ID: 1077095009

View in Genome Browser
Species Human (GRCh38)
Location 11:795550-795572
Sequence CTCTCTGTGCTGAAGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 258}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077095009_1077095015 12 Left 1077095009 11:795550-795572 CCCACATCCTTCAGCACAGAGAG 0: 1
1: 0
2: 0
3: 31
4: 258
Right 1077095015 11:795585-795607 CACCTGCCCCCTTCGAGCTAGGG 0: 1
1: 0
2: 1
3: 11
4: 79
1077095009_1077095016 13 Left 1077095009 11:795550-795572 CCCACATCCTTCAGCACAGAGAG 0: 1
1: 0
2: 0
3: 31
4: 258
Right 1077095016 11:795586-795608 ACCTGCCCCCTTCGAGCTAGGGG 0: 1
1: 0
2: 1
3: 8
4: 59
1077095009_1077095026 26 Left 1077095009 11:795550-795572 CCCACATCCTTCAGCACAGAGAG 0: 1
1: 0
2: 0
3: 31
4: 258
Right 1077095026 11:795599-795621 GAGCTAGGGGCTGGGGTCCCGGG 0: 1
1: 0
2: 5
3: 58
4: 487
1077095009_1077095014 11 Left 1077095009 11:795550-795572 CCCACATCCTTCAGCACAGAGAG 0: 1
1: 0
2: 0
3: 31
4: 258
Right 1077095014 11:795584-795606 GCACCTGCCCCCTTCGAGCTAGG 0: 1
1: 0
2: 0
3: 15
4: 127
1077095009_1077095020 18 Left 1077095009 11:795550-795572 CCCACATCCTTCAGCACAGAGAG 0: 1
1: 0
2: 0
3: 31
4: 258
Right 1077095020 11:795591-795613 CCCCCTTCGAGCTAGGGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 82
1077095009_1077095018 17 Left 1077095009 11:795550-795572 CCCACATCCTTCAGCACAGAGAG 0: 1
1: 0
2: 0
3: 31
4: 258
Right 1077095018 11:795590-795612 GCCCCCTTCGAGCTAGGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 123
1077095009_1077095022 19 Left 1077095009 11:795550-795572 CCCACATCCTTCAGCACAGAGAG 0: 1
1: 0
2: 0
3: 31
4: 258
Right 1077095022 11:795592-795614 CCCCTTCGAGCTAGGGGCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 124
1077095009_1077095025 25 Left 1077095009 11:795550-795572 CCCACATCCTTCAGCACAGAGAG 0: 1
1: 0
2: 0
3: 31
4: 258
Right 1077095025 11:795598-795620 CGAGCTAGGGGCTGGGGTCCCGG 0: 1
1: 0
2: 0
3: 32
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077095009 Original CRISPR CTCTCTGTGCTGAAGGATGT GGG (reversed) Intronic
900924948 1:5699162-5699184 TTCTCTGTGCTCAAGGCTGTGGG - Intergenic
904118274 1:28178057-28178079 CTCTCTGTGTAGGAGGTTGTTGG - Intronic
904801976 1:33099448-33099470 TTCTCAGTGCAGTAGGATGTGGG - Intronic
905075413 1:35266653-35266675 GCCTCTGTGCTGAATGATCTTGG + Intergenic
905273899 1:36805030-36805052 CTCTCTGTGCTGGTGGCCGTGGG - Exonic
906017591 1:42596048-42596070 CTCTCTTCTCTGAAGGATCTAGG - Intronic
907563527 1:55413122-55413144 CTCTCTCTGATGACTGATGTTGG + Intergenic
909028300 1:70508419-70508441 ATCTCTTTGCTGAGAGATGTCGG + Intergenic
909532052 1:76692587-76692609 CTCTGGGGGCTGAAGGATGGTGG + Intergenic
911062331 1:93759109-93759131 CTAACTGTGCCGCAGGATGTGGG - Intronic
913391289 1:118315282-118315304 CTCTTTGTACTGAAGGATTTTGG + Intergenic
914999117 1:152571995-152572017 CTCTCTGTGCTGACCCATGAGGG - Intronic
915701801 1:157803603-157803625 TTCACTGTGCTGGAGGGTGTGGG - Intronic
916485531 1:165255048-165255070 CTCTCTGTGGGGAAGGCTCTGGG + Intronic
916684475 1:167132266-167132288 TTCTCTGTGCTGAATAACGTGGG - Intergenic
917460547 1:175225525-175225547 AGCTCTGTGCTGAAGGCTGAGGG - Intergenic
918058707 1:181044531-181044553 CGCTCTGTGGGAAAGGATGTGGG - Intronic
918464971 1:184811904-184811926 CACTCTTTGCTGATGGCTGTGGG + Intronic
920036233 1:203067579-203067601 CTCTTTGTGCTGGAGGCAGTAGG + Intronic
921535535 1:216344925-216344947 CCCTCTTTGCTGATGGCTGTGGG + Intronic
921563886 1:216692818-216692840 GTTTCTGTGCTGAATAATGTAGG - Intronic
922185046 1:223266918-223266940 CTTTCTGTGCAGCAAGATGTGGG + Intronic
923865440 1:237934368-237934390 CTCTCAGCTCTGAAGGCTGTGGG - Intergenic
924522452 1:244816809-244816831 CACTCTTTGCTGATGGCTGTGGG + Intergenic
1062984408 10:1754610-1754632 CTCGCTGTGCTGCAGGGTGCAGG + Intergenic
1062984800 10:1758436-1758458 CTCTATTTTCTGAAGGATTTGGG - Intergenic
1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG + Intergenic
1063150210 10:3329893-3329915 CTCCCTGGGCTGGAGCATGTGGG + Intergenic
1063957396 10:11280159-11280181 CTCTCTTTTCTGAGGTATGTGGG - Intronic
1066977057 10:42378765-42378787 CACTCTCTGCTGATGGTTGTGGG - Intergenic
1068971122 10:62959600-62959622 CTCTCTCTGGAGAAGGATATGGG - Intergenic
1068973294 10:62981619-62981641 CTCTTTTTGCTGAAGCATGAAGG - Intergenic
1069613197 10:69789163-69789185 CTCTGTGTGGGGAAGGCTGTGGG + Intergenic
1069936282 10:71919460-71919482 CACTCTTTGCTGAGGGCTGTTGG - Intergenic
1073170906 10:101507653-101507675 TTTTTTTTGCTGAAGGATGTTGG + Intronic
1076485945 10:130817191-130817213 GTCTCTGTGCTGCAGCATGAGGG - Intergenic
1077005079 11:351179-351201 CACTCTCTGCTGACGGCTGTGGG - Intergenic
1077095009 11:795550-795572 CTCTCTGTGCTGAAGGATGTGGG - Intronic
1077156760 11:1095560-1095582 CTCTGTGTGCTGGTGGGTGTTGG - Intergenic
1077156816 11:1095767-1095789 CTCTGTGTGCTGGTGGGTGTTGG - Intergenic
1077157922 11:1099611-1099633 CTCTTTGTGCTGGTGGGTGTTGG - Intergenic
1077562774 11:3274768-3274790 CTCTATGTGCTGAAAGAAATGGG + Intergenic
1077568667 11:3320587-3320609 CTCTATGTGCTGAAAGAAATGGG + Intergenic
1079502120 11:21112899-21112921 AACTCTGTGCTTAAGGTTGTAGG + Intronic
1080665835 11:34335342-34335364 CTCTTTGTGCTGAGGGATATTGG - Intronic
1081662653 11:44897359-44897381 CTCTCTCTGCTGAAGTATTGTGG + Intronic
1083137305 11:60691500-60691522 CTCTGGGTGCTGAAGCTTGTGGG - Intergenic
1084030121 11:66476214-66476236 CCCTCTGGGCTGCAGGAGGTGGG - Exonic
1085974407 11:81635174-81635196 CACTCTTTGCTGATGGCTGTGGG + Intergenic
1086405792 11:86497976-86497998 CTCCCTGTGCTGCTGGACGTCGG - Exonic
1086799093 11:91149026-91149048 CAATCTGTGATGAAGCATGTGGG + Intergenic
1087524931 11:99297414-99297436 CACTCTGTGCTGATGGCTGTGGG - Intronic
1089099820 11:115952902-115952924 CTCTCTGTGCTGCCTGAAGTTGG + Intergenic
1089179316 11:116570194-116570216 ATCTCTGTTCTGCAGGTTGTGGG - Intergenic
1090455446 11:126844751-126844773 CACTCTTTGCTGAAGGCTATGGG + Intronic
1091026434 11:132145952-132145974 CTCCCTTTGCTCAAGGATTTGGG - Intronic
1091918368 12:4285260-4285282 CTCTCTCTGCTGCAGGAGGAAGG + Intronic
1093059928 12:14591164-14591186 CAGTCTGTGATGAAGGATGAAGG - Intergenic
1093114673 12:15194749-15194771 CTCTGGTTGCTGCAGGATGTTGG + Intronic
1095249221 12:39958904-39958926 ATCTCTGTGCTGGATTATGTCGG + Intronic
1095693068 12:45112788-45112810 CTCTCTATAGTGAAGGAAGTTGG + Intergenic
1096337364 12:50766423-50766445 CGCTCTTTGCTGATGGCTGTGGG + Intronic
1096452645 12:51756800-51756822 CACTCAGTCCTGAAGGCTGTAGG - Intronic
1101579177 12:106026523-106026545 CTCTCTGTGATGGAGGAAGATGG - Intergenic
1102557255 12:113735359-113735381 GTCCCTGAGCTGGAGGATGTGGG - Intergenic
1103875636 12:124125078-124125100 GCCTCTGTGCTGTGGGATGTGGG + Intronic
1107802630 13:44123572-44123594 CTCCATGTGCTGGGGGATGTGGG - Intergenic
1108149101 13:47512824-47512846 CCCTCCGTGGTGAAGGCTGTAGG + Intergenic
1109261707 13:60152327-60152349 TTCTGTGTGCTGAGGGATGTGGG - Intronic
1113519468 13:110929380-110929402 CTCTCTGTGGTGCAGGAAGGTGG + Intergenic
1114584122 14:23794485-23794507 CACTCTTTGCTGATGGCTGTGGG - Intergenic
1115742843 14:36406219-36406241 TTGTCTGTGCTGAAGGGTGGAGG - Intergenic
1115779279 14:36751336-36751358 CTGTTTGAGCTGAAGAATGTAGG + Intronic
1115888101 14:37996036-37996058 ACCACTGTGGTGAAGGATGTTGG - Intronic
1116329451 14:43577483-43577505 CACTCTTTGCTGATGGCTGTGGG + Intergenic
1116584708 14:46687604-46687626 CTCTCTGTGCTGCCTGAGGTTGG + Intergenic
1116678663 14:47938616-47938638 CACTCTTTGCTGACGGCTGTGGG + Intergenic
1118118357 14:62806872-62806894 CTCTCTTTGCTGATGGCTGTGGG + Intronic
1118443937 14:65835300-65835322 CTCTCTGTTCTGAAACATATAGG - Intergenic
1119606558 14:76023143-76023165 CTCTCTGAGCTGGATGATGTTGG + Intronic
1119788406 14:77329126-77329148 CTGTCTGTCCTGAAGCAAGTGGG + Exonic
1120036894 14:79708026-79708048 CCCTCTTTGCTGAAAGCTGTTGG + Intronic
1120352778 14:83384297-83384319 GTCTCTGTGATGAAGTAGGTTGG - Intergenic
1120716095 14:87842181-87842203 TTCTCTGTCCTGAAGGAGGTAGG - Intronic
1121276436 14:92671255-92671277 CCAGCTGTGCTGGAGGATGTGGG + Intronic
1121398477 14:93649507-93649529 CTAACTTTGCTGAAGTATGTAGG - Intronic
1121462710 14:94094255-94094277 CACTCTTTGCTGATGGCTGTGGG + Intronic
1121653718 14:95579212-95579234 CTCTGTGTGATCAAGGGTGTTGG + Intergenic
1121664344 14:95660542-95660564 CTCTTTTTGCTGAGGGAAGTGGG - Intergenic
1121694055 14:95898415-95898437 CTCCCAGAGCTGAAGGACGTGGG - Intergenic
1122592129 14:102861244-102861266 CACTCTTTGCTGATGGCTGTGGG - Intronic
1123995870 15:25717745-25717767 CTCTCCGTGCTGGATGATGGTGG + Intronic
1124201943 15:27686308-27686330 CTCCCTGTGCTTAGGGATGGAGG - Intergenic
1125518030 15:40333823-40333845 TGCTCTCTGCTGAAGGCTGTGGG - Exonic
1125887339 15:43238618-43238640 CTCGCTGGCCTGCAGGATGTGGG + Intronic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1128148881 15:65348826-65348848 CACTCTTTGCTGATGGCTGTGGG + Intronic
1130461300 15:84159752-84159774 CGCTCTGTGCTGACGGAGGCTGG + Intergenic
1130965155 15:88691785-88691807 CTGTCTGTGGTGAAGGATCAGGG + Intergenic
1131784876 15:95901628-95901650 ATCTCTGTCCAGAAGGATGTTGG - Intergenic
1132905537 16:2280789-2280811 CTCTCTGGGCTCACGGATGTTGG + Intronic
1134249832 16:12566466-12566488 CTGGCTGTGCTGAATGATGATGG + Intronic
1136922257 16:34343189-34343211 CTCTCAGCTCTGAAGGCTGTGGG + Intergenic
1136982316 16:35068617-35068639 CTCTCAGCTCTGAAGGCTGTGGG - Intergenic
1138439756 16:57026907-57026929 CTCCCTGTGCTCTAGGATGTTGG - Exonic
1140255723 16:73334482-73334504 CTCTTGGAGCTGAAGGAAGTGGG + Intergenic
1140255852 16:73335769-73335791 CTCTCAGAGCTGAAGGCAGTGGG - Intergenic
1141244819 16:82295943-82295965 CTTTCTGTGGTGAAGAATCTGGG + Intergenic
1142134223 16:88444277-88444299 CTCTCTGTGCGGTGGGGTGTGGG - Intergenic
1142407085 16:89896223-89896245 CTCTCTGGGCTTAAGGATAGAGG + Intronic
1143251518 17:5526594-5526616 CTGTGTGTGCTGAAGGAGATGGG + Intronic
1149642590 17:58213498-58213520 TTCTCTGTGCTGCTGAATGTAGG - Intronic
1151479159 17:74360237-74360259 CTCTCTGTGCTGCAGCAGGAAGG + Exonic
1152212926 17:79012609-79012631 CCCTCTTTGCTGATGGCTGTGGG + Intergenic
1153585108 18:6612793-6612815 CTCTCTGTGGAGAAGGAGGCAGG - Intergenic
1156351271 18:36303341-36303363 CTCTCTGTGCAGATGGGGGTGGG + Intronic
1156783662 18:40882462-40882484 CTCTCAGTGGTGAGGGACGTGGG - Intergenic
1157583087 18:48784572-48784594 CTCTCTCTGCAGCAGGATGGAGG + Intronic
1158855627 18:61540742-61540764 CTCTCTGTGCAGCAAGATGCTGG - Intronic
1160303439 18:77707048-77707070 CTTACTATGCTGAAGGATGAAGG - Intergenic
1162017857 19:7855411-7855433 CATTCTGTGCTGATGGATTTTGG - Intronic
1163104848 19:15117280-15117302 CTCTCTGTCCTGAGGGCAGTGGG + Intronic
1164503832 19:28841680-28841702 CTCACTGTGGTGAGGGGTGTGGG - Intergenic
1164649461 19:29881573-29881595 AGCCCTGTGCTGAATGATGTGGG - Intergenic
1165697411 19:37911429-37911451 CTCTCTGCACTGAAGAATGTGGG - Intronic
1166901017 19:46062914-46062936 CACTCTTTGCTGATGGCTGTGGG - Intronic
1167863085 19:52300716-52300738 CTCTCAGCTCTGAAGGCTGTTGG - Intronic
1167863807 19:52307600-52307622 CTCTCAGCTCTGAAGGCTGTTGG - Intronic
925324674 2:3008693-3008715 CACTCAGAGCTGAAGGAGGTAGG + Intergenic
926833355 2:16989299-16989321 CTGTTTGTCATGAAGGATGTAGG + Intergenic
927199708 2:20570790-20570812 CTCTCTGAGCTGGAGGAGTTTGG + Intronic
929484478 2:42341554-42341576 TTCTTTGAGCTGAAGGATGTGGG - Intronic
931992034 2:67800148-67800170 CTCACTGTGCTGAACAATGAGGG - Intergenic
932384393 2:71317925-71317947 CTCTCAGCTCTGAAGGCTGTGGG - Intronic
933970554 2:87466590-87466612 CTCCCTGTGCTTGAGGATGGAGG - Intergenic
934649099 2:96078745-96078767 CAATCTATGCTGAAGGATGGTGG - Intergenic
934888718 2:98047300-98047322 CACTCTTTGCTGATGGCTGTGGG + Intergenic
936284710 2:111173211-111173233 CTCTGTGTGATGGAGGGTGTGGG + Intergenic
936323176 2:111483592-111483614 CTCCCTGTGCTTGAGGATGGAGG + Intergenic
937222335 2:120349012-120349034 CACTCTCTGCTGCAGGATGCTGG - Intronic
937908051 2:127061956-127061978 CTCTCTGTGCTCAGGGAGGCAGG - Intronic
938119683 2:128624774-128624796 GTCTCTCTGCTGAAGGAAGAAGG + Intergenic
938643449 2:133307067-133307089 ATCTTTGTGCTGAATGAGGTAGG - Intronic
938942758 2:136183323-136183345 TTGTGTTTGCTGAAGGATGTTGG + Intergenic
939843861 2:147220510-147220532 CACTCTCTGCTGATGGCTGTGGG - Intergenic
940075262 2:149734448-149734470 GGCTATGTGCTGAGGGATGTCGG + Intergenic
940499339 2:154474939-154474961 CACTCTTTGCTGATGGTTGTGGG - Intergenic
944522767 2:200588281-200588303 TTCTGTGTGCTTAAGGAGGTAGG + Intronic
946069159 2:217016491-217016513 TTCTCTCTGCTGGAGGTTGTAGG - Intergenic
1170018305 20:11808053-11808075 CTCTGTATGCTGGAGAATGTGGG - Intergenic
1170139736 20:13113390-13113412 GGCTCTGTGCTGATGTATGTGGG - Intronic
1170188168 20:13615974-13615996 CTCTTGGTAATGAAGGATGTAGG - Intronic
1172995668 20:39068926-39068948 CTCTCTCTGCTGTGGGATGGGGG + Intergenic
1172998877 20:39091477-39091499 CTCTCTGTCCTGAAAGAGGCTGG - Intergenic
1173107025 20:40146830-40146852 GTCTGTGTGCTGAAGAATGAAGG + Intergenic
1173903641 20:46609800-46609822 CTCTCTGTGGTGTGGGAAGTTGG - Intronic
1174400251 20:50272157-50272179 TTCTCTGAGCAGAAGGAAGTGGG - Intergenic
1174442466 20:50566989-50567011 CTCCCTGTGCTGAAGGGACTCGG - Intronic
1174773272 20:53321348-53321370 CCCTCTGGGCTCAAGTATGTTGG + Intronic
1178090142 21:29153793-29153815 CTCTCTGTTCTAAAAGATGGTGG + Intronic
1179104239 21:38383983-38384005 CTCTCTGTGATGACGGAAGGAGG + Intronic
1179227517 21:39468109-39468131 ACCTCTGTGCTGAACGATCTAGG - Intronic
1181426663 22:22848417-22848439 CTCTCTGTGCTGAACCATGAAGG + Intronic
1182172282 22:28243830-28243852 CTGTCTGTGTTCAAGGAAGTTGG - Intronic
1182584287 22:31334942-31334964 GTGTCTGTGCTAAAGGAGGTTGG - Intronic
1184171296 22:42761293-42761315 CTCTCTGTCCGAAAGGATGCAGG + Intergenic
1184246404 22:43237927-43237949 CCCTCTGTGCAGAAGGGTGAGGG - Intronic
1185202827 22:49518497-49518519 CCCTCTGGGCGGAAGCATGTGGG + Intronic
949499294 3:4663594-4663616 CTCACTGTGATGTAGGATGTCGG - Intronic
949888062 3:8712034-8712056 CTCACTGTGCTGGAGGCTGAAGG - Intronic
949963005 3:9329837-9329859 CACTCTTTGCTGATGGCTGTGGG - Intronic
951249827 3:20381923-20381945 CACTCTTTGCTGATGGCTGTGGG + Intergenic
952750014 3:36817425-36817447 CTGTATGTGCTGGAGGAGGTAGG - Intergenic
954461654 3:50630263-50630285 CACTCTGTCCTCAAGGATTTAGG - Intronic
955795990 3:62637481-62637503 CTCACAGTGCTGATGTATGTGGG + Intronic
957034456 3:75281093-75281115 TTCCCTCTGCTGAAGGAGGTGGG - Intergenic
961078367 3:124002995-124003017 CTCCCTCTGCTGAAGGAGGTGGG - Intergenic
961305155 3:125953782-125953804 CTCCCTCTGCTGAAGGAGGGCGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961728721 3:128951344-128951366 TTCCCGGTGCTGAAGGATGTGGG + Intronic
961981345 3:131082466-131082488 CTTTCTGTGCTGATGGAAATGGG + Intronic
964529238 3:157649139-157649161 CTCTCTATTCTAAAGGAAGTAGG - Intronic
966075365 3:175930404-175930426 CTCTCTGTGTTGATACATGTGGG - Intergenic
968476438 4:811849-811871 CTGTCTTTGCTGACGTATGTTGG + Intronic
968544578 4:1192205-1192227 ATCTCTGTGCTAAAGCATGTGGG - Intronic
969420255 4:7090282-7090304 CACTCTTTGCTGATGGCTGTGGG - Intergenic
969448487 4:7259372-7259394 CTATCTGTGCTTGAGAATGTGGG - Intronic
969672634 4:8598203-8598225 CTCTGTGAGCTGAATGGTGTAGG + Intronic
970103015 4:12546669-12546691 CTCTCTGTGATTTAGGATTTAGG + Intergenic
972818853 4:42676065-42676087 CACTCTTTGCTGATGGCTGTGGG + Intergenic
973814289 4:54604490-54604512 CACTCTTTGCTGATGGCTGTGGG - Intergenic
974072874 4:57141123-57141145 CTCTCTTTGCTGATGGCTATGGG - Intergenic
975492061 4:75000062-75000084 CTTGCTTTGTTGAAGGATGTGGG + Intronic
975890201 4:79018352-79018374 CTCTCAGTGCTGTTGCATGTGGG + Intergenic
976147206 4:82053657-82053679 CTCCCTGTGCTCTGGGATGTGGG - Intergenic
977458559 4:97296047-97296069 CTCTCTGTTCTGAAGCATCTGGG + Intronic
977564693 4:98568993-98569015 CTCACTGTGGAGAAGGATGCAGG + Intronic
977589766 4:98813452-98813474 CACTCTTTGCTGATGGCTGTGGG + Intergenic
977593110 4:98848824-98848846 CACTCTTTGCTGATGGCTGTGGG - Intergenic
977972811 4:103230882-103230904 ATACCTGTGCTGAAGGATTTTGG - Intergenic
982141349 4:152322757-152322779 TTCTCAGTGGTGCAGGATGTTGG - Exonic
982864080 4:160488610-160488632 CACTCTTTGCTGATGGCTGTGGG + Intergenic
984441341 4:179774379-179774401 CACTCTTTGCTGAAGGCTGTGGG + Intergenic
985268780 4:188175266-188175288 GTCTCTGTCCTGAGGGCTGTGGG - Intergenic
985836412 5:2275349-2275371 CTCTCTCTGCAGGAGGCTGTGGG - Intergenic
986815060 5:11400206-11400228 ATCTATGACCTGAAGGATGTGGG + Intronic
986973020 5:13359257-13359279 CTCTCTGTGCTTAATTATGTTGG - Intergenic
987221819 5:15798292-15798314 TTCCCTTTGCTCAAGGATGTTGG + Intronic
987545874 5:19309710-19309732 TTCTGGGTGCTGAAGGATGATGG + Intergenic
990342492 5:54837393-54837415 CTGTCTCTGCTGTAGAATGTTGG - Intergenic
992459101 5:76943747-76943769 ATCTCTAAGGTGAAGGATGTGGG - Intergenic
994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG + Intergenic
995051497 5:107711116-107711138 ATCTCTGTGCTGAAGAATCATGG - Intergenic
996369432 5:122737721-122737743 CTCTCTGGGCTGAAGGGTGGAGG + Intergenic
997624734 5:135324123-135324145 ACCTCTGTGCTGAAGGCTGAGGG - Intronic
998224759 5:140318380-140318402 CTCTCTTTGCTGAAGGGGGTGGG - Intergenic
999252742 5:150192301-150192323 CTCTCTGTCCTGAAGAGTCTTGG + Intronic
1001245631 5:170104311-170104333 CTCTCTGTGATGAAGCAGATGGG - Intergenic
1001312194 5:170619180-170619202 ATCTGTGTTCTGAAGGATGAGGG - Intronic
1004226104 6:13785600-13785622 CTCTCTGTGCTTGAAGAAGTAGG + Intergenic
1006299258 6:33185157-33185179 CTGTCTGTGCTGGGGGATGGGGG + Intronic
1007353255 6:41291118-41291140 CACTCTTTGCTGATGGCTGTGGG - Intergenic
1009939420 6:70272516-70272538 CTCTCTGTGCTGAATGTTTGGGG - Intronic
1009943186 6:70313505-70313527 TTCTCTGTCCTCAAGGAAGTAGG + Intergenic
1010620446 6:78067684-78067706 CTCTCTGTGCAGCAGGTTGAGGG - Intergenic
1011638581 6:89398796-89398818 CTCTAGGTGGTGAAGGCTGTAGG - Intronic
1015143729 6:129963055-129963077 CTCTCAGTGCTGATTGTTGTTGG + Intergenic
1015412752 6:132913323-132913345 CTTTCAGGGCTGCAGGATGTGGG + Intergenic
1016569121 6:145492810-145492832 CTCTCTCTGCTGATGGAGCTGGG + Intergenic
1016849661 6:148604663-148604685 CTCTCTTTGCTGAATTATCTTGG + Intergenic
1017919088 6:158855944-158855966 CCTTCTGTTCTGAAGTATGTTGG - Intergenic
1018681753 6:166270870-166270892 CTCTATGTGCTGAACCTTGTTGG - Intergenic
1018718286 6:166552427-166552449 CTCTGTGTGGCGAAAGATGTGGG + Intronic
1019868141 7:3732166-3732188 TTCTCTGTGTTGAAGTAGGTAGG + Intronic
1020245340 7:6424926-6424948 CTCTCTGTGCCGCAGGACTTGGG - Intronic
1022747179 7:33184359-33184381 CGCTCTTTGCTGATGGCTGTGGG - Intronic
1023143052 7:37121321-37121343 TTCTCTGAGCTAAAGGATGAAGG + Intronic
1023588755 7:41758977-41758999 CACTCTTTGCTGATGGCTGTGGG - Intergenic
1025273308 7:57547430-57547452 CTTTCTGGGCTGAAGGAAATAGG + Intergenic
1028407823 7:90495534-90495556 CTTTCTGTGCAGGTGGATGTAGG - Intronic
1030156399 7:106460160-106460182 CACTCTTTGCTGATGGCTGTGGG - Intergenic
1030470534 7:109957592-109957614 CTCCCTGTGCTTAAAGATGATGG + Intergenic
1033589158 7:142796304-142796326 CTGTCTGTGCTAAGGGAGGTGGG + Intergenic
1033928962 7:146500249-146500271 CTTTCTGTGCTGCAAGATGCAGG - Intronic
1035389072 7:158493180-158493202 GTCTCTGTGCTGAAGCAGGAGGG - Intronic
1036429942 8:8680858-8680880 CTCTCTGATCTGAAGCAGGTGGG - Intergenic
1040947591 8:52900325-52900347 TTCTCTGTAATTAAGGATGTGGG - Intergenic
1041090043 8:54293442-54293464 CTCCCTGTGCTGAAGACTGGAGG + Intergenic
1041763873 8:61396412-61396434 CTCTCTGTGCTGAGGAATTATGG - Intronic
1043608504 8:82031906-82031928 CTTTCTGTGCAGAAGCATTTTGG + Intergenic
1044755966 8:95461514-95461536 CGCTCTGTGGTGAGGGGTGTAGG + Intergenic
1046856629 8:119039678-119039700 GTCTCTGTTCTGAAGGTTCTGGG + Intronic
1046862978 8:119115699-119115721 CTCTCTATTCTGAAGGATTTAGG - Intergenic
1049417246 8:142500683-142500705 CTGACTGTTCTGAAGGATGTGGG + Intronic
1050319719 9:4439113-4439135 CTCTCTGTGCTGCATGCTGAGGG + Intergenic
1051225302 9:14892604-14892626 CACTCTTTGCTGATGGCTGTGGG + Intronic
1053108744 9:35438362-35438384 CTCCTTGTACTGAAGGGTGTGGG + Intergenic
1053320003 9:37088967-37088989 CTCTCTCTACTGAGGGATGTAGG + Intergenic
1053324586 9:37131947-37131969 CTCTCTCTACTGAGGGATGTAGG + Intronic
1053391528 9:37739845-37739867 CTCTCTGAGCTAAAGGAGGCTGG - Intronic
1055780315 9:79814039-79814061 GTCTCTATGATGAAGGAGGTAGG + Intergenic
1057051862 9:91929890-91929912 CTCTCTGTGTTCAATGATGTGGG - Intronic
1057807251 9:98228330-98228352 CTCTCTGGGATGTAGGATTTTGG + Intronic
1058648149 9:107149904-107149926 CTCCCTGTGAGGAATGATGTGGG - Intergenic
1059403838 9:114087786-114087808 CTCTCTCTGGAAAAGGATGTGGG + Intronic
1060422091 9:123476531-123476553 CTCTATGTGCTGCTGGCTGTAGG - Intronic
1060724020 9:125995575-125995597 CTCCCAGTGCTGGAGGATGCAGG + Intergenic
1062622192 9:137428158-137428180 CTCACTGTGCTGCTGGCTGTGGG + Intronic
1185527221 X:789366-789388 CTCTCAGTGCTGACAGATGGAGG - Intergenic
1185705381 X:2262824-2262846 CTCTCTGCTCTGAAGGGTGTGGG - Intronic
1186270357 X:7880095-7880117 CACTCTGTGCTGAAGAAAGGGGG - Intergenic
1186291309 X:8102863-8102885 CTCCCTGCGCTTGAGGATGTGGG - Intergenic
1187827590 X:23347396-23347418 CTCTCTGAGGAGAAGTATGTGGG + Intronic
1190920963 X:54852115-54852137 CACTCTTTGCTGATGGCTGTGGG - Intergenic
1192162598 X:68799711-68799733 CACTCTCTGCTGAAGGAGTTTGG + Intergenic
1192306716 X:69968114-69968136 TTCTCTTTTCTGAAGGCTGTGGG - Intronic
1193396349 X:80988379-80988401 CTCTCAGCTCTGAAGGCTGTGGG - Intergenic
1195065196 X:101233592-101233614 CCCTCAGTGCTGAGGGATGGGGG + Intronic
1196962029 X:121014091-121014113 CTATATTTGCTGAAGGATCTAGG + Intergenic
1198409355 X:136350073-136350095 GTCTTTCTGCTGAAGGATGAAGG - Exonic
1199039532 X:143095541-143095563 GTTTCTGTTTTGAAGGATGTCGG + Intergenic
1199380327 X:147165080-147165102 TTCCCAGTGCTGAAGGATGTGGG + Intergenic
1199454123 X:148008694-148008716 CTCTCTTTTCTGGAGGAGGTAGG + Exonic
1200697956 Y:6377680-6377702 CTGTCTGTGCTCCAGGTTGTGGG - Intergenic
1200851803 Y:7891245-7891267 CTCTCTTTGCAGATGGATTTTGG + Intergenic
1200917010 Y:8580129-8580151 CTGGCTGTGCTGCAGGTTGTGGG + Intergenic
1201036156 Y:9787019-9787041 CTGTCTGTGCTCCAGGTTGTGGG + Intergenic
1202040999 Y:20683988-20684010 CTCTCAGTTCTGAAGGCTGTGGG - Intergenic
1202377955 Y:24255392-24255414 CGCTCTGTGCTGATGGAGGCTGG - Intergenic
1202492827 Y:25414729-25414751 CGCTCTGTGCTGATGGAGGCTGG + Intergenic