ID: 1077097483

View in Genome Browser
Species Human (GRCh38)
Location 11:805158-805180
Sequence AGGTACGCGCCGGCCTGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077097483_1077097489 -10 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097489 11:805171-805193 GCGCGTACCTGCGCTGCAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 68
1077097483_1077097497 30 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097497 11:805211-805233 CTCAGCGGGCGCTCGGCGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 111
1077097483_1077097491 0 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097491 11:805181-805203 GCGCTGCAGGCGGCGCGCAAAGG 0: 1
1: 0
2: 1
3: 11
4: 79
1077097483_1077097493 4 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097483_1077097494 15 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097494 11:805196-805218 CGCAAAGGGTGGCTGCTCAGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1077097483_1077097495 16 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097495 11:805197-805219 GCAAAGGGTGGCTGCTCAGCGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1077097483_1077097496 23 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097496 11:805204-805226 GTGGCTGCTCAGCGGGCGCTCGG 0: 1
1: 0
2: 1
3: 13
4: 150
1077097483_1077097492 1 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097492 11:805182-805204 CGCTGCAGGCGGCGCGCAAAGGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077097483 Original CRISPR AGGTACGCGCCGGCCTGGGC GGG (reversed) Exonic