ID: 1077095627

View in Genome Browser
Species Human (GRCh38)
Location 11:797887-797909
Sequence CGCACGTGTCCACAGATGTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077095617_1077095627 15 Left 1077095617 11:797849-797871 CCGCTCCGTCCTCCGCCTGGCCA 0: 1
1: 0
2: 1
3: 22
4: 359
Right 1077095627 11:797887-797909 CGCACGTGTCCACAGATGTCCGG 0: 1
1: 0
2: 1
3: 4
4: 64
1077095624_1077095627 -8 Left 1077095624 11:797872-797894 CCGCGACTCCGGCCACGCACGTG 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1077095627 11:797887-797909 CGCACGTGTCCACAGATGTCCGG 0: 1
1: 0
2: 1
3: 4
4: 64
1077095623_1077095627 -5 Left 1077095623 11:797869-797891 CCACCGCGACTCCGGCCACGCAC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1077095627 11:797887-797909 CGCACGTGTCCACAGATGTCCGG 0: 1
1: 0
2: 1
3: 4
4: 64
1077095619_1077095627 6 Left 1077095619 11:797858-797880 CCTCCGCCTGGCCACCGCGACTC 0: 1
1: 0
2: 1
3: 16
4: 252
Right 1077095627 11:797887-797909 CGCACGTGTCCACAGATGTCCGG 0: 1
1: 0
2: 1
3: 4
4: 64
1077095618_1077095627 10 Left 1077095618 11:797854-797876 CCGTCCTCCGCCTGGCCACCGCG 0: 1
1: 0
2: 2
3: 16
4: 202
Right 1077095627 11:797887-797909 CGCACGTGTCCACAGATGTCCGG 0: 1
1: 0
2: 1
3: 4
4: 64
1077095620_1077095627 3 Left 1077095620 11:797861-797883 CCGCCTGGCCACCGCGACTCCGG 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1077095627 11:797887-797909 CGCACGTGTCCACAGATGTCCGG 0: 1
1: 0
2: 1
3: 4
4: 64
1077095622_1077095627 0 Left 1077095622 11:797864-797886 CCTGGCCACCGCGACTCCGGCCA 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1077095627 11:797887-797909 CGCACGTGTCCACAGATGTCCGG 0: 1
1: 0
2: 1
3: 4
4: 64
1077095615_1077095627 19 Left 1077095615 11:797845-797867 CCGACCGCTCCGTCCTCCGCCTG 0: 1
1: 0
2: 0
3: 20
4: 177
Right 1077095627 11:797887-797909 CGCACGTGTCCACAGATGTCCGG 0: 1
1: 0
2: 1
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077095627 Original CRISPR CGCACGTGTCCACAGATGTC CGG Exonic
901657125 1:10775791-10775813 CACACGTGGCCACAGACCTCAGG - Intronic
903882010 1:26516948-26516970 GGCAGGTGTACACAGATGGCAGG + Intergenic
912600441 1:110926947-110926969 GGCAAGTGTCCATATATGTCTGG - Intergenic
923099414 1:230800549-230800571 CGCAAGTGTCCACAGGTGTAGGG + Intronic
1075898813 10:126021464-126021486 CACAAGTGTCCACAGGTGTGTGG + Intronic
1077095627 11:797887-797909 CGCACGTGTCCACAGATGTCCGG + Exonic
1080009673 11:27445234-27445256 CGCACGTGTCCATAGGTGATAGG - Intronic
1084447286 11:69210943-69210965 GGCACGTGTCCACAGCTTCCTGG + Intergenic
1087053007 11:93905197-93905219 CGCACTGATACACAGATGTCTGG - Intergenic
1099176028 12:79423188-79423210 TGCACGTGTGCACACATGTGTGG - Intronic
1103933563 12:124463446-124463468 GGCAGGTGTGCACAGATGGCAGG - Intronic
1106376782 13:29196843-29196865 CTCAAGTGTCCACAGATGAAAGG - Intronic
1122104434 14:99441543-99441565 CGCACGCTAGCACAGATGTCAGG + Intronic
1122859214 14:104575014-104575036 CGCACATGTCCACAGATGTGTGG + Intronic
1123067293 14:105625133-105625155 CGCACGTGACCTCAGGGGTCCGG + Intergenic
1123071315 14:105643860-105643882 CGCACGTGACCTCAGGGGTCCGG + Intergenic
1123076269 14:105668900-105668922 CGCACGTGACCTCAGGGGTCCGG + Intergenic
1123096609 14:105769894-105769916 CGCACGTGACCTCAGGGGTCCGG + Intergenic
1123160806 14:106276565-106276587 CGGCCGTGTCCTCAGATCTCAGG + Intergenic
1123185301 14:106511134-106511156 CGGCCGTGTCCTCAGATCTCAGG + Intergenic
1123206063 14:106714701-106714723 CGGCCGTGTCCTCAGATCTCAGG + Intergenic
1123208531 14:106737129-106737151 CGGCCGTGTCCTCAGATCTCAGG + Intergenic
1123211147 14:106762111-106762133 CGGCCGTGTCCTCAGATCTCAGG + Intergenic
1123583224 15:21735527-21735549 CGGCCGTGTCCTCAGATCTCAGG + Intergenic
1123619874 15:22178124-22178146 CGGCCGTGTCCTCAGATCTCAGG + Intergenic
1127716400 15:61653226-61653248 CCCAAGTGTCCACAGCTGTCAGG + Intergenic
1132382977 15:101379349-101379371 GGCATGTGTCCACACCTGTCAGG - Intronic
1132658110 16:1049672-1049694 GGCACTTGTCCCCAGATCTCCGG + Intergenic
1140884346 16:79229597-79229619 CGCCCCTGTCCACAGATGGATGG - Intergenic
1142336258 16:89491037-89491059 CGGACGTGGCCCGAGATGTCCGG - Intronic
1150767169 17:68011346-68011368 CGCGCGTGGCCACAGATCTTAGG - Intergenic
1152356756 17:79811296-79811318 CGCACGCATGCACAGGTGTCCGG + Intergenic
1155310919 18:24522495-24522517 GGCTCATTTCCACAGATGTCTGG - Intergenic
1160983323 19:1826623-1826645 TGCACGTGGCCACAGAAGCCTGG + Intronic
934187320 2:89758595-89758617 GGCACGTGTCCACAGAGGAAAGG - Intergenic
937297005 2:120815550-120815572 GGCACGTGACCACAGAGCTCAGG - Intronic
939674217 2:145051717-145051739 CTGAGGTGTCCACAGATGTCTGG - Intergenic
1170398846 20:15958334-15958356 TGCACATGTCCACAGCTGTGGGG - Intronic
1176144748 20:63560561-63560583 TGCACGTGGCCAAAGATGACAGG + Exonic
1177324460 21:19566674-19566696 TGCACGTGGCCACAGAGGCCAGG + Intergenic
1180261883 21:46676023-46676045 CACACATGTCCAAATATGTCTGG - Intergenic
1180637540 22:17272787-17272809 CGCAGGTGGTCACAGATGCCAGG - Intergenic
1185251279 22:49802908-49802930 CTCACGTGTCCACAGAGTTGAGG - Intronic
950892579 3:16417475-16417497 CACAACTGGCCACAGATGTCAGG + Intronic
953624035 3:44555929-44555951 CACACGTGTACAAAGATGACTGG + Intronic
963845952 3:150158398-150158420 CACACGTGTTCCCAGATCTCAGG + Intergenic
964025730 3:152071522-152071544 CTCTCCTGGCCACAGATGTCTGG - Intergenic
969264436 4:6055714-6055736 TGCAGGTGTCCCCAGAGGTCGGG + Intronic
971352898 4:25868531-25868553 GGCATGTGTCCATAGATGTAAGG + Intronic
983261555 4:165462275-165462297 CACACTTGCCCCCAGATGTCTGG - Intronic
984689956 4:182715242-182715264 GGCAAGTGTCCACAGAGGCCCGG - Intronic
990194019 5:53292716-53292738 CTCACGTGTCTACAGTTGTCTGG + Intergenic
997612494 5:135224883-135224905 GGCACCTGGCCAGAGATGTCAGG - Intronic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
999658823 5:153837013-153837035 CACAGGTGTCCACAAATGCCAGG + Intergenic
1006595744 6:35191737-35191759 GGCACGAGTCCACAGAGGACAGG + Intergenic
1008256714 6:49310929-49310951 CGCACGTCTCCCCAGCTTTCAGG - Intergenic
1013755299 6:113454652-113454674 CACACATATCCACAGAAGTCAGG - Intergenic
1015237654 6:130989194-130989216 CACATGTGTCCACAATTGTCTGG - Intronic
1017522417 6:155213826-155213848 TGAACGTGTCCACACATGGCTGG + Intronic
1024013763 7:45293005-45293027 CACACGTGTACACACATGCCTGG - Intergenic
1030090524 7:105853968-105853990 GCCGCGTGTCCACAGATGTTAGG - Intronic
1033558249 7:142507775-142507797 CACACAAGTACACAGATGTCTGG - Intergenic
1035909188 8:3547001-3547023 CCCTCCTGTCCACAGATGTGGGG + Intronic
1041167392 8:55102859-55102881 CGGACGTGGGCACAGACGTCTGG + Exonic
1052785536 9:32824694-32824716 TGCAGGTGACCACAGATATCTGG - Intergenic
1059344830 9:113621023-113621045 GGCAAGTGGCCACAGATGTTAGG - Intergenic
1187242935 X:17530177-17530199 TGAACGTGTCCAGAGATCTCTGG + Intronic
1187697286 X:21935112-21935134 CCCACCTGTCCACACATCTCTGG + Intergenic
1188434396 X:30144103-30144125 TGTAGGTGTCCACAGATTTCAGG + Intergenic