCTGAGCTGG + Intergenic
1184555350 22:45229720-45229742 CTGGGGCTCAGGGGGTCAGCTGG + Intronic
1184694982 22:46134082-46134104 CTGTGGGGAGAGGGGGCAGCAGG - Intergenic
1184730654 22:46369403-46369425 CTGTGGGGCAGTGGGTGGACAGG - Intronic
1184754428 22:46508167-46508189 GTGGGTGGGAGGGGGTCAGCTGG - Intronic
1184907372 22:47497887-47497909 CTGTGGGGCAGGGCCTGAGTGGG + Intergenic
1185075975 22:48682465-48682487 CTGTGGGACGTGGGGTCACCAGG - Intronic
1185214306 22:49589775-49589797 ATGTGGGGCCTGGGGCCAGCGGG + Intronic
1185228209 22:49665178-49665200 CAGCGGGGCTGGGGGTCAGCAGG - Intergenic
1185272609 22:49935877-49935899 GTGTGGGGCCTGGGGTGAGCAGG + Intergenic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950360316 3:12445214-12445236 CTGCTGGGCAGGAAGTCAGCAGG + Intergenic
950423241 3:12910884-12910906 CTGGGGAGCAGGGGGCCACCTGG - Intronic
952334546 3:32392685-32392707 CTGGAGGGCAGGGGGTCAGTTGG + Intronic
953287734 3:41629238-41629260 CTGTGGGGGATGGGAACAGCTGG + Intronic
954239861 3:49285078-49285100 TTTTGGGGCTGGGGGTCAGAAGG - Intronic
954295052 3:49669831-49669853 CTTTGGAGAAGGGGGTGAGCAGG - Exonic
954685826 3:52369687-52369709 CTGTGGGGCAGGGGCAGTGCTGG - Intronic
955103994 3:55878419-55878441 TTTTGGGGCAGGAGGACAGCAGG - Intronic
957587045 3:82146122-82146144 CTGAGGGGCTGGGGTACAGCTGG - Intergenic
958833027 3:99112546-99112568 CTGTGTGTCAGGGGGTGAGAGGG + Intergenic
960989523 3:123301592-123301614 CTTTGAGGGAGGTGGTCAGCTGG + Intronic
961326298 3:126111409-126111431 CTCAGGGGCAGCGGGGCAGCGGG - Intronic
963366284 3:144338486-144338508 CTGTGGGGCAGGTGTCCTGCGGG - Intergenic
963511148 3:146250951-146250973 CTGCGGGGCAGGCGGTGAGTGGG - Exonic
964786454 3:160400801-160400823 CGCTGGGGCCGGGGGACAGCCGG - Exonic
968118524 3:196108224-196108246 CTGAGGGGAGGAGGGTCAGCTGG + Intergenic
968472557 4:788701-788723 CTGTGGGGCCAGGGGTGTGCTGG + Intronic
968520015 4:1030972-1030994 CTGGGGGACAGGGGAGCAGCAGG - Intergenic
968615242 4:1574768-1574790 CTGGACGGCAGGTGGTCAGCGGG + Intergenic
968736101 4:2297279-2297301 CCATGGGGCAGAGGGTCAGCAGG + Intronic
968751086 4:2389372-2389394 CTGTGGCTCACAGGGTCAGCAGG - Intronic
968949670 4:3684028-3684050 CTGTGGGGGAGGTGCACAGCTGG - Intergenic
969344684 4:6563479-6563501 CTGCGGGGCTGGGGGTGAGGCGG + Intronic
969665982 4:8557897-8557919 CTGTGGGCCAGGGTGGGAGCTGG - Intergenic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
970193129 4:13533594-13533616 CTGTGGTGCAGTGTGGCAGCTGG - Intergenic
971496124 4:27267270-27267292 CAGTGGAGAAGGAGGTCAGCTGG + Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
975854390 4:78607838-78607860 CTGTGGGCCAGGTGCTCTGCTGG + Intronic
976408094 4:84682017-84682039 ATGTGGGGCTGGGGTGCAGCAGG + Intronic
976663647 4:87566479-87566501 ATGTGGGGCAGGGAGGAAGCAGG - Intergenic
980156760 4:129117384-129117406 CTATGGGGCTGGGGGACAGTGGG - Intergenic
980888790 4:138792268-138792290 ATTTGGGGCAGGGGGTGACCTGG - Intergenic
982165495 4:152610049-152610071 CTCTGGGGCAGGGGGTGCACTGG + Intergenic
984329626 4:178298069-178298091 GTGTGGGGCGGGGGGGCAGTCGG + Intergenic
985440350 4:189979372-189979394 CTGGGGTGCAGGGGGGCTGCCGG + Intergenic
985519421 5:366060-366082 GTGTGGGGCAGGGGGTGGGGGGG - Intronic
986259931 5:6135063-6135085 CTCTGGGGTAGGGGGTGGGCAGG + Intergenic
986402628 5:7395565-7395587 CTGTGGGGGAGGGTGGGAGCAGG + Intergenic
986407273 5:7438556-7438578 CTGTGGTTTAGGGGGACAGCAGG + Intronic
986526866 5:8688445-8688467 CTGGGGGTCAGGAGCTCAGCTGG + Intergenic
986637290 5:9835738-9835760 CTGTGGGAGAGGGGCCCAGCAGG - Intergenic
990255083 5:53959775-53959797 CAGTGGGGCAGGGAGTGAGGAGG - Intronic
991169493 5:63604364-63604386 CTGCTGGGCTGGGGGTGAGCTGG + Intergenic
991478530 5:67050421-67050443 CTGAGGGGCAGGAGGTGAGCAGG - Intronic
991508361 5:67350064-67350086 CTGTGGGGAAGGAGTCCAGCTGG - Intergenic
992050566 5:72936706-72936728 CTGTAGGCCAGGAGCTCAGCTGG + Intergenic
995156220 5:108916444-108916466 CTGTTTGGCAGGGGGTCGGGGGG - Intronic
995460628 5:112399420-112399442 CTGGGAGGCAGTGTGTCAGCCGG + Intronic
996997269 5:129713198-129713220 CTATGTTGCAGGGGGTGAGCAGG + Intronic
997266444 5:132497690-132497712 CTGTGGGGGAGCAGGTCAGAAGG - Intergenic
997392517 5:133528650-133528672 GAGTGGGGCAGGGGTTCTGCTGG - Intronic
997674707 5:135704134-135704156 CTGGGCGGCAGAGGCTCAGCGGG + Intergenic
997988762 5:138526534-138526556 CTGGGGGGCAGGGGGTAGGCGGG - Intronic
998386517 5:141760225-141760247 CTGTGGGGCAGGGGGCCGGTGGG + Intergenic
998473356 5:142400567-142400589 CTGAGGAGCCTGGGGTCAGCAGG + Intergenic
999484918 5:151985637-151985659 GTGTGGGGCAGGGGGTGAGGGGG - Intergenic
1001116391 5:168944276-168944298 TTGTGGGGCAGGGTGTTAGCAGG + Intronic
1001513392 5:172338807-172338829 CTTTGGGGGAGGTGGTCTGCGGG + Exonic
1001568082 5:172713385-172713407 CTGAGAGGCAGGGTGTCTGCTGG - Intergenic
1001600863 5:172927224-172927246 CTGTGCAGCAGTGGGTCTGCAGG - Intronic
1001926447 5:175640529-175640551 CTGGGGGGCAGGGAGCCTGCTGG + Intergenic
1002165029 5:177338671-177338693 CTGTGGGGCAGGGGCCGTGCTGG - Intronic
1002187655 5:177462061-177462083 TGGTGGGGCCGGGGGTGAGCGGG - Intronic
1002327464 5:178419181-178419203 CTGAGGGACAGAGGGCCAGCAGG - Intronic
1002328026 5:178422456-178422478 CTGAGGGCCAGAGGGCCAGCAGG + Intronic
1002372741 5:178767992-178768014 CTGTGAGTCAGGGGGTAAACAGG + Intergenic
1002575679 5:180172458-180172480 CTGAGGGGCAGAGGGACAGGGGG + Intronic
1002587149 5:180256395-180256417 GGGTGGGGCAGGGGGGCAGGGGG + Intronic
1003049880 6:2770321-2770343 CTGTGGCTCAGAGGGTCAGTGGG - Exonic
1003362668 6:5443667-5443689 CTGCGGGGCTGGGGCTCAGCTGG - Intronic
1003625260 6:7735650-7735672 CTGTGGGGCAGGGGGTACCTGGG - Intronic
1004140256 6:13011684-13011706 CTGTGGGGCAGAGAGTAAGGCGG + Intronic
1004217565 6:13716810-13716832 CGGGTGGGCAGGGGCTCAGCAGG + Intergenic
1004320989 6:14631296-14631318 CTGTGGGTCAGGCATTCAGCAGG + Intergenic
1004323002 6:14647698-14647720 CTGTGAGGCAGAGGGTCCTCAGG + Intergenic
1004822541 6:19383241-19383263 CAGAGGGGCAGGGGGGCAGGAGG - Intergenic
1005376951 6:25192661-25192683 CTGTTGGGCAGGGAGTTGGCAGG + Intergenic
1005621582 6:27625414-27625436 GTGTAGGGCAGGGGGTGAGGGGG - Intergenic
1006162478 6:32046596-32046618 CTGTGGGGCATGGCGGGAGCAGG - Intronic
1006378368 6:33684179-33684201 CACTGGGGCATGGGGGCAGCAGG + Intronic
1006881451 6:37343574-37343596 CTGTGGGTCAGGGATTCAGGTGG + Intergenic
1007339675 6:41182759-41182781 CTGTGGGGAAGGGTGTCACATGG - Intergenic
1007727425 6:43924897-43924919 CGGCGGGGCAGGGGGTCAGTGGG + Intergenic
1010092498 6:72001498-72001520 ATATGGGGCAGGGGGTGAGTAGG - Intronic
1011664783 6:89623404-89623426 CTGTAGGGCAGTGTCTCAGCAGG + Exonic
1013633018 6:112003185-112003207 CTGTGGGGCAGGTGGTAAGCTGG + Intergenic
1014384624 6:120785744-120785766 CTGTGGGGCAGGGGGCTTCCTGG - Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1016713969 6:147203639-147203661 CTGGGGGGCTGGGGGCCTGCTGG + Intergenic
1018467088 6:164057819-164057841 ATGTGGGGCAGGAAATCAGCAGG - Intergenic
1018926785 6:168212424-168212446 CAGGGGGGCAGCGGGGCAGCAGG + Intergenic
1018990211 6:168668844-168668866 GTGTGGGGGAGGGTGACAGCAGG - Intronic
1018990267 6:168668987-168669009 GTGTGGGGGAGGGTGACAGCAGG - Intronic
1019164340 6:170088241-170088263 CTGTGGGGCTGGGAGTGAGCGGG + Intergenic
1019215224 6:170438932-170438954 CTGAGGGCCTAGGGGTCAGCAGG + Intergenic
1019215250 6:170438997-170439019 CTGGGGGCTGGGGGGTCAGCAGG + Intergenic
1019219145 6:170461279-170461301 GTGAGGGGCATGGGGTCAGGGGG - Intergenic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019529227 7:1495300-1495322 GTGTGGGGCAGGGGCTGTGCGGG + Intronic
1019558744 7:1645496-1645518 CTGTGGGCCCGGAGGCCAGCGGG - Intergenic
1019576775 7:1741386-1741408 CTCTGGGGCAGGGGCCGAGCAGG + Intronic
1019601260 7:1884857-1884879 CCGTGGGGCAAGGGGGCAGAGGG + Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019707889 7:2505078-2505100 CTGGGAGGAAGCGGGTCAGCAGG + Intergenic
1020118914 7:5491951-5491973 CTGGGAGGCAGGGGGTAAGGTGG + Intronic
1020438321 7:8189697-8189719 CCGAGGGGCAGGTGGGCAGCTGG + Intronic
1021578267 7:22125302-22125324 CTGTGGGGACAGGAGTCAGCGGG + Intronic
1021862821 7:24923731-24923753 CAGTGGGGCAGGCGGGCGGCCGG + Intronic
1022478524 7:30727736-30727758 GTGGGGGGCCAGGGGTCAGCAGG + Intronic
1022494659 7:30845295-30845317 GTGTGGGGCAGGGGCTCTGTAGG - Intronic
1022532744 7:31076990-31077012 CTGTGGGGCTGCGGGTCTTCGGG + Intronic
1023987563 7:45105654-45105676 CGGTGGAGCAGGAGGTCCGCTGG - Exonic
1024075140 7:45814235-45814257 CTGGGAGGCAGGGGGTGGGCCGG + Intergenic
1025604455 7:63029371-63029393 GTGGGGGGCATGGGGTCAGGGGG - Intergenic
1026442954 7:70459853-70459875 CTGTGGGGCAGAGGGTCTCATGG + Intronic
1026562440 7:71461753-71461775 CAGAGGAGGAGGGGGTCAGCAGG - Intronic
1026638395 7:72104126-72104148 CTGTGGGCCAGGGTGTCTCCAGG - Intronic
1026796073 7:73366920-73366942 CTGTGGGGAGGAGGGGCAGCAGG - Intergenic
1026885284 7:73938242-73938264 CTGTGGGCCAGAGGGAAAGCAGG - Intergenic
1027569010 7:79838882-79838904 CTGTGGGGCAGCTGGTAAGGAGG - Intergenic
1027638209 7:80702274-80702296 CTGTGGTGTAGGGGGTGAGGAGG - Intergenic
1028054477 7:86225569-86225591 ATGGGGGGCAGGAGGTCAGGGGG + Intergenic
1029147585 7:98457871-98457893 CTGTGCTGCAGAGGGGCAGCTGG - Intergenic
1029346629 7:99983464-99983486 GTGAGTGGCAAGGGGTCAGCAGG + Intergenic
1029558587 7:101287401-101287423 GTGAGTGGCAAGGGGTCAGCAGG - Intergenic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1031869365 7:127075504-127075526 ATGTGGGGCAGGGGGTCGGGGGG + Intronic
1032121396 7:129159749-129159771 CTGTGGGACAAGGCGCCAGCTGG + Intronic
1033082206 7:138308990-138309012 ATCTGGGGAAGGGGGTCAGTAGG - Intergenic
1034164765 7:149017050-149017072 CTGTGGAGCATGGTGTCAGTTGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034347801 7:150397766-150397788 CTGTGGGGCCGGGGACAAGCGGG + Exonic
1034349293 7:150405879-150405901 CGGAGGAGCAGGGGCTCAGCTGG + Intronic
1036788645 8:11703782-11703804 GTGTGGGGCACTGGGTCACCCGG - Intronic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037689871 8:21172636-21172658 TTGCAGGGCAGGGGGTCAGAGGG + Intergenic
1037887446 8:22602328-22602350 ATGTGGGGCAGGTGGTGGGCTGG + Intronic
1037966121 8:23135210-23135232 CTGTGGGCCAGAGGGAGAGCAGG + Intergenic
1037989665 8:23311859-23311881 CTGTCGGGTAGGTGGTCAGGAGG + Intronic
1038412516 8:27369207-27369229 CTGTAGGGCAGGGGGTGTGGAGG - Intronic
1039482548 8:37885385-37885407 CTGAGGGGCATGGGATCAGGAGG - Intronic
1039819967 8:41126490-41126512 CAGTGGGGCAGGGGCTTAGTGGG + Intergenic
1039873020 8:41562914-41562936 ATTTGGGGTAGGGGGTGAGCGGG + Intergenic
1040576059 8:48652410-48652432 CCAGGGAGCAGGGGGTCAGCTGG + Intergenic
1041447535 8:57969267-57969289 CTGTGGGTGGCGGGGTCAGCAGG + Intergenic
1043555045 8:81420956-81420978 CTGTGGGACATGGGGGCAGAGGG + Intergenic
1045232472 8:100317748-100317770 CACTGGGGCAGGATGTCAGCAGG + Intronic
1046653998 8:116874055-116874077 GGGTGGGGCGGGGGGTCGGCGGG - Intronic
1047425205 8:124739084-124739106 CAGGGGGGCAGGGGGGCAGGGGG + Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049300425 8:141866753-141866775 CTGTGGGGCAGGTGAGCAGCAGG + Intergenic
1049302687 8:141879936-141879958 CTGTGGGGCAGGGCATCAGCAGG + Intergenic
1049638821 8:143705232-143705254 GTGTTGGGGAGGGGGACAGCTGG - Intronic
1049687998 8:143946676-143946698 CTGCTGGGCGGGGGGTCTGCTGG - Intronic
1050726914 9:8660567-8660589 CTGAGGGGCTGGGAGCCAGCTGG - Intronic
1051604589 9:18907362-18907384 TTGGGAGGGAGGGGGTCAGCTGG - Intronic
1051780580 9:20684400-20684422 CTGCGGGGCTGGGGCTGAGCTGG + Intronic
1052036171 9:23683629-23683651 CTGTGGGGGAGGGGGTTAGGTGG - Intergenic
1052815989 9:33102931-33102953 CTGTGGGGCAGGGAGGGTGCAGG - Intergenic
1053360959 9:37486355-37486377 TGGTGGGTGAGGGGGTCAGCAGG - Intronic
1053647389 9:40131378-40131400 CTGTGGGCTAGGGGGGCAGCTGG - Intergenic
1053758338 9:41332465-41332487 CTGTGGGCTAGGGGGGCAGCTGG + Intergenic
1054328377 9:63729332-63729354 CTGTGGGCTAGAGGGGCAGCTGG - Intergenic
1054537190 9:66244792-66244814 CTGTGGGCTAGGGGGGCAGCTGG + Intergenic
1055618279 9:78095766-78095788 CTGAGGAGGAGGGGGTCACCTGG - Intergenic
1055804530 9:80077625-80077647 CTGTGGGGGAGTGAGGCAGCAGG + Intergenic
1056714743 9:89020167-89020189 CTGTGTGGCCTGTGGTCAGCAGG + Intronic
1056757388 9:89390362-89390384 CTGCGGGGCTGCGGGGCAGCTGG + Intronic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1056957701 9:91095826-91095848 CTGTGGGGCCTGGGCTCTGCAGG - Intergenic
1057695474 9:97320121-97320143 CTGGGGGGCAGGAGGTCACTGGG - Exonic
1059320166 9:113463124-113463146 CTGTGGGACGGGGGGCCATCAGG + Intronic
1060402287 9:123355976-123355998 GAGTGGGGCAGAGGGTCAGGAGG + Intergenic
1060553055 9:124494770-124494792 CTGGGGGCCAGGGGCTCAGAAGG + Intronic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1061087761 9:128409228-128409250 GTTGGGGGGAGGGGGTCAGCGGG + Intergenic
1061295339 9:129673963-129673985 ACGTGGGGCAGGGGGGCAGGTGG + Intronic
1061674521 9:132208229-132208251 ATTTGTGGCAGGGGGACAGCAGG + Intronic
1061872199 9:133527050-133527072 GGGTGGGGCAGGGAGCCAGCCGG - Intronic
1062050941 9:134446717-134446739 CTGGGGGGCTGGGGGGCTGCTGG + Intergenic
1062086922 9:134653808-134653830 CTGTAGGGCTGGGGGTGTGCAGG + Intronic
1062144216 9:134979832-134979854 CTGTGGGGCAGGAGTTCTTCAGG + Intergenic
1062220762 9:135413849-135413871 CCATGGGGCAGGGCCTCAGCTGG - Intergenic
1062353944 9:136153115-136153137 CTGTGGGGGACGGAGTCAGGAGG - Intergenic
1062483248 9:136762151-136762173 CTGGGGGGCATGGGGTGGGCGGG + Intronic
1062486707 9:136780545-136780567 ATGGTGGGCAGAGGGTCAGCAGG + Intergenic
1062735237 9:138133682-138133704 ATGGTGGGCAGAGGGTCAGCAGG - Intergenic
1202795173 9_KI270719v1_random:114675-114697 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1185494638 X:545099-545121 GTGTGTGGCAGGGTGTAAGCAGG + Intergenic
1188265290 X:28066010-28066032 CTGTGGGGCGTGTGGTCAGCAGG - Intergenic
1189672334 X:43424357-43424379 CTGTGGGTCAGGGGTTCATATGG - Intergenic
1190279788 X:48922170-48922192 GTGTGGGGCAGGGGTTGGGCGGG - Intronic
1190396861 X:49993851-49993873 CTGTGGGGCAGCTGGGAAGCAGG + Intronic
1190455126 X:50619489-50619511 CTGTGGGCCCGGGGGCAAGCAGG - Intronic
1192329141 X:70160099-70160121 CTTTGGCCCAGGGGGGCAGCTGG - Intronic
1194278212 X:91913518-91913540 CTGTGGAGCATGGGGTGAGGTGG - Intronic
1195338468 X:103879921-103879943 CTGTGGGTCAGGGGCTCTCCAGG + Intergenic
1195706785 X:107743085-107743107 TGGTGGGGCAGCGGGTCAGACGG - Intronic
1196255611 X:113514810-113514832 GTGAGGGACAAGGGGTCAGCAGG + Intergenic
1196685978 X:118510610-118510632 GTGTGTGGCGGGGGGTCAGCGGG + Intronic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200055221 X:153456701-153456723 CTGTGGGGCTGAGGGCCTGCTGG - Intronic
1200123222 X:153800957-153800979 CTGTGCGGCAGAGAGGCAGCTGG + Intergenic
1200138584 X:153886384-153886406 CTGCGGGGAAGGGGGTCTGGCGG - Intronic
1200149679 X:153944957-153944979 CTGTGGGGCAGGGGTGCAGCAGG + Intergenic
1200230218 X:154440203-154440225 ATGCGGGGCAGGGGGACAGCAGG - Intronic
1200595549 Y:5135593-5135615 CTGTGGAGCATGGGGTGAGGTGG - Intronic
1201587347 Y:15575644-15575666 CTGTGTGGCAAGTGGGCAGCTGG - Intergenic