ID: 1077097483

View in Genome Browser
Species Human (GRCh38)
Location 11:805158-805180
Sequence AGGTACGCGCCGGCCTGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077097483_1077097493 4 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097483_1077097497 30 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097497 11:805211-805233 CTCAGCGGGCGCTCGGCGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 111
1077097483_1077097496 23 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097496 11:805204-805226 GTGGCTGCTCAGCGGGCGCTCGG 0: 1
1: 0
2: 1
3: 13
4: 150
1077097483_1077097489 -10 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097489 11:805171-805193 GCGCGTACCTGCGCTGCAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 68
1077097483_1077097491 0 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097491 11:805181-805203 GCGCTGCAGGCGGCGCGCAAAGG 0: 1
1: 0
2: 1
3: 11
4: 79
1077097483_1077097494 15 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097494 11:805196-805218 CGCAAAGGGTGGCTGCTCAGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1077097483_1077097492 1 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097492 11:805182-805204 CGCTGCAGGCGGCGCGCAAAGGG 0: 1
1: 0
2: 0
3: 1
4: 36
1077097483_1077097495 16 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097495 11:805197-805219 GCAAAGGGTGGCTGCTCAGCGGG 0: 1
1: 0
2: 1
3: 18
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077097483 Original CRISPR AGGTACGCGCCGGCCTGGGC GGG (reversed) Exonic
900252129 1:1676357-1676379 AGGTAGGCGGCGGCTCGGGCAGG - Exonic
900262539 1:1739215-1739237 AGGTAGGCGGCGGCTCGGGCAGG - Exonic
900371872 1:2335832-2335854 AGCTGCGCGCTGGGCTGGGCTGG - Intronic
901196208 1:7441377-7441399 CTGTACGCACCGCCCTGGGCTGG + Intronic
902214288 1:14924575-14924597 AGGTGCGCGCGGGGCGGGGCGGG + Intronic
903063575 1:20686036-20686058 AGGTACTCACAGGCCTGGGCGGG + Exonic
903190204 1:21651996-21652018 TTGTTCGCGCCGCCCTGGGCCGG + Intronic
922593310 1:226795310-226795332 AGGTATGTGATGGCCTGGGCTGG + Intergenic
1063458998 10:6203588-6203610 AGGGACGCGCGCGCCTGGGCAGG + Intronic
1065390339 10:25175757-25175779 GGGTGCGCGCTGGCCAGGGCTGG - Exonic
1067841012 10:49679593-49679615 CGCTACGCGCCGGGCGGGGCCGG - Intergenic
1074450087 10:113552147-113552169 AGGTAGGGGCAGGGCTGGGCAGG + Intronic
1075747623 10:124738634-124738656 TGGTACGCCCCAGCCAGGGCTGG - Intronic
1076724133 10:132405461-132405483 AGGTCCGCGCCGGCCGGCACAGG - Exonic
1076852242 10:133098964-133098986 AGGTTAGCGCCGGCCTGGAGGGG - Intronic
1077097483 11:805158-805180 AGGTACGCGCCGGCCTGGGCGGG - Exonic
1077169258 11:1159054-1159076 AGGTGGGGGCAGGCCTGGGCTGG + Intronic
1077244465 11:1529501-1529523 AGGTGAGCGTCGGCCTGTGCAGG - Intergenic
1077367331 11:2166459-2166481 AGGTACGCCGCGGCCTCGGAGGG - Exonic
1081856636 11:46308143-46308165 GGGTAGGCGGAGGCCTGGGCTGG - Intronic
1084526343 11:69700777-69700799 AGCTGGGCGCCGGCCTGGCCTGG - Intronic
1085235207 11:75009315-75009337 AGCTAAGTGCCGGCCTGTGCAGG - Exonic
1091789471 12:3263516-3263538 AGCAACGCACCGGCCTGGGGAGG + Intronic
1096105896 12:48997076-48997098 AGCGGCGCGCCGGCCGGGGCTGG - Exonic
1097251041 12:57632496-57632518 GGGGGCGCGCCGGCCAGGGCGGG - Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1118019346 14:61695399-61695421 GAGCGCGCGCCGGCCTGGGCAGG + Intergenic
1119719982 14:76883950-76883972 AGGTCAGAGCGGGCCTGGGCTGG - Intergenic
1122399249 14:101457735-101457757 AGGGAGGCGCGGGCCTGGCCTGG + Intergenic
1127768090 15:62207569-62207591 TGGTGCTCGCCGGCCGGGGCAGG + Intergenic
1132055529 15:98648422-98648444 TTGCGCGCGCCGGCCTGGGCCGG + Intergenic
1132527974 16:426719-426741 AGGTACGGAGCGGCCCGGGCCGG + Exonic
1137785607 16:51134986-51135008 AGGTGGGCGCTGACCTGGGCCGG - Intergenic
1141828647 16:86497636-86497658 AGGGGCGCGCCGGCTGGGGCCGG - Intergenic
1141972288 16:87492332-87492354 GGGGACGCGCGGGCCGGGGCCGG + Intergenic
1142116253 16:88357576-88357598 AGGCAGGCGGGGGCCTGGGCAGG + Intergenic
1144816692 17:18039901-18039923 AGGTGAGCGCCGGGCCGGGCCGG + Exonic
1148128284 17:45247883-45247905 AGACACGCCCCGGGCTGGGCGGG + Intergenic
1148157145 17:45431008-45431030 CGGTGCGGGCCGGGCTGGGCGGG - Intronic
1152628131 17:81397590-81397612 CGGGAGGCGCCGGCCGGGGCTGG + Intronic
1160714973 19:572437-572459 ATGTACGCGCCGGCTCCGGCAGG - Intronic
1160739639 19:680008-680030 CGGTGCGCGCGGGCCGGGGCGGG - Intronic
1160801487 19:972095-972117 TGGAGCCCGCCGGCCTGGGCAGG + Exonic
1161043801 19:2123809-2123831 AGGTACGTCCCGCACTGGGCGGG - Exonic
1163012212 19:14433350-14433372 GGGGACGCGGCGGCCTGGCCAGG + Intronic
1163304907 19:16471892-16471914 AGGTACGGGCCGGGCGGGCCTGG - Exonic
1164693809 19:30228742-30228764 AGCTGCGCGCCGCCCCGGGCCGG + Intronic
925407185 2:3613381-3613403 AGGTACCTGCAGCCCTGGGCCGG + Exonic
926268073 2:11344329-11344351 AGGGCCGGGCCGGGCTGGGCCGG - Exonic
927443383 2:23136031-23136053 AGGCAGGCGCTGGCCTGGGTGGG + Intergenic
927472382 2:23385779-23385801 AGGTAAGAGCCGGGCCGGGCTGG + Exonic
927949627 2:27158881-27158903 AGCTCAGCCCCGGCCTGGGCCGG - Intergenic
935865301 2:107381471-107381493 AGGTACGTGCAGGCTGGGGCAGG + Intergenic
946235679 2:218323236-218323258 AGGCACGCGCCGGCCGGGCGGGG - Intronic
946278713 2:218650461-218650483 AGGTACACCCTTGCCTGGGCAGG - Exonic
946404363 2:219484582-219484604 GGGTCCCCGCCGGGCTGGGCCGG - Exonic
946431000 2:219627470-219627492 GGGGCCGCGCCGGCCGGGGCGGG + Intronic
1174569717 20:51492830-51492852 AAGTGAGCGCCGGCCGGGGCTGG + Intronic
1178913770 21:36695960-36695982 AGGTAGGCGCCGGCGCGGCCTGG + Intergenic
1179893697 21:44350274-44350296 AGGTAGGTGCCCGCCGGGGCCGG + Intronic
1180612836 22:17108916-17108938 AGCTCCGCGCCGCCCTGGACAGG + Exonic
1182729427 22:32475123-32475145 AGGTACGCTGGGGCCGGGGCTGG + Exonic
1183294087 22:37019640-37019662 GGGGCCGCGCGGGCCTGGGCTGG + Intronic
1184222822 22:43111419-43111441 AGGTGCGCCCCAGACTGGGCGGG + Intronic
1184645419 22:45892339-45892361 AGGGATGCCCCGGGCTGGGCAGG - Intergenic
1185370777 22:50459931-50459953 AGGTGAGGGCCGGCCAGGGCTGG - Exonic
950487747 3:13282939-13282961 AGGTACTCGGCCGCCTGGCCGGG + Intergenic
956406375 3:68932517-68932539 AGCTGCGCGCCGCCCTGGACGGG - Exonic
981033758 4:140151267-140151289 AGGATCGCGCCGACCTGGGAGGG + Intronic
984638855 4:182142688-182142710 AGGTTGGCGACGGCCGGGGCAGG + Intergenic
984864161 4:184266911-184266933 AGGCACGCACTGGGCTGGGCTGG + Intergenic
985788081 5:1910373-1910395 AGTCAGACGCCGGCCTGGGCAGG - Intergenic
988497558 5:31758040-31758062 AGATGAGCCCCGGCCTGGGCAGG - Intronic
990825496 5:59893585-59893607 AGCAGCGCGCCGGCCCGGGCGGG - Exonic
999142618 5:149372366-149372388 AGGTATGTGCCTGCCTGGGATGG - Intronic
999768421 5:154756964-154756986 AGGGAGTGGCCGGCCTGGGCGGG + Intronic
1001596659 5:172902984-172903006 AGGTACGCAAGGGCCTGGGGAGG - Intronic
1001746919 5:174099299-174099321 TGGAACTCGCCGGCCTGAGCCGG + Intronic
1002071315 5:176680342-176680364 AGGCACCCACCCGCCTGGGCCGG + Intergenic
1002276738 5:178108827-178108849 AGGTGCGTGCCGGTGTGGGCAGG + Intergenic
1002281059 5:178130545-178130567 AGGTGCGCACCGGCCTCGGCAGG - Intergenic
1002281302 5:178131375-178131397 AGGTGCGCACCGGGCTCGGCAGG + Exonic
1002337085 5:178487224-178487246 AGGGAAGCCCTGGCCTGGGCTGG - Intronic
1003061920 6:2870367-2870389 AGGTGGGCGCAGGCGTGGGCGGG - Intergenic
1003472501 6:6450490-6450512 AGGTGCTGGCCGGCCTGAGCAGG + Intergenic
1003868497 6:10383673-10383695 AGGGACACGCCGCCCCGGGCCGG + Intergenic
1006366899 6:33621347-33621369 AGGTACGCGCGGGCCGGGCGGGG + Exonic
1006706866 6:36028054-36028076 AGGTCCCCGCCCGGCTGGGCGGG + Exonic
1018756334 6:166852771-166852793 AGGGACCCTCAGGCCTGGGCAGG - Intronic
1019473105 7:1231611-1231633 AGGAGAGCTCCGGCCTGGGCTGG - Intergenic
1020420553 7:7999566-7999588 CGGTACACTCCAGCCTGGGCAGG + Intronic
1028856155 7:95596418-95596440 TTGTGCGCCCCGGCCTGGGCTGG + Exonic
1030884541 7:114922150-114922172 AGGCCAGAGCCGGCCTGGGCTGG - Exonic
1035314541 7:157989899-157989921 AGGTCAGCGCAGCCCTGGGCAGG - Intronic
1035431859 7:158828914-158828936 AGGGAAGCGCCTGCCTGGACCGG + Intronic
1037116887 8:15237564-15237586 AGGTACGTGCGGGTCCGGGCGGG - Exonic
1039554725 8:38467861-38467883 AGGGAGGCGCCGGCCCCGGCTGG + Intronic
1040981760 8:53251739-53251761 AGGGACCTGCCGGCCTGGGGCGG - Intergenic
1047798866 8:128288128-128288150 TGGTAAGTGCCTGCCTGGGCTGG - Intergenic
1061862427 9:133474930-133474952 GGGTGGGCGCCGGCCGGGGCTGG + Intronic
1062076757 9:134593943-134593965 TGGGAAGCGCTGGCCTGGGCAGG + Intergenic
1188506425 X:30889222-30889244 GGGTACGCGCCGTGCAGGGCCGG + Intronic
1189509511 X:41648168-41648190 AGGTACGCCTCGGGGTGGGCGGG - Intronic
1197746135 X:129932880-129932902 CGGGACGCGCCGGCCCGGCCTGG - Intergenic