ID: 1077096694

View in Genome Browser
Species Human (GRCh38)
Location 11:802004-802026
Sequence GGACCCGGAATGACAACAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077096694_1077096700 4 Left 1077096694 11:802004-802026 CCAGCTGTTGTCATTCCGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1077096700 11:802031-802053 CACCACTTCACGGCAGCGCCGGG 0: 1
1: 0
2: 0
3: 20
4: 150
1077096694_1077096699 3 Left 1077096694 11:802004-802026 CCAGCTGTTGTCATTCCGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1077096699 11:802030-802052 CCACCACTTCACGGCAGCGCCGG 0: 1
1: 0
2: 0
3: 13
4: 309
1077096694_1077096705 16 Left 1077096694 11:802004-802026 CCAGCTGTTGTCATTCCGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1077096705 11:802043-802065 GCAGCGCCGGGCCTGCGGTGGGG 0: 1
1: 0
2: 1
3: 29
4: 244
1077096694_1077096696 -6 Left 1077096694 11:802004-802026 CCAGCTGTTGTCATTCCGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1077096696 11:802021-802043 GGGTCCTGACCACCACTTCACGG 0: 1
1: 0
2: 0
3: 17
4: 118
1077096694_1077096703 14 Left 1077096694 11:802004-802026 CCAGCTGTTGTCATTCCGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1077096703 11:802041-802063 CGGCAGCGCCGGGCCTGCGGTGG 0: 1
1: 0
2: 2
3: 29
4: 296
1077096694_1077096702 11 Left 1077096694 11:802004-802026 CCAGCTGTTGTCATTCCGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1077096702 11:802038-802060 TCACGGCAGCGCCGGGCCTGCGG 0: 1
1: 0
2: 1
3: 11
4: 148
1077096694_1077096704 15 Left 1077096694 11:802004-802026 CCAGCTGTTGTCATTCCGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1077096704 11:802042-802064 GGCAGCGCCGGGCCTGCGGTGGG 0: 1
1: 0
2: 0
3: 24
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077096694 Original CRISPR GGACCCGGAATGACAACAGC TGG (reversed) Exonic
900514510 1:3074878-3074900 GGACCAGGGATGTCAGCAGCCGG - Intronic
907451447 1:54548150-54548172 GGACGCGGGGTGATAACAGCTGG + Intronic
909890859 1:81005002-81005024 GGACCCAGAGCGACAGCAGCTGG - Intergenic
910690677 1:89962377-89962399 GGACCTGGACTGAGAACAACAGG + Intergenic
1067477388 10:46576015-46576037 GGAGCCTGGAAGACAACAGCTGG + Intergenic
1067617352 10:47765769-47765791 GGAGCCTGGAAGACAACAGCTGG - Intergenic
1070835408 10:79444634-79444656 GGTCCCCGAGTGAGAACAGCAGG + Intronic
1071145101 10:82559552-82559574 GGACCCAGAAGGACAGCAGCTGG + Intronic
1072291028 10:93964833-93964855 GAACCCTGAATAAAAACAGCTGG - Intergenic
1074860980 10:117510281-117510303 GAATCTGGAATGACATCAGCTGG + Intergenic
1077080779 11:723850-723872 GGACCAGGAATGAGCACAGAAGG - Intronic
1077096694 11:802004-802026 GGACCCGGAATGACAACAGCTGG - Exonic
1083147507 11:60770155-60770177 TGAGCTGGGATGACAACAGCCGG - Intronic
1086503181 11:87474251-87474273 AGACCAGGAATAGCAACAGCAGG - Intergenic
1104763340 12:131311412-131311434 GGACCAGGAATGAAGTCAGCAGG + Intergenic
1104816157 12:131646658-131646680 GGACCAGGAATGAAGTCAGCAGG - Intergenic
1110149172 13:72229070-72229092 GGACCTGGAAAGACCACAACTGG - Intergenic
1112327706 13:98454172-98454194 TGACCTGGTATGACAACAGAAGG + Intronic
1113740942 13:112712009-112712031 GAACCCAGAGTGAGAACAGCTGG + Intronic
1114379764 14:22190172-22190194 GGACCACGAATGCCCACAGCAGG - Intergenic
1121358757 14:93235916-93235938 GGACCAGGAATGAAAACAGGAGG - Intergenic
1124689047 15:31806582-31806604 GGACCCCCAATGACCACTGCTGG + Intronic
1126423338 15:48498990-48499012 GGGCCAGGAATGACGTCAGCAGG - Exonic
1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG + Exonic
1140817991 16:78638351-78638373 GGACAGGGAATGAAAAGAGCTGG - Intronic
1140952854 16:79835817-79835839 AGACCCGGGATGACAAAAGCAGG + Intergenic
1143772365 17:9176856-9176878 GGACCAGAAAAGACAACTGCAGG - Intronic
1151951201 17:77355183-77355205 GGCCACGGAATGAAAACAGGAGG - Intronic
1152071283 17:78134938-78134960 GGACCAGAAATGTGAACAGCAGG - Exonic
1153520675 18:5950532-5950554 GGTCCTGGAAGGACAACATCTGG + Intergenic
1155027790 18:21958028-21958050 GGATCAGTAATGACATCAGCTGG - Intergenic
1156340170 18:36203511-36203533 GGACCCAGAAAGGCAAGAGCAGG - Intronic
1163302314 19:16455770-16455792 ATACCAGGAATCACAACAGCCGG - Intronic
928031081 2:27779956-27779978 GGACCAGGAATGACAAAAAGAGG + Intronic
937198759 2:120183103-120183125 GGACCGAGAATGAGAACAGGTGG - Intergenic
945629898 2:212261011-212261033 GGACCCAGAATGAGAAAACCTGG + Intronic
945867538 2:215193513-215193535 GGAAAAGGAATGACAGCAGCTGG + Intergenic
1168771233 20:418100-418122 GGACCCATCATGAGAACAGCTGG + Intronic
1181990201 22:26831518-26831540 AGATCAGGAATGACATCAGCAGG + Intergenic
1183524996 22:38317476-38317498 GGGCCGGGGATGACATCAGCGGG - Intronic
1185018228 22:48358136-48358158 GGGCCAGGAATGGGAACAGCAGG + Intergenic
950195981 3:11009584-11009606 GGACCAGGAAGGAGACCAGCTGG + Intronic
956287717 3:67628101-67628123 GGACCCCAAATGATAAAAGCAGG + Intronic
958097263 3:88962895-88962917 GGACCCCGACTTGCAACAGCTGG - Intergenic
964062837 3:152545095-152545117 GGAACTCAAATGACAACAGCAGG + Intergenic
964749981 3:160045682-160045704 AAAGCCTGAATGACAACAGCAGG + Intergenic
968481627 4:835569-835591 GGACCCGGCCTGTGAACAGCAGG - Intergenic
968659838 4:1794365-1794387 AGAACCCGAATAACAACAGCGGG - Intronic
977590360 4:98819472-98819494 GGACTCCCAATGACAAAAGCTGG + Intergenic
982843813 4:160224434-160224456 GGACCCAGAATGACACATGCAGG + Intergenic
984709051 4:182869766-182869788 GGACCCGGAATTACCACAGAGGG - Intergenic
998219577 5:140265709-140265731 GGACCTGGAATGTCTGCAGCAGG + Intronic
1005254084 6:23981368-23981390 GGCCCCTGAATGGCAGCAGCAGG - Intergenic
1010047147 6:71458535-71458557 GGACCCAGAAGAACAGCAGCTGG - Intergenic
1012170998 6:96016296-96016318 GGACGGGGAATCACAGCAGCTGG - Intronic
1015581770 6:134732922-134732944 GCTCCCGGAATGTCATCAGCTGG + Intergenic
1033589087 7:142795834-142795856 GGACCCTGCAAGACCACAGCTGG - Intergenic
1041294596 8:56342001-56342023 GAAGCAGGAATGAGAACAGCAGG - Intergenic
1046228261 8:111315821-111315843 GAGCTCGGAAGGACAACAGCAGG + Intergenic
1047766579 8:127994784-127994806 GGACCAGGAATGCCAAGGGCAGG + Intergenic
1048462035 8:134629060-134629082 GGACCCACGAGGACAACAGCAGG + Intronic
1049753627 8:144297698-144297720 GGACCCGGAGAGGGAACAGCCGG + Intronic
1051823632 9:21194978-21195000 AGACTAGGAATGAGAACAGCCGG - Intergenic
1055865815 9:80811876-80811898 GGACCCCTAAGGAGAACAGCAGG - Intergenic
1186480243 X:9891069-9891091 GGACCAGGAAGGACAGCCGCTGG - Exonic
1200827596 Y:7660137-7660159 GGACCTGAAATGACAACCGGAGG + Intergenic