ID: 1077097493

View in Genome Browser
Species Human (GRCh38)
Location 11:805185-805207
Sequence TGCAGGCGGCGCGCAAAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077097482_1077097493 7 Left 1077097482 11:805155-805177 CCGCCCGCCCAGGCCGGCGCGTA 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097487_1077097493 -6 Left 1077097487 11:805168-805190 CCGGCGCGTACCTGCGCTGCAGG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097476_1077097493 16 Left 1077097476 11:805146-805168 CCGCCCCCTCCGCCCGCCCAGGC 0: 1
1: 0
2: 9
3: 212
4: 1647
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097481_1077097493 10 Left 1077097481 11:805152-805174 CCTCCGCCCGCCCAGGCCGGCGC 0: 1
1: 1
2: 5
3: 81
4: 651
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097486_1077097493 -1 Left 1077097486 11:805163-805185 CCAGGCCGGCGCGTACCTGCGCT 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097483_1077097493 4 Left 1077097483 11:805158-805180 CCCGCCCAGGCCGGCGCGTACCT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097479_1077097493 12 Left 1077097479 11:805150-805172 CCCCTCCGCCCGCCCAGGCCGGC 0: 1
1: 0
2: 2
3: 57
4: 560
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097473_1077097493 20 Left 1077097473 11:805142-805164 CCCGCCGCCCCCTCCGCCCGCCC 0: 1
1: 3
2: 39
3: 367
4: 2343
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097474_1077097493 19 Left 1077097474 11:805143-805165 CCGCCGCCCCCTCCGCCCGCCCA 0: 1
1: 3
2: 15
3: 335
4: 2368
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097484_1077097493 3 Left 1077097484 11:805159-805181 CCGCCCAGGCCGGCGCGTACCTG 0: 1
1: 0
2: 0
3: 20
4: 93
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097472_1077097493 21 Left 1077097472 11:805141-805163 CCCCGCCGCCCCCTCCGCCCGCC 0: 1
1: 5
2: 52
3: 378
4: 2385
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097480_1077097493 11 Left 1077097480 11:805151-805173 CCCTCCGCCCGCCCAGGCCGGCG 0: 1
1: 0
2: 3
3: 19
4: 274
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097477_1077097493 13 Left 1077097477 11:805149-805171 CCCCCTCCGCCCGCCCAGGCCGG 0: 1
1: 0
2: 7
3: 77
4: 652
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1077097485_1077097493 0 Left 1077097485 11:805162-805184 CCCAGGCCGGCGCGTACCTGCGC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077097493 Original CRISPR TGCAGGCGGCGCGCAAAGGG TGG Exonic
900495871 1:2975778-2975800 TGCAGGCGGAGGGCGAGGGGTGG - Intergenic
901055574 1:6447384-6447406 TGCAGGGGGCGCGGAGCGGGCGG + Intronic
902417651 1:16250959-16250981 CCCAGGCGGCGAGCAATGGGAGG + Exonic
903233838 1:21937257-21937279 TGCGGGCGGCGCGGAGCGGGCGG - Exonic
904896975 1:33824815-33824837 TGCAGGAGAAGGGCAAAGGGAGG + Intronic
905726653 1:40258116-40258138 TGCCAGCAGCGCGCAGAGGGAGG + Exonic
905726862 1:40259459-40259481 TGCCAGCAGCGCGCAGAGGGAGG + Intronic
906277036 1:44524111-44524133 TGCTGGAGGGGGGCAAAGGGAGG + Intronic
912952018 1:114126800-114126822 AGCAGGCTGCGAGCAGAGGGAGG + Intronic
914771797 1:150693471-150693493 TGCAGGCGGTGGGCGAGGGGGGG + Intronic
920021182 1:202957968-202957990 CGGAGGCGGCGCGCAGTGGGAGG + Intronic
921155017 1:212432800-212432822 CGCAGGAGGCGCGCGAAGGGCGG + Intergenic
1062934281 10:1374609-1374631 TGCATACGGCGGGCAGAGGGAGG - Intronic
1068989036 10:63132543-63132565 GGCAGGGGGCGGGCAGAGGGAGG + Intergenic
1069664490 10:70145665-70145687 CGCGGGCGGCGCGGAAAAGGGGG + Exonic
1073206127 10:101770366-101770388 CGCAGGCTGCGCGTGAAGGGCGG + Exonic
1075316434 10:121457392-121457414 TGCAGGCGGGGCCTAATGGGAGG - Intergenic
1075730923 10:124636445-124636467 TGCAGGCGTCTGGCACAGGGTGG - Intronic
1077097493 11:805185-805207 TGCAGGCGGCGCGCAAAGGGTGG + Exonic
1083880855 11:65547601-65547623 AGGAGGCGGCGGGCAAGGGGAGG + Intronic
1091226084 11:133957044-133957066 TGCGGGCGGCGCCCAATAGGCGG - Intergenic
1094445431 12:30524582-30524604 TGCAGGCTGTGCTCCAAGGGTGG - Intergenic
1096700695 12:53380675-53380697 AGCAGGCGGCGACCAGAGGGCGG - Intronic
1100760065 12:97797466-97797488 TGCAGGTGGGGTGCACAGGGTGG + Intergenic
1102924926 12:116819375-116819397 AGCCGGCGGCGCGCAGAGCGGGG + Intronic
1106709639 13:32315893-32315915 TGAAGGCGGAGCCCAAAGGCCGG - Intronic
1107884782 13:44866257-44866279 GGGAGGCGGGGCGGAAAGGGAGG - Intergenic
1108689004 13:52846082-52846104 AGAAGGAGGTGCGCAAAGGGGGG - Exonic
1109286838 13:60419631-60419653 TGGGGGCGGGGGGCAAAGGGAGG + Intronic
1113465102 13:110507265-110507287 TGGAGGCGGGGCGCACAGGCAGG - Intronic
1113895071 13:113759178-113759200 TGCAGGGGGCGGGGAAGGGGCGG + Intergenic
1122905842 14:104801096-104801118 TGCAGGCAGCGCGGAAAGAGCGG - Exonic
1128466355 15:67915798-67915820 GGCAGGCGGCTGGCAAAGGCAGG - Intergenic
1133286562 16:4693530-4693552 TGCGGGCGGTGTGCAAAGGAGGG - Intergenic
1133741233 16:8653047-8653069 TGCATGCGCCGGGCAAACGGTGG + Intergenic
1134385049 16:13763920-13763942 TGCAGGAGGAGGACAAAGGGTGG + Intergenic
1139383676 16:66550129-66550151 TCCAGGCGGCGCCCAACGGCTGG - Exonic
1141702648 16:85649640-85649662 TCCAGGCTGCGCGCCAGGGGTGG - Intronic
1142509769 17:386094-386116 GGCCGGCGGGGCGCACAGGGAGG - Intronic
1143900765 17:10173166-10173188 TGCTGGGGGCGGGCGAAGGGAGG + Intronic
1147840666 17:43369114-43369136 CGGAGGGGGCGCGCAGAGGGAGG + Intergenic
1148844508 17:50521329-50521351 TGGAGGTGGTGGGCAAAGGGTGG + Exonic
1160724964 19:613828-613850 TGCACGTGGCGCGCAGGGGGGGG - Intronic
1161571743 19:5034634-5034656 TGGAGGCGGCCCGGAAAGGCAGG - Intronic
1165675527 19:37719439-37719461 TGCAGGAGGCGCTCAGAGCGCGG - Exonic
1168409009 19:56127029-56127051 TGCAGCTGGGGCGCAGAGGGAGG + Intergenic
926306645 2:11641817-11641839 TCCAGGCGCCGGGCAATGGGTGG - Exonic
927432067 2:23035137-23035159 TGCAGGAGGCCTGCAGAGGGGGG - Intergenic
944413614 2:199463628-199463650 TGCAGGCGACGCGGAAGGGTTGG - Intronic
1171175657 20:23049524-23049546 TGCAGGCGCCGGGGAAAGCGCGG + Exonic
1173274766 20:41570325-41570347 TGCAGGCAGCCCTCAAAGAGAGG + Intronic
1176070256 20:63222555-63222577 TGCAGGTGGCCCAGAAAGGGAGG + Intergenic
1176427322 21:6556829-6556851 TGCAGGTGGCGGGCAGGGGGAGG - Intergenic
1176521900 21:7830408-7830430 TGCAGGCGGGTCGCAGAGGCAGG + Intergenic
1178655920 21:34460420-34460442 TGCAGGCGGGTCGCAGAGGCAGG + Intergenic
1179702813 21:43165146-43165168 TGCAGGTGGCGGGCAGGGGGAGG - Intergenic
964323902 3:155526221-155526243 TCCAGGCCACGCTCAAAGGGAGG - Intronic
974308321 4:60171831-60171853 TGCAGGCGGTACACAAAGTGTGG + Intergenic
982292168 4:153791098-153791120 TGCAGCCGGCGCGCGGAGCGCGG - Intergenic
984823514 4:183905253-183905275 TGCGCGCGGCGCGCGAGGGGAGG - Intronic
995650376 5:114362254-114362276 TGCGGGAGGGGCGCGAAGGGCGG - Exonic
1002185842 5:177454562-177454584 AGCAGGGGGCGCGCGAAGGACGG - Intronic
1006096377 6:31659203-31659225 GGCAGGCGAAGTGCAAAGGGTGG + Exonic
1006472128 6:34235378-34235400 GGGAGCCGGCGCGCAGAGGGCGG + Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1015625988 6:135181436-135181458 GGCAGGCGGCGGGCAGCGGGAGG + Exonic
1035387797 7:158485597-158485619 AGCAGGCGGGGCGCAGAGAGGGG - Intronic
1038544044 8:28412086-28412108 TGCAGGCGGCGCGCAGGGGTGGG - Intronic
1045387937 8:101689340-101689362 TGCAGGAGGCGCACAATGGACGG + Exonic
1056872946 9:90302009-90302031 GGCAGGTGGGGAGCAAAGGGAGG - Intergenic
1061204160 9:129153300-129153322 TGCAGGCGGAGGGCGGAGGGAGG + Intergenic
1062594991 9:137295520-137295542 TGCGGGCGGCGGCCACAGGGCGG + Intergenic
1197734948 X:129843621-129843643 TCCAGGCGCCGCGGAAGGGGAGG + Intronic
1200746645 Y:6909974-6909996 TTAAGGCCGCGCGCGAAGGGAGG + Intergenic