ID: 1077098429

View in Genome Browser
Species Human (GRCh38)
Location 11:809973-809995
Sequence CGACCTCGGTGGCGACAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077098429 Original CRISPR CGACCTCGGTGGCGACAGGG AGG (reversed) Exonic
900092438 1:926225-926247 CCTCCCCGGTGGAGACAGGGGGG + Intronic
912429421 1:109621148-109621170 GGACCACGGCGGCGACAGCGGGG - Exonic
1067807921 10:49405934-49405956 GGACCTGGGTGGGGACAGGCAGG - Intergenic
1068561079 10:58514205-58514227 CCACATCGGTGGCTACAGGTAGG - Intronic
1075562591 10:123479197-123479219 CGACCTTGGTGTCTACTGGGCGG + Intergenic
1076107625 10:127835816-127835838 AGACCTGTGTGGGGACAGGGTGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1081872665 11:46390679-46390701 CGACCACGGCGGAGACATGGAGG - Intergenic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1088256492 11:107908352-107908374 CGACCTCGTTTGCATCAGGGAGG - Intronic
1097352255 12:58561870-58561892 AGACCTCAGTGGTGAGAGGGAGG + Intronic
1101409684 12:104457918-104457940 CGACCTCGGCAGCAGCAGGGAGG - Intronic
1103596831 12:122029357-122029379 CAACCCCCGTGGTGACAGGGTGG + Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1119606471 14:76022342-76022364 TTACCTCGCTGCCGACAGGGAGG + Exonic
1121019173 14:90568613-90568635 AGTCCTCGGTGAGGACAGGGTGG + Intronic
1121778857 14:96608821-96608843 CCACCTCCGTGGCCACAGTGAGG - Intergenic
1124616995 15:31249078-31249100 CGCCCTCGCTGGCTGCAGGGAGG - Intergenic
1128208136 15:65870357-65870379 CGACCTGGGTGGTGGGAGGGAGG + Intronic
1143708618 17:8718163-8718185 CGCCCACGGTGGCGGCGGGGAGG + Intergenic
1146833215 17:36088624-36088646 CGACCTCGGTGGGCCCAGTGGGG - Exonic
1150096596 17:62381601-62381623 CGATCTTGGTGGAGTCAGGGAGG - Intronic
1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG + Intergenic
1152921539 17:83068627-83068649 CGACAGCGGGGGCGACAGCGGGG + Intergenic
1156268062 18:35506032-35506054 AGGCCTTGGTGGGGACAGGGTGG + Intergenic
1160011293 18:75108731-75108753 GGCCCTCGGTGGAGGCAGGGAGG - Intergenic
1160767603 19:815351-815373 AGGCCTCGGTGCCCACAGGGAGG + Intronic
1161087458 19:2341583-2341605 CGACAGCGGTGGGGACCGGGCGG - Intronic
1166043894 19:40218289-40218311 CGAGCCCGGTGGGGAGAGGGCGG + Exonic
925398915 2:3558086-3558108 CGACCCCGATGCCGGCAGGGAGG + Intronic
927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG + Intronic
931252931 2:60549996-60550018 CGAGCTCCGAGGCGAGAGGGGGG + Intronic
934941481 2:98506169-98506191 AGACATGGGTGGGGACAGGGCGG + Intronic
1173717049 20:45217541-45217563 TGACCTTGGTGGGGGCAGGGGGG + Intergenic
950692576 3:14671928-14671950 CGAGCATGGGGGCGACAGGGAGG - Exonic
962899022 3:139740981-139741003 CAACCTCGCTGGAGACAGGTGGG + Intergenic
968453687 4:686846-686868 CGCCCTCGGGGGAGGCAGGGTGG - Intronic
969573721 4:8024643-8024665 CGACCTCGGAGGCCACACGAAGG - Intronic
978618707 4:110619529-110619551 CGCCGTCTGGGGCGACAGGGAGG - Intronic
985824088 5:2180159-2180181 ACACCTCGGGGGCGAGAGGGTGG + Intergenic
998176440 5:139904632-139904654 CTACCTCGGTGGGCCCAGGGAGG - Intronic
999247030 5:150160529-150160551 AGACCTCGGTGGCTACAGTCTGG - Intergenic
1000091282 5:157931594-157931616 TGACCTCGGCGGCGTCAGGGAGG + Intergenic
1001839727 5:174864869-174864891 CTCCCTGGGTGGGGACAGGGTGG - Intergenic
1002569340 5:180131142-180131164 AGACCTCTGTGGCTGCAGGGTGG - Intronic
1004674715 6:17830541-17830563 CGACCACAGTGGCAACAGGGCGG + Intronic
1006144212 6:31948583-31948605 CTACCTTGAGGGCGACAGGGAGG + Intronic
1024618684 7:51138342-51138364 CCACCTCCATGGCAACAGGGAGG + Intronic
1028393486 7:90341309-90341331 AGACCTCGGTGGTGATCGGGAGG + Intronic
1034267218 7:149787051-149787073 CAGCCTCGGTGGCGGCAGGCTGG - Intergenic
1038765405 8:30423408-30423430 CTACCTCGGAGGGGACAGTGAGG + Intronic
1045367701 8:101492520-101492542 CGAGCTCGGAGGCGGCCGGGCGG - Exonic
1056965948 9:91163013-91163035 GGGTCTCTGTGGCGACAGGGAGG - Intergenic
1060208910 9:121698901-121698923 CAAGCTCGGAGGCGGCAGGGAGG + Intronic
1061216131 9:129223033-129223055 CGGCCTCAGAGGGGACAGGGAGG - Intergenic
1062394155 9:136346003-136346025 TGACCACTGTGGCCACAGGGTGG + Intronic
1062518523 9:136947734-136947756 CGGCCTGGGTGGGGGCAGGGAGG + Intronic
1062715933 9:138010074-138010096 CAAGGTAGGTGGCGACAGGGAGG + Exonic
1186509140 X:10117435-10117457 CGAGCTTGGGGGCGACAGCGAGG - Exonic
1190065188 X:47235612-47235634 CGGCCTGGATGGAGACAGGGAGG - Intronic