ID: 1077098675

View in Genome Browser
Species Human (GRCh38)
Location 11:811209-811231
Sequence CTGTAGTCCCAGACTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 5, 2: 52, 3: 140, 4: 518}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077098668_1077098675 27 Left 1077098668 11:811159-811181 CCTCGTCTCTAAAATACAATAAA 0: 1
1: 7
2: 147
3: 1096
4: 9756
Right 1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG 0: 1
1: 5
2: 52
3: 140
4: 518
1077098671_1077098675 -3 Left 1077098671 11:811189-811211 CCAGGCTTGGTTGCTCATGCCTG 0: 3
1: 499
2: 16949
3: 74020
4: 162872
Right 1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG 0: 1
1: 5
2: 52
3: 140
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077098675 Original CRISPR CTGTAGTCCCAGACTGAGGT GGG Intronic
901384070 1:8895516-8895538 CTGTAATCCCAGACCGAGGTGGG + Intergenic
902217099 1:14941174-14941196 CTGTAATCCCAGACTTTGGGAGG - Intronic
902508005 1:16950478-16950500 ATGTAGTCCCAGCCTCAGGGAGG - Intronic
902699541 1:18162302-18162324 CTGTAATCCCAGACTTGGGGAGG - Intronic
902905301 1:19552225-19552247 CTGTAATCCCAGCCTGAGGCAGG + Intergenic
903517154 1:23919048-23919070 CTGTAATCCCAGACTTTGGGAGG + Intergenic
903570214 1:24298584-24298606 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
904107939 1:28101517-28101539 CTGTAATCCTAGACTGAGGCAGG + Intergenic
905063449 1:35159451-35159473 CTGTAATCCCAGCCTGTGGGAGG - Intergenic
905232357 1:36522142-36522164 CTGGAGACCCAGTCTGAGGGGGG - Intergenic
906581925 1:46942208-46942230 CTATAGTACTAGACTGAAGTAGG - Intergenic
906601785 1:47136691-47136713 CTATAGTACTAGACTGAAGTAGG + Intergenic
907006895 1:50923300-50923322 CTGTAGTCCTAGCCTGAGGCAGG + Intronic
907633537 1:56108837-56108859 CTGTAATCCCAGACTTTGGGAGG + Intergenic
907794282 1:57699195-57699217 CTGTAATCCCAGACTTAGGGAGG - Intronic
908169892 1:61493924-61493946 CTGTAATCCCAGGCTGAGGCAGG - Intergenic
909028399 1:70509659-70509681 CTGTAATCCCACACTTAGGGAGG - Intergenic
909240599 1:73207719-73207741 CTGTAGTCCAAGAGTGTGCTTGG - Intergenic
909242694 1:73235183-73235205 CTGTAATCCCAGACTTTGGAAGG - Intergenic
909487736 1:76192322-76192344 CTGTAGTCCTGAACTGAGATTGG + Intronic
910064622 1:83138687-83138709 CTGTAGTCCAAGAGTAAGTTTGG + Intergenic
910333484 1:86102729-86102751 CTGTAGTCCAAGAGAGTGGTTGG + Intronic
911514511 1:98850412-98850434 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
912139777 1:106709680-106709702 CTGTAGTCTGAGACTGTGTTTGG + Intergenic
912914948 1:113805333-113805355 CTGTATTCCCAGACCAAGGTGGG - Intronic
913301456 1:117374183-117374205 CTGTAGTCGGAGGCTGAGGTGGG + Intronic
914397852 1:147288066-147288088 CTGTAATCCCAGACTTTGGGAGG + Intronic
915423860 1:155807448-155807470 CTGTAATCCCAGACTTTGGGAGG + Intronic
915647153 1:157280948-157280970 CTGTAATCCCAGACTTTGGGAGG - Intergenic
916190858 1:162176751-162176773 CTGTAATCCCAGGCCAAGGTGGG - Intronic
917080549 1:171252833-171252855 CTGAAGCCCCAGACCGTGGTAGG - Intronic
917521559 1:175752121-175752143 CTGTAGTCCCAGCTACAGGTGGG + Intergenic
917967361 1:180187062-180187084 CTGCAGACCCACACTGAGGAGGG - Intronic
918199749 1:182255971-182255993 CTGTAATCCCACACTGTGGGAGG + Intergenic
918445929 1:184616919-184616941 CTGGAGTGCAAGGCTGAGGTGGG + Intronic
918856772 1:189765637-189765659 CTGTAGACCCAGGCTGAGACAGG - Intergenic
919890934 1:201973814-201973836 CTGTGGTGCCAGATTGAAGTTGG - Intergenic
919908492 1:202095017-202095039 CTGTAATCCCAGGCTGAGGTGGG + Intergenic
920867516 1:209765407-209765429 CTGTAATCCCAGACTTTGGGAGG + Intronic
921134795 1:212250382-212250404 CTGTGGTCCCAGTCTCAGTTGGG - Intergenic
921675545 1:217971915-217971937 CTGTGGTCCAAGAATGGGGTTGG + Intergenic
922139241 1:222865754-222865776 CAGTAGTACTAGACTGATGTTGG - Intergenic
922971520 1:229745277-229745299 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
923054427 1:230415161-230415183 CTGCAGTCTTAGACTGAGGTGGG + Intronic
924543789 1:245006421-245006443 CTGTAATCACAGGCTGAGGCAGG - Intronic
1063178817 10:3577726-3577748 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1063729430 10:8678789-8678811 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1063987266 10:11518224-11518246 CTGATTTCACAGACTGAGGTGGG + Intronic
1064100152 10:12456653-12456675 CTGTTGTCCCAGGTTGAGGCGGG + Intronic
1064538297 10:16380433-16380455 CTGTAGTTCTAGGCTGAGGAAGG - Intergenic
1065370581 10:24980975-24980997 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1065896140 10:30164639-30164661 CTGTAATCCCAGTCCGAGGCAGG - Intergenic
1066108683 10:32177741-32177763 CTGAAGTTACAAACTGAGGTTGG + Intergenic
1066112930 10:32213159-32213181 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1066144196 10:32539862-32539884 CTGTAGTCTGAGAGTGTGGTTGG + Intronic
1066277985 10:33887529-33887551 CTAGAGACCCAGACTGAGGTTGG - Intergenic
1066363815 10:34756708-34756730 CTGTAATCCCAGACTTAAGGAGG - Intronic
1067111327 10:43403138-43403160 CTGTAATCCCAGGCTGAGGCAGG - Intronic
1067277767 10:44850135-44850157 CTGCAGCCCCACACAGAGGTGGG + Intergenic
1067389738 10:45852166-45852188 CTGTAATCCCAGACTGTGGGAGG - Intronic
1067501727 10:46811672-46811694 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1067592852 10:47528333-47528355 CTGTAATCCCAGACTTTGGGAGG - Intronic
1067639968 10:48036438-48036460 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1067873526 10:49983890-49983912 CTGTAATCCCAGACTGTGGGAGG + Intronic
1068055509 10:52007919-52007941 CTGTAGCCCAAGACTGTGTTTGG - Intronic
1068252548 10:54462634-54462656 CTGTATTTCCAGACTGGGGAAGG - Intronic
1068957840 10:62836054-62836076 TTGTAGTCCCAGGCTGAGGCAGG + Intronic
1069442563 10:68442035-68442057 CTGTAGTCCCAGGATGAGGTGGG - Intronic
1069507225 10:69011503-69011525 CTGTACTCCAAGGATGAGGTGGG - Intronic
1069967765 10:72135608-72135630 CAGTAGTTACAGAGTGAGGTGGG + Intronic
1070136924 10:73702390-73702412 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1071697359 10:87890825-87890847 CTTTAGTCCCAGGCTGAGGTGGG - Intronic
1071848906 10:89548557-89548579 CTGTAATCCCAGACTTTGGGAGG + Intronic
1072509814 10:96109278-96109300 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1072696634 10:97608904-97608926 CTGCAGTCCCAGGCTGAGCTAGG + Intronic
1073075690 10:100824820-100824842 CTGTAGTCTGAGGCTGGGGTGGG + Intronic
1073355322 10:102849252-102849274 CTGCAATCCCAGGCAGAGGTGGG - Intergenic
1073448252 10:103593601-103593623 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1073480346 10:103782738-103782760 CTGTAATCCCAGACTTTGGGAGG + Intronic
1073503559 10:103964915-103964937 CTATAATCCCAGGCTGAGGTGGG - Intergenic
1074064786 10:110004409-110004431 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1075067517 10:119299319-119299341 CTGTAATTCCAGGCTGAGGCAGG + Intronic
1075894310 10:125981383-125981405 CTGTAGTCCCGGGCTGAGGTGGG + Intronic
1076039268 10:127229110-127229132 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1076374568 10:129974560-129974582 CTGAAGTCCCACAATGGGGTTGG - Intergenic
1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG + Intronic
1078059608 11:8034596-8034618 CAGTAATCCCAGCCTGAGCTGGG + Intronic
1078122760 11:8527081-8527103 CTGTAATCCCAGGCTGAGGCAGG - Intronic
1078129589 11:8602331-8602353 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
1078182773 11:9026678-9026700 CTGTAATCCCAGGCTGAGGGAGG - Intronic
1078638767 11:13076501-13076523 TTGTCCTCCAAGACTGAGGTTGG - Intergenic
1079120470 11:17680485-17680507 CTGAAGGCACAGACTGAGATTGG - Intergenic
1080256768 11:30298685-30298707 CTGTGGTCCCAGAGTGTGGTTGG - Intergenic
1080459866 11:32444953-32444975 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1081265500 11:41015876-41015898 CTATAGTCCCAGGCTGAGGCAGG + Intronic
1081523370 11:43904893-43904915 CTGTAGTAGCACACTGAGATAGG - Intronic
1082882788 11:58054674-58054696 CTGTGATCCCAGGCCGAGGTGGG + Intronic
1082883922 11:58064641-58064663 CTGCAGTCCCACAGTGATGTCGG + Intronic
1083097604 11:60267558-60267580 CAGTAGTCCCAGAGAGAGGATGG + Intergenic
1083144227 11:60746705-60746727 CTGTAGGCCCAGACTAAGCAAGG - Intergenic
1083276689 11:61600877-61600899 CTGAAGCCCCAGACTCAGGTTGG - Intergenic
1083470130 11:62878893-62878915 CTGTAGTCCCAGACTTGGAGGGG - Intronic
1083596773 11:63921316-63921338 ATTTGTTCCCAGACTGAGGTGGG - Intergenic
1083709191 11:64537575-64537597 CTGTAGTCCTAGCTTGAGGTGGG - Intergenic
1083818201 11:65149738-65149760 CTGTAGTCCCAGACTTTGGGAGG - Intergenic
1083877874 11:65533970-65533992 CTGTAATCCCAGACTTTGGGAGG + Intronic
1085538371 11:77241819-77241841 CTGTAGTCTCAGCCTGAGGCAGG + Intronic
1085592807 11:77779626-77779648 CTGTAATCCCAGGCTGAGGTGGG - Intronic
1085605881 11:77898071-77898093 CTGTAATCCCAGACTTTGGGAGG - Intronic
1085626615 11:78078845-78078867 CTGTGGTCCCAGGCTGAGGGAGG - Intronic
1086401944 11:86468085-86468107 CTGTGGTCAGAGACTGAGATGGG - Intronic
1087102617 11:94380187-94380209 CTGTCTTCCCAGACTGGAGTTGG + Exonic
1087903195 11:103665647-103665669 CTGTAGTCCAAGACCGTGGTTGG + Intergenic
1087907743 11:103718964-103718986 CTGTGGTCCAAGAATGTGGTTGG + Intergenic
1088064698 11:105702178-105702200 ATGTAATCCCAGGCTGAAGTGGG - Intronic
1088071870 11:105796972-105796994 CTGTAATCCCAGACTTTGGGTGG + Intronic
1088650329 11:111952435-111952457 CTGTAATCCCAGACTTTGGGAGG + Intronic
1088672670 11:112158243-112158265 CTGTAGTCCCAGCCTTTGGGAGG - Intronic
1089012529 11:115142702-115142724 CTGTAGTCCCAGCATGTGGGAGG - Intergenic
1089062336 11:115635613-115635635 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1089512171 11:119006490-119006512 CTGTAATCCCAGACTTTGGGAGG - Intronic
1090051126 11:123380832-123380854 CTCCAGTCCCAGAATGAGGAGGG - Intergenic
1090105362 11:123848934-123848956 CTGTGGTTCCAAAATGAGGTTGG + Intergenic
1090142480 11:124279157-124279179 CTGTAATCCCAGGCCAAGGTGGG - Intergenic
1090376938 11:126296772-126296794 CTGTAATCCCAGACTTAGGCAGG - Intronic
1090742344 11:129676172-129676194 CTGTGGTCCCAGAGTCTGGTTGG - Intergenic
1091246099 11:134096223-134096245 CTGTAATCCCAGGCCGAGGCAGG - Intronic
1092678924 12:10955224-10955246 CTGTGGTCCAAGAATGTGGTTGG - Intronic
1092898365 12:13035594-13035616 CTGTAGCCCCAGGCTGAGGCAGG - Intergenic
1093541813 12:20296587-20296609 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1094680553 12:32663391-32663413 CTGTAATCCCAGGCCGAGGTGGG - Intergenic
1095677685 12:44938466-44938488 ATGAATTCCCAGACTGATGTAGG - Intergenic
1096060697 12:48697078-48697100 CTGTAATCCCAGGCTGAGGCTGG - Intronic
1096125863 12:49119103-49119125 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1096251172 12:50033362-50033384 CTTGAGTCCCAGCCAGAGGTGGG - Intergenic
1097998997 12:65921369-65921391 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1098420233 12:70288391-70288413 CTGTAATCCCAGGCCGAGGTAGG - Intronic
1098453783 12:70649829-70649851 CTGTAGTCCCAGACTTTGGGAGG - Intronic
1099049875 12:77768755-77768777 CTGCAATCTCAGAATGAGGTAGG + Intergenic
1099750929 12:86771588-86771610 CTGTAATCCCAGACTTTGGGAGG + Intronic
1099767404 12:87005601-87005623 CTGTTGTCCAAGAGTGTGGTGGG + Intergenic
1100535843 12:95508036-95508058 CTGTAATCCCAGACTTTGGGAGG - Intronic
1100635190 12:96428665-96428687 CTGTAATCCCAGCCTGAGGCAGG + Intergenic
1101118469 12:101554689-101554711 CTGTAATCCCAGACTTTGGAAGG + Intergenic
1101810734 12:108105573-108105595 CTGTATTCCCAGAATGAAGCAGG - Intergenic
1102130652 12:110526091-110526113 CTGTAATCCCAGACTTTGGGAGG - Intronic
1102208842 12:111109571-111109593 CCTGAGTCCAAGACTGAGGTGGG - Intronic
1102542109 12:113628533-113628555 GAGTAGTCACAGAATGAGGTAGG + Intergenic
1102960256 12:117088130-117088152 CTGTATGCCCAAACTGAGGAGGG + Intronic
1103489246 12:121304145-121304167 CTGTAATCCTAGGCTGAGGCAGG + Intergenic
1103719427 12:122965529-122965551 CTCAAGTCCCAGAGTGAGGCTGG - Intronic
1103754464 12:123192831-123192853 CTGTAATCCCGCACTCAGGTGGG + Intronic
1103943204 12:124512031-124512053 CTGTAGTCCCACGCTGAGGCAGG - Intronic
1104511506 12:129383559-129383581 CTGTAATCCCAGGCTGAGTCAGG - Intronic
1104582393 12:130020616-130020638 CTGTAATCCCAGGCTGAGGCAGG - Intergenic
1104972364 12:132537725-132537747 CTGTTGCCCCACACTGTGGTTGG - Intronic
1105060721 12:133147897-133147919 CTGTAATCCCAGACTTTGGGAGG - Intronic
1105202470 13:18192000-18192022 CTGTAGTCCCACCCTGAAGTAGG + Intergenic
1106998401 13:35515294-35515316 CTGAAATTCCAGACTGAGGAGGG + Intronic
1107121834 13:36804558-36804580 CTGTAGTCCCAGGCTGAGGTGGG - Intergenic
1107934166 13:45330821-45330843 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1107970095 13:45633213-45633235 ATGAAGGCCCAGCCTGAGGTTGG - Intergenic
1108527776 13:51300408-51300430 CTGTAATCCCAGGCTGAGGCGGG + Intergenic
1108977887 13:56472221-56472243 CTGTAATCCCAGCATGAGGTGGG + Intergenic
1109317980 13:60774394-60774416 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1110475582 13:75909542-75909564 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1110708768 13:78626808-78626830 CTGTAATCCCAGACTTTGGGAGG + Intronic
1110742499 13:79014409-79014431 CTGTAGTCCAAGAATACGGTTGG + Intergenic
1110859009 13:80327428-80327450 CTGTAATCCCAGGGTGAGGCAGG - Intergenic
1110985759 13:81965844-81965866 CTGTAGTCCCAGACACAGGGAGG - Intergenic
1111795057 13:92908809-92908831 CTGTAGTCCGAAACTGGGGAGGG + Intergenic
1112011694 13:95298994-95299016 CTGTAATCCCAGACTTTGGGTGG + Intronic
1112543760 13:100343816-100343838 CTGTAGTCCCACACTTTGGGAGG + Intronic
1114283763 14:21220348-21220370 CTGTAGTACAAGGCTGAGGCAGG - Intronic
1114552748 14:23542978-23543000 CTGTAATCCCAGGCCAAGGTGGG - Intronic
1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG + Exonic
1115248552 14:31321268-31321290 CGGTAGTCTCAGGCTGAGGTGGG - Intronic
1115553600 14:34526475-34526497 CTGTAATCCCAGGCCAAGGTGGG + Intronic
1115868557 14:37775578-37775600 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1115890778 14:38025960-38025982 CTGTGGTCCGAGAGTGTGGTTGG - Intronic
1116360585 14:43991605-43991627 CTGTAGTCACAGAGTGTGGTAGG + Intergenic
1116522003 14:45860694-45860716 CTGTAGTCTGAGAGTGTGGTTGG + Intergenic
1116746054 14:48820626-48820648 CTGTAGTCTGAGAGTGTGGTTGG - Intergenic
1116941120 14:50791923-50791945 CTGTAGCCCCAGTCTGAGCTGGG + Intronic
1118068708 14:62221602-62221624 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1119160952 14:72452095-72452117 CTGTAGTCCCAAGCTGGGGGTGG - Intronic
1119279622 14:73394199-73394221 CTGTAATCCCAGCACGAGGTGGG - Intronic
1120497661 14:85256673-85256695 CTGTGGTCCCAGGCTGAGGCAGG - Intergenic
1121913562 14:97815275-97815297 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1122150899 14:99725669-99725691 CTTTAGAACCAGACTGAGCTGGG - Intronic
1122236220 14:100332061-100332083 CTGTAATCCCAGGCTGAGGCGGG - Intergenic
1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG + Intronic
1122334338 14:100959926-100959948 CTGTAATCCCAGGCTGAGGTGGG + Intergenic
1122428851 14:101627454-101627476 CTGTAGTCCCAGTGGGAGTTTGG - Intergenic
1122877727 14:104676656-104676678 CTGTAGCCCCAGCCTGGGGGAGG + Intergenic
1123455445 15:20418671-20418693 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
1123463542 15:20496025-20496047 CTGTAATCCCAGGCCGAGGCGGG - Intergenic
1123654520 15:22504400-22504422 CTGTAATCCCAGGCCGAGGCGGG + Intergenic
1123759399 15:23420954-23420976 CTGAGGTTCCAGACTGAGGCGGG + Intergenic
1124183261 15:27498611-27498633 CTGTAGTCCCAGCAGGAGGCTGG - Intronic
1124274386 15:28313423-28313445 CTGTAATCCCAGGCCGAGGCGGG - Intronic
1124308430 15:28599596-28599618 CTGTAATCCCAGGCCGAGGCGGG + Intergenic
1124336225 15:28859127-28859149 ATATAGCCCCAGGCTGAGGTGGG - Intergenic
1124580644 15:30951754-30951776 CTGTAATCCCAGACTTTGGGAGG - Intronic
1124627049 15:31313999-31314021 CTGTTGCCCCAGATTGGGGTTGG - Intergenic
1126759153 15:51953496-51953518 CTGTAGTCCCAGCCTTCGGGAGG + Intronic
1127845087 15:62863044-62863066 CTGTAGTCCGAGAGTGTGGTTGG - Intergenic
1128172308 15:65523771-65523793 CTGTAGTCCCAGCCTTTGGGAGG + Intergenic
1128277141 15:66363249-66363271 CTGTAATCCCAGACTTTGGGAGG + Intronic
1128325829 15:66723428-66723450 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1128348436 15:66871669-66871691 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1129987431 15:79930486-79930508 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1130329925 15:82914078-82914100 CTGTAATCCCAGACTTTGGGAGG + Intronic
1131022411 15:89110180-89110202 CTGTAATCCCAGGCTGAGGCAGG - Intronic
1131222355 15:90595447-90595469 CTATAGTCCCAGGCTGAGGCAGG + Intronic
1131237508 15:90709935-90709957 CTCTAGTCCAAGGCTGAGGTGGG - Intergenic
1131495781 15:92909620-92909642 CTGCAATCCCAGTCTCAGGTGGG + Intronic
1131880001 15:96852257-96852279 CTGTAGTCCCAGCCTTTGGGAGG - Intergenic
1132800873 16:1752363-1752385 CTGTCGTGCCAGCCTGAGCTCGG - Intronic
1133238690 16:4402365-4402387 CTGTGGTCCCAGGCTGAGGCAGG - Intronic
1133690726 16:8211900-8211922 CTGCAGTCCCAGGCCGAGGTTGG + Intergenic
1134047147 16:11109274-11109296 CTGTGGTCCCAGGCTGAGGTGGG - Intronic
1134236216 16:12468419-12468441 CTGTAATCCCAGGCTAAGGCAGG - Intronic
1134269657 16:12722611-12722633 CTGTAGTCCCAGCGTGAGGCAGG + Intronic
1134454097 16:14381352-14381374 GTGTTGTCCCAGACTGAGGGAGG + Intergenic
1134478378 16:14595919-14595941 CTGTAATCCCACACTTAGGGAGG - Intronic
1134810627 16:17163924-17163946 CTGTGATCCCAGGCTGAGGCAGG + Intronic
1135034447 16:19065201-19065223 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1135063622 16:19291097-19291119 CTGTAATCCCAGACTTTGGGAGG - Intronic
1135221712 16:20620466-20620488 CTGTAGTCCCAGGCTGAGGTGGG - Intronic
1135875760 16:26198596-26198618 CTGCATTCCCAGAATGAAGTCGG + Intergenic
1136135117 16:28251541-28251563 CTGTAGTCCCAGGCTGAGCCTGG + Intergenic
1136351906 16:29715866-29715888 CTGTAATCCCAGGCTGAGGCAGG - Intergenic
1136582491 16:31161547-31161569 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
1136642171 16:31576034-31576056 CTGTAGTCCCAGGCTGAGACAGG + Intergenic
1137638201 16:50005928-50005950 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1137756930 16:50909872-50909894 CTGTAATCCCAGCGTGAGGCAGG - Intergenic
1137969014 16:52965254-52965276 CTGTAATCCCAGGCTGATGTGGG - Intergenic
1138142436 16:54580454-54580476 CTTTAGACAAAGACTGAGGTGGG - Intergenic
1138341265 16:56290521-56290543 CTGGAGACCCAGAATGAGTTTGG + Intronic
1138436415 16:57003169-57003191 CTGTAATCCCAGGCTGAGGTGGG - Intronic
1138502451 16:57455954-57455976 CTGTGGTCCCAGGCTAAGATGGG + Intronic
1138776748 16:59732216-59732238 CTGTGGTCCAAGAGTGTGGTTGG - Intronic
1139746485 16:69078864-69078886 CTGTAATGCCAGGCTGAGATAGG - Intronic
1141422429 16:83925688-83925710 AGGGAGTCCCAGACTGAGGGAGG - Exonic
1141437250 16:84007224-84007246 CTGTAATCCCAGGCTGAGTCAGG + Intergenic
1141560383 16:84863843-84863865 CTGTAATCCCAGGCTGAGGTAGG + Intronic
1141683870 16:85559115-85559137 CTGTAATCCCAGCCCAAGGTGGG - Intergenic
1141902123 16:86997774-86997796 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1142136037 16:88452553-88452575 CTTCCGTCCCAGACTGCGGTGGG - Intergenic
1142420495 16:89966718-89966740 CTGTGGCCCCAGCCTGAGGAGGG + Exonic
1142553851 17:758671-758693 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1142574688 17:898737-898759 CTATAGTTCCAAGCTGAGGTGGG + Intronic
1142575823 17:906827-906849 CTGTAATCCCAGCCTGACTTTGG - Intronic
1142797321 17:2318574-2318596 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1143215054 17:5218594-5218616 CTGTAATCCCAGACTTTGGGAGG - Intronic
1143425021 17:6828892-6828914 CTGTAATCCCAGACTTTGGGAGG + Intronic
1143505352 17:7361592-7361614 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1144040793 17:11409457-11409479 CTGTAATCCCAGGCTGAGGCGGG + Intronic
1144113776 17:12065689-12065711 CTGTAATCCCAGACTGTGGGAGG - Intronic
1144334555 17:14257087-14257109 CGGTAATCCCAGGCTGAGGCAGG - Intergenic
1144438181 17:15259824-15259846 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1144684150 17:17215180-17215202 CTGTAGCTGCAGACCGAGGTGGG - Exonic
1144804823 17:17957842-17957864 CTGTAATCCCAGGCCGAGGTGGG + Intronic
1144858291 17:18283121-18283143 CTGTAATCCCAGGCCGAGGCGGG + Intronic
1145036441 17:19544065-19544087 CTGTAATCCCAGGCTGAGGCTGG - Intronic
1145743732 17:27297577-27297599 CTGTAGTACCAGGCTGAGGTGGG - Intronic
1146012137 17:29204661-29204683 CTGAGGTGGCAGACTGAGGTAGG - Intergenic
1146895232 17:36535767-36535789 CTGTAATGCCAGGCTGAGGCGGG - Intronic
1147011337 17:37451287-37451309 CTGTAATCCCAGACTTTGGGAGG - Intronic
1147185040 17:38708637-38708659 CTGTAATCCCAGACTTTGGGAGG + Intronic
1147219523 17:38920219-38920241 CTGTAGCCCCAGACAGAGATGGG - Exonic
1147410371 17:40246853-40246875 CTGTAATCCCAGACTTTGGGAGG + Intronic
1147997111 17:44366259-44366281 CTGTTGGCCCAGGGTGAGGTAGG + Intergenic
1148047753 17:44754248-44754270 CTGAAGTCCCAGTCTGATGAAGG + Intergenic
1148802686 17:50241550-50241572 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1148909338 17:50932390-50932412 CTGAAGCCCCAGCCTGGGGTCGG - Intergenic
1149965285 17:61156510-61156532 TTGTAGGTTCAGACTGAGGTTGG + Intronic
1150195479 17:63293849-63293871 CTGTAGTCCGAGCCTGAGGTGGG - Intronic
1150282550 17:63937852-63937874 CTGTAGTCCCAGGCTCAGGTGGG + Intergenic
1150481918 17:65517325-65517347 CTGTAACCCCAGCCTGAGGAAGG - Intergenic
1151824080 17:76513928-76513950 CTGTAATCCCAGACTTTGGGTGG - Intergenic
1151861089 17:76762542-76762564 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1151867497 17:76813900-76813922 CTGTAGCCACAGGCTGAGGTGGG - Intergenic
1152037797 17:77883933-77883955 CTGTAGTCCAAGAGAGAGGCAGG - Intergenic
1152173552 17:78770661-78770683 CTGTAATCCCAGGCCGAGGCAGG - Intronic
1152416451 17:80165736-80165758 CTGTAATCCCAGGCCAAGGTGGG + Intergenic
1153655029 18:7274618-7274640 CTGTAATCCCAGGCTGAGGCAGG - Intergenic
1154953057 18:21228615-21228637 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1155039084 18:22050000-22050022 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1155298071 18:24403469-24403491 CTGTAGTCTGAGACTGAGACCGG + Intergenic
1155323395 18:24642001-24642023 CTGTAATCCCATACTTAGGGAGG - Intergenic
1155463576 18:26111036-26111058 CTGTCGTCCAAGAGTGTGGTTGG + Intergenic
1155672695 18:28390814-28390836 CTGTGGTCCAAGAATGTGGTTGG - Intergenic
1155708803 18:28850029-28850051 CTGTGGTCCCAGAATGTGGTTGG - Intergenic
1155779605 18:29814222-29814244 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1156510055 18:37628704-37628726 GTGTACACCCAGACTGAGGGTGG + Intergenic
1157677704 18:49579385-49579407 CTGTAATCTCAGGCTGAGGCAGG - Intronic
1158255089 18:55537341-55537363 CTGTAATCCCAGACCAAGGTGGG + Intronic
1158337444 18:56428518-56428540 CTGTGGTCCAAGATTGTGGTTGG - Intergenic
1158452921 18:57582798-57582820 CTGTAGTTCCAGGCTGAGACAGG + Intronic
1158712013 18:59845996-59846018 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1159158816 18:64618227-64618249 CTGTAGTCTCATACAGAGGGAGG - Intergenic
1159527594 18:69612991-69613013 CTGTAGTCCCAGCTTCAGGTGGG - Intronic
1160790841 19:922944-922966 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1161092986 19:2372111-2372133 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1161373298 19:3925748-3925770 CTGTAATCCCAGACTTTGGGAGG + Exonic
1161946663 19:7441435-7441457 CTGTAATCCCAGACTTTGGGAGG - Intronic
1162069258 19:8143927-8143949 CTGTAGTCTCAGGCTGAAGTGGG - Intronic
1162083339 19:8233126-8233148 CTGTAATCCCAGGCTGAAGTTGG - Intronic
1162535262 19:11259837-11259859 CTGTAATCCCAGACTTTGGGAGG - Intronic
1162961871 19:14132872-14132894 CTGTAATCCCAGGCCGAGGCGGG + Intronic
1163224198 19:15944356-15944378 CTGTAATCCTAGGCTGAGGTGGG - Intergenic
1163250684 19:16124818-16124840 CTGTGGACCCAGGCTGAGGCGGG + Intronic
1163388114 19:17012593-17012615 CTGTAATCTGAGGCTGAGGTGGG - Intronic
1163448124 19:17359647-17359669 CTGTAATCCCAGGCCGAGGTGGG - Intronic
1163456138 19:17406682-17406704 CTGTGGTCCCAGGCTGAGGCTGG + Intronic
1163834425 19:19564507-19564529 CTGTAATCCCAGGCCGAGGCGGG - Intronic
1163865766 19:19772095-19772117 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1164147800 19:22523015-22523037 CTGTAATCCCAGACTTTGGGAGG + Intronic
1165003838 19:32788232-32788254 CTGTAATCCCAGACTGAGGCAGG - Intronic
1165458968 19:35933005-35933027 CTGTAATCCCAGGTTGAGGTGGG + Intergenic
1165524085 19:36338111-36338133 CTGTAGTCCCAGGCTGAGGTGGG - Exonic
1165649368 19:37472159-37472181 CTGTAATCCCAGCCTTTGGTAGG - Intronic
1165679406 19:37761094-37761116 CTGTAATCCCAGCCTGAGCCTGG + Intronic
1165693746 19:37884646-37884668 CTCTAGGCCCACACAGAGGTAGG - Intergenic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1165975888 19:39676373-39676395 CTGTAATCCCAGGCTGAGGCTGG + Intergenic
1166369199 19:42292030-42292052 CTGTGGCCCCAGACTGGGGCAGG - Intronic
1167011995 19:46814610-46814632 CTGTAATCCCAGACTTTGGGTGG - Intergenic
1167514770 19:49916807-49916829 CTGTGATCCCAGATAGAGGTGGG + Intronic
1168112876 19:54204259-54204281 CTTTAATCCCAGGCTGAGGCAGG + Intronic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
925295070 2:2770894-2770916 CTGTAGTCTCAGGCTGAGGCAGG - Intergenic
925993758 2:9275190-9275212 CTGTAATCCCAGGCTGAGGAGGG - Intronic
926480442 2:13386577-13386599 CTGTAATCTCAGGCTGAGGCAGG - Intergenic
926951924 2:18252450-18252472 CTCTAGTCCCTGACTGTGGCAGG - Intronic
927543524 2:23932846-23932868 CTGTAATCCCAGACTTGGGGAGG + Intronic
927548440 2:23975748-23975770 CTGTAATCCCAGGCTGAGGTAGG - Intronic
927781305 2:25941469-25941491 CTGTAATCCCAGGCTGAGGTGGG + Intronic
927891355 2:26751953-26751975 CTGTAGTCCCAGGCTGAGGTGGG - Intergenic
927903717 2:26842322-26842344 CTGTAATCCCAGGCTGATGCAGG + Intergenic
928848506 2:35710715-35710737 CTGTAATCCCAGGCTTAGGCAGG - Intergenic
928939406 2:36712579-36712601 CTGTAATCCCAGACTTTGGGAGG + Intronic
928939904 2:36717288-36717310 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
929161497 2:38836968-38836990 CTGTAGTCCCAGCAAGGGGTTGG - Intronic
929230565 2:39555846-39555868 TTGTAATCCCAGGCTGAGGCAGG - Intergenic
929912373 2:46101123-46101145 CTGTAATCCCAGACTTCGGGAGG - Intronic
931330904 2:61282235-61282257 CTGTAATCACAGGCCGAGGTGGG - Intronic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
931921434 2:67020616-67020638 CTGTGGTCCAAGAATGTGGTTGG - Intergenic
932040507 2:68294407-68294429 CTGTAATCCCAGGCTGAGGCAGG + Intronic
932235527 2:70118150-70118172 CTGTAATCCCAGACTTTGGGAGG + Intergenic
932853102 2:75206451-75206473 CTGTGGTCCAAGAATGTGGTTGG + Intergenic
933891443 2:86775083-86775105 CTATGGGGCCAGACTGAGGTTGG - Exonic
934218854 2:90062593-90062615 CTGTGGTCCAAGAGAGAGGTTGG + Intergenic
934669126 2:96197146-96197168 CTGTAATCCCAGACTTTGGGAGG + Intronic
934738239 2:96701054-96701076 CTGTAATCCCAGCCTGTGGGAGG + Intergenic
935143740 2:100379466-100379488 CTGTAGTCCCACACTTTGGGAGG + Intergenic
935419574 2:102853497-102853519 CTGTAATCCCACACTTTGGTAGG + Intergenic
935560780 2:104557489-104557511 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
937005227 2:118506009-118506031 CTGTAATCCCAGGCTGAGGGAGG - Intergenic
937116894 2:119413021-119413043 CTGTAGTCCCAGGCAGAGGCAGG - Intergenic
938790910 2:134674851-134674873 GGGTAGTGCCAGTCTGAGGTTGG - Intronic
939782162 2:146462675-146462697 CTGTGGTCCCAGAGTGTGGTTGG + Intergenic
940299927 2:152166078-152166100 CTGTAGTCCCAGATTGAACCTGG + Intronic
941936968 2:170989762-170989784 CTGTAGTCCCAGCTTGAGCCCGG + Intergenic
941948650 2:171129716-171129738 CTATAGTCCCAGGCTGAGGTGGG + Intronic
942230211 2:173853826-173853848 CTGTAATCCCAGGCTGAAGCAGG + Intergenic
943274829 2:185853211-185853233 CTGTAATCCCAGGCCGAGGCAGG + Intergenic
944641581 2:201731902-201731924 CTTTTGTCCCAGAATGAGGATGG + Intronic
945238847 2:207658395-207658417 CTGTAATCCCAGACTTTGGGAGG + Intergenic
945528790 2:210924462-210924484 CTGTAATCCCAGGCAGAGGCAGG - Intergenic
945656895 2:212634962-212634984 TTGTAGTCCCAGGCTGAGGTTGG + Intergenic
947424219 2:229968588-229968610 CTGTAGTCCCAGCTTGTAGTGGG - Intronic
948141410 2:235674931-235674953 CTGTAATCCCAGACCGAGGGGGG - Intronic
948227964 2:236327365-236327387 GTGTAGTCCCGGGCTGAGGCAGG - Intronic
948773569 2:240267261-240267283 CTGTGGTCCAAGAATGTGGTTGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169484069 20:6011840-6011862 CTGTAATCCCAGGCCGAGGGAGG - Intronic
1169633992 20:7666714-7666736 CTGTAGTCCCAGTCTTAGTCAGG - Intergenic
1171977118 20:31602426-31602448 CTGTAATCCCAGCCTGAGGCAGG + Intergenic
1172238371 20:33394272-33394294 CTGTAATCCCAGGCTGAGGCAGG - Intronic
1172408822 20:34707882-34707904 CTGTAATCCCAGGCTGAGGCAGG - Intronic
1172577814 20:36022740-36022762 CTGTAGTCCCAGGCTGAGGTGGG - Intronic
1172688038 20:36772135-36772157 CTGTAATCCCAGACTTTGGGAGG - Intronic
1173519633 20:43689617-43689639 CTGTTCTCCCAGACTGTGGTTGG + Intronic
1173545972 20:43898237-43898259 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
1173648056 20:44645999-44646021 CTGTGGGCGCAGAGTGAGGTTGG - Intronic
1173712033 20:45166776-45166798 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1174171172 20:48619071-48619093 CTGTGGTCCCAGGCTGAGGTGGG - Intergenic
1174327605 20:49791687-49791709 CTGTAGTCCCAGGCTGAGGAGGG + Intergenic
1174637439 20:52013805-52013827 CTATAGTCCCAGGCTGAGGCAGG + Intergenic
1174642006 20:52052740-52052762 CTGTAATCCCAGACTTTGGGAGG - Intronic
1174993145 20:55535463-55535485 CTGTAGTCCCATACTTTGGGAGG - Intergenic
1175022728 20:55868112-55868134 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1176259740 20:64173296-64173318 CAGCAGTCACAGACAGAGGTGGG + Intronic
1176715480 21:10346008-10346030 CTGTAGTCCCACCCTGAAGTAGG - Intergenic
1178352716 21:31884333-31884355 CTGTAATCCCAGACTTTGGGAGG + Intronic
1178416267 21:32407710-32407732 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1178505778 21:33161848-33161870 CTGTAATCCCAGGCTGATGAGGG - Intergenic
1178574804 21:33776436-33776458 CTGTAGTACCTGCCTGAGGCAGG + Intronic
1178611471 21:34085723-34085745 CTGTAGTCCCAGTCCCAGCTGGG - Intronic
1180602868 22:17033945-17033967 CTGTAGTCCCACCCTGAAGTAGG + Intergenic
1180657232 22:17432837-17432859 CTGTAATCACAGGGTGAGGTGGG - Intronic
1180687053 22:17677473-17677495 CTGTAATCCCAGCGTGAGGGAGG + Intronic
1180829206 22:18890479-18890501 GTGTAGTCCCAGTGTGAGTTGGG - Intergenic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1180919484 22:19513548-19513570 CTGTAGGTCCAGGCTGTGGTGGG - Intronic
1181015707 22:20067305-20067327 CTGTAGTGCGAGGCTGAGGTGGG + Intergenic
1181611448 22:24015697-24015719 CTGTAATCCCAGACTTTGGGAGG + Intronic
1182290499 22:29274792-29274814 TTGTATTCCGATACTGAGGTTGG + Intronic
1183529126 22:38343125-38343147 CTGTAATCCCAGGCTGAAGCGGG + Intronic
1183612836 22:38922180-38922202 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1184065629 22:42118350-42118372 CTGAACTCCCAGACTTAGCTGGG + Intergenic
1184341417 22:43888062-43888084 TTCCAGTACCAGACTGAGGTGGG + Intronic
1203279298 22_KI270734v1_random:116517-116539 GTGTAGTCCCAGTGTGAGTTGGG - Intergenic
949474639 3:4431731-4431753 CTGAAGTCACAGACCAAGGTGGG + Intronic
949535179 3:4989707-4989729 CTTTGGTCCCAGCCTGAGGCTGG - Intergenic
950093429 3:10313588-10313610 CTGTTGTCCCAGCCAGAGGGAGG - Intronic
950383978 3:12641897-12641919 CTGTAATCCCAGCCTGAGGCAGG + Intronic
950453179 3:13077147-13077169 CTATAGTCCCAGGCTAAGGCAGG - Intergenic
950989613 3:17418901-17418923 CTGTAGTCTCAGTCCGTGGTTGG - Intronic
951011056 3:17680341-17680363 CTGTGGTCCCATGCTGAGGAGGG - Intronic
951059035 3:18183117-18183139 TTGGAGTCCCAGATTGAGGGTGG - Intronic
951167248 3:19497589-19497611 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
951538153 3:23758250-23758272 CTGTAATCCCAGACTTTGGGAGG - Intergenic
952801296 3:37294641-37294663 CTGTAATCCCACACTGTGGGAGG - Intronic
953166530 3:40469841-40469863 CTGTAATCCCAGACTTTGGGAGG - Intergenic
953200294 3:40772267-40772289 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
953716902 3:45323396-45323418 CTAAAGTCCCAGGCTGAGGTGGG + Intergenic
953983849 3:47426691-47426713 CTGTAATCCCAGACTTTGGGAGG - Intronic
954338736 3:49936658-49936680 CTGTAATCCCAGACTTTGGGAGG - Intergenic
955046700 3:55367815-55367837 CTGTAGCCCCAGACTCGGGTAGG - Intergenic
957138507 3:76321258-76321280 CTGTAATCCCAGACTTTGGGAGG + Intronic
957572786 3:81969799-81969821 CTGTAATCCCAGACTTTGGGAGG - Intergenic
957737181 3:84217070-84217092 CTGTATTCCAAGACTGTGGTTGG - Intergenic
957915209 3:86680009-86680031 CTGTAGTCCAAGAGTGTGCTTGG + Intergenic
958124408 3:89336936-89336958 CTGTTGACCCAGGCTGAGGTGGG + Intronic
958252738 3:91289279-91289301 CTGTAATCCCAGACTTTGGGAGG - Intergenic
958460481 3:94388254-94388276 CTGTAGTCCAAGAGTGTGGTTGG - Intergenic
958792156 3:98664281-98664303 CTGTAATCCCAGGCTGAGACAGG - Intergenic
960115565 3:113888942-113888964 CTGTAATCCCAGACTTTGGGAGG + Intronic
961004255 3:123394016-123394038 CTGTAATCCCAAGCTGAGGCAGG + Intronic
961846841 3:129772233-129772255 CTGTGGTCCCAGGCTGAGGTGGG + Intronic
961865949 3:129953655-129953677 CTGTAATCCCAGCCTGAGATAGG - Intergenic
962216694 3:133528731-133528753 CTGTAATCCCAGACTTTGGGAGG + Intergenic
962226558 3:133615861-133615883 CTGTAATCCCAGACTTTGGGGGG - Intronic
964069210 3:152611510-152611532 CTGTAGTCCCAGCTACAGGTGGG - Intergenic
965825976 3:172730167-172730189 CTGTAATCCCAGACTTTGGGAGG + Intergenic
965863049 3:173170208-173170230 CTGTGGTCCCAGACAAAGGTGGG + Intergenic
966189847 3:177262251-177262273 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
966405026 3:179587744-179587766 CTGGAGTCCCAGGCTGAGGTGGG + Intronic
967024363 3:185550926-185550948 CTGTAATCCCAGACTTTGGAAGG + Intronic
967418337 3:189244305-189244327 CTGTAATCCCAGGCTGAGACAGG + Intronic
967726907 3:192870597-192870619 CTGTAATCCCAGGCTGAGGCAGG + Intronic
967823845 3:193862952-193862974 TTGGAGTCCCAGACTGAGGCAGG - Intergenic
968112714 3:196062283-196062305 CTGTAATCCCAGGCCGAGGCAGG + Intronic
968142215 3:196267456-196267478 CTGTAATCCCACACTGTGGCAGG + Intronic
968147525 3:196312001-196312023 CTGTAATCCCAGGCTGAGACAGG - Intronic
969632767 4:8347942-8347964 CTGTAGCCCCTGAGTGAGGGAGG - Intergenic
971398288 4:26250936-26250958 ATATAGTCCCAGACTCAGGAAGG - Intronic
971573525 4:28245192-28245214 CTGTAATCCCAGACTTTGGGAGG + Intergenic
972545901 4:40080457-40080479 CTGTAGTCCCAGACAGAGGCAGG - Intronic
972774839 4:42231113-42231135 CTATAATCCCAGGCTGAGGCGGG - Intergenic
972827955 4:42783428-42783450 CTGTAGTCCAAGAGTACGGTTGG + Intergenic
973319392 4:48794733-48794755 CTGTAATCCCAGCGTGAGGGAGG - Intergenic
973685089 4:53361641-53361663 CTGTAATTCCAGGCTGAGGCTGG - Intronic
974270674 4:59647183-59647205 CTGTAGCCTCAGGGTGAGGTGGG + Intergenic
974920571 4:68234047-68234069 TTGTAGTCCCAGGCTGAGGCAGG + Intronic
975109603 4:70608833-70608855 CTGTAGTCCCATACTTTGGGAGG + Intergenic
976310034 4:83602208-83602230 CTGTAGTCTCAGACACAGGAAGG + Intronic
977035695 4:91950206-91950228 CTGTAGCCCCAGCACGAGGTAGG + Intergenic
978043280 4:104095440-104095462 CTGTAGTCCAAGAGTGTGTTTGG - Intergenic
978080063 4:104581264-104581286 CTGTAATCCCAGACTTTGGGAGG + Intergenic
979175934 4:117664055-117664077 CTGTAGTCCCAGAATGGAGTGGG + Intergenic
979472309 4:121113859-121113881 CTGAAATCGTAGACTGAGGTTGG + Intergenic
979657491 4:123212639-123212661 TTGTAGTCCCAAACTAAAGTAGG + Intronic
979699191 4:123648567-123648589 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
980115586 4:128676028-128676050 CTGTAGTCCTAGGCTGAGGCAGG - Intergenic
980131881 4:128824306-128824328 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
980704838 4:136479683-136479705 CTATAGTCCCAGGCTGGGGTGGG - Intergenic
981267681 4:142806021-142806043 CTGTAATCCCAGACTTTGGGAGG + Intronic
981757182 4:148153432-148153454 CTGTAATCCCAGACTTTGGGAGG - Intronic
981786663 4:148487185-148487207 CTGTAATCCCATAATGAGGCAGG - Intergenic
983733744 4:171031253-171031275 CTGAAGGTCCATACTGAGGTAGG - Intergenic
983799913 4:171914540-171914562 CTATAATCCCAGGCTGAGGCAGG - Intronic
984490912 4:180433354-180433376 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
984960544 4:185093404-185093426 CTGTAATCCCAGACTTTGGGAGG - Intergenic
985124239 4:186675643-186675665 CTGTAGCTCCAGGCTGAGGTGGG + Intronic
986169082 5:5301324-5301346 CTGTAATTCCAGGCTGAGGCAGG - Intronic
986877757 5:12132086-12132108 CTGCAGTTCTAGACTGAGGCAGG + Intergenic
986909494 5:12536428-12536450 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
987210134 5:15673067-15673089 CTGTAATCCCAGGCCGAGGAAGG + Intronic
987660923 5:20874691-20874713 CTGTAGTCCAAGATTGTGGCTGG + Intergenic
987695488 5:21324370-21324392 AGGTAGTTCCAGACTGAAGTAGG + Intergenic
987822598 5:22984888-22984910 CTGTATTCCCAGACTTTGGGAGG + Intergenic
987851312 5:23358977-23358999 CTGTAATCCCAGACTTTGGGAGG + Intergenic
988013903 5:25528553-25528575 CTGTAATCCCAGACTTTGGGAGG - Intergenic
988762717 5:34330994-34331016 CTGTAGTCCAAGATTGTGGCTGG - Intergenic
989626945 5:43438653-43438675 CTGTAATCCAAGGCTGAGGCAGG + Intergenic
989716111 5:44465653-44465675 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
990167877 5:53015444-53015466 CTGTGGTCCAAGACTGTGGTTGG + Intronic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
991060904 5:62374681-62374703 CTGTAATCCGAGGCCGAGGTGGG + Intronic
991374891 5:65956486-65956508 CTGCAGTCCCAGGCTGAGGTGGG - Intronic
991504587 5:67310954-67310976 CTGTAGTCTGAGAATGTGGTTGG - Intergenic
991659816 5:68939147-68939169 CTGTAGTCAGAGCCTGAGTTGGG - Intergenic
992399339 5:76397392-76397414 CTGTAATCCCAGACTTTGGGAGG - Intergenic
992751328 5:79865479-79865501 CTGTAGTCCCAGGTTGAGGTGGG - Intergenic
992965845 5:81999181-81999203 CTGTAGTCTAAGAGTGTGGTTGG - Intronic
993401325 5:87456159-87456181 CGGTATTCCCAGGCTGAGATGGG - Intergenic
996069473 5:119118485-119118507 CTGTAATCCCAGGATGAGGCGGG + Intronic
996709308 5:126528325-126528347 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
997210787 5:132075502-132075524 CTTAAGTGCCAGCCTGAGGTTGG - Intronic
997989182 5:138529863-138529885 CTGTAGTCCCAGGCTAGGGTGGG - Intronic
998398480 5:141835045-141835067 CTGTGGTCTCAGGCTCAGGTGGG - Intergenic
999162219 5:149511204-149511226 CTGTAGTCCCAGCTACAGGTAGG + Intronic
999186803 5:149716923-149716945 CTGGCCTCACAGACTGAGGTGGG + Intergenic
999665298 5:153906441-153906463 CAGTAGGCCCAGGCAGAGGTGGG - Intergenic
1000555254 5:162718033-162718055 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1000569867 5:162898501-162898523 CTGTGGTCCCAGAGTGTGGTTGG - Intergenic
1001057421 5:168461204-168461226 CTGTAGTCCCAGGCTGTACTTGG + Intronic
1001825089 5:174737975-174737997 TTCTAGTCCCAGACTTAGATAGG - Intergenic
1001880556 5:175240482-175240504 CTGGTGTCGCAGACTGAGGAGGG - Intergenic
1001961475 5:175882577-175882599 CTGTATTCCCAGAGTGGGATCGG + Exonic
1002033090 5:176445396-176445418 CTGTAGTCCCAGGCCGAGGCAGG - Intergenic
1002177881 5:177412214-177412236 CAGGAGTTCCAGACTGATGTAGG + Intronic
1002472025 5:179440997-179441019 CTGTAACCCCAGGTTGAGGTGGG + Intergenic
1002520484 5:179790576-179790598 CTGTACTCCCAGCACGAGGTGGG - Intronic
1002893570 6:1359880-1359902 CTGTAATCCAAGGCTGAGGCGGG + Intergenic
1003749235 6:9038363-9038385 CTGTAATCCCAGTACGAGGTGGG + Intergenic
1003864567 6:10351271-10351293 CTGTAATCCCAGGCCGAGGCGGG + Intergenic
1004226208 6:13786295-13786317 CTTGGGTCCCAGGCTGAGGTGGG + Intergenic
1004399815 6:15278108-15278130 CTGTAATCCCAGGCTGAAGCAGG + Intronic
1004599612 6:17135350-17135372 CTGTAGTCCAAGAGTATGGTTGG - Intergenic
1004941522 6:20562490-20562512 CTGTAATCCCAGGCTGAGGTGGG + Intronic
1005596366 6:27382073-27382095 CTGTAATCCCAGACTTTGGGAGG + Intronic
1005909983 6:30300920-30300942 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1006354487 6:33546676-33546698 CTGTAGTCCCAGATACAGGCAGG - Intergenic
1006507107 6:34496370-34496392 CTGCAGGCCCAGGCTGAGGGGGG + Intronic
1007354182 6:41299029-41299051 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1007383848 6:41507452-41507474 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1007502568 6:42309896-42309918 TTGTAGTCCCAGGTTGAGGCGGG - Intronic
1007620446 6:43210231-43210253 CTGTAGTCCCAGACTTTGGCAGG - Intronic
1007641186 6:43341077-43341099 CTGTAGTTCAAGCCTTAGGTTGG - Intronic
1007655464 6:43448806-43448828 CTGTAGTCAGAAACTGAGCTGGG + Intronic
1009191741 6:60637639-60637661 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1009438129 6:63641747-63641769 CTGTAATCCGAGGCTGAGGTGGG - Intronic
1009805252 6:68594266-68594288 CTGTGGTCCAAGACTGTAGTTGG + Intergenic
1009979406 6:70709447-70709469 CTGCAGTCGCAGGCTCAGGTGGG - Intronic
1010178137 6:73053529-73053551 CTGTAGTCTGAGAGTGTGGTTGG - Intronic
1010466143 6:76168434-76168456 CTGTGGTCCAAGAGTGTGGTCGG - Intergenic
1010568273 6:77445161-77445183 CTGTGGTCACACACTGTGGTAGG + Intergenic
1011273064 6:85599694-85599716 CTGTGGTCCCAGGCTGAGGTGGG + Intronic
1011458260 6:87575923-87575945 CTGTAATCCCAGGCTGAAGCAGG - Intronic
1011584280 6:88907989-88908011 CTGTAATCCCAGACTTGGGGAGG - Intronic
1011643365 6:89434568-89434590 TGGTGGTCCCAGGCTGAGGTGGG - Intronic
1012061720 6:94493331-94493353 CTGTAATCTCAGGCTGAGGGAGG - Intergenic
1012462617 6:99480550-99480572 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1012545863 6:100418908-100418930 CTGTAATCCCAGACTTTGGGAGG + Intronic
1012586611 6:100931007-100931029 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1012834168 6:104243988-104244010 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1013525869 6:110973262-110973284 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1014850490 6:126334762-126334784 CTATGGTGCCAGTCTGAGGTTGG - Intergenic
1015016793 6:128423571-128423593 CTGTAGTCCCACACTTTGGGAGG + Intronic
1015468306 6:133573519-133573541 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1016013069 6:139158557-139158579 CTGTAGTCCCATGCTGAGGTGGG + Intronic
1016409829 6:143771347-143771369 CTGTAGTCCCAGCTTGAGCCTGG - Intronic
1016898195 6:149074621-149074643 CTATAATCCGAGGCTGAGGTGGG + Exonic
1017491932 6:154952610-154952632 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1017917720 6:158845421-158845443 CTGTAGTCCCAGACTATGGGAGG - Intergenic
1018496812 6:164356221-164356243 CTGTAGTCCAAGAGTGTGGTTGG + Intergenic
1018754929 6:166840713-166840735 CTGTAATCCCAGGCTTAGGCGGG + Intronic
1018988890 6:168658531-168658553 CTGTAGCACCAGGCTGAGGAGGG - Intronic
1019573859 7:1726744-1726766 CCGTCGTCCCAGCCTCAGGTGGG + Intronic
1020128882 7:5548629-5548651 CTGTAATCCCAGACTTTGGGAGG - Intronic
1020226734 7:6286172-6286194 CTGTAATCCCAGGCTGAGGCAGG - Intergenic
1020425971 7:8066731-8066753 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1020450570 7:8316347-8316369 ATGCAGTCCCAGACTGCAGTGGG - Intergenic
1021824484 7:24534963-24534985 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1022398094 7:30008851-30008873 CTGTAGCCCCAGGCTGAGGCAGG + Intergenic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1023363548 7:39440299-39440321 CTGGAGTACCAGAATGAGATAGG - Intronic
1023497403 7:40813058-40813080 CTGTAGTCCCAGAGTGTGGTTGG + Intronic
1026141201 7:67708389-67708411 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1026194975 7:68164842-68164864 CTGTAATCCCACACTTAGGGAGG - Intergenic
1026315499 7:69224009-69224031 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1027241900 7:76336041-76336063 CTGTAGTTCCAGGTTGAGGCAGG - Intronic
1028024431 7:85820078-85820100 CTGTAGTCCCATTCTGAGGCAGG + Intergenic
1028353711 7:89881217-89881239 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1028641757 7:93050152-93050174 CTGTAGTCCCAGTCCCAGCTAGG + Intergenic
1028673843 7:93435559-93435581 CTGTAATCCCAGGCCGAGGCGGG + Intronic
1028872555 7:95785163-95785185 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1029250248 7:99231193-99231215 CTGTAATCCCAGGCCGAGGCGGG - Intergenic
1029271216 7:99377887-99377909 CTGTAATCCCAGACTTTGGGAGG - Intronic
1029272400 7:99385075-99385097 CTGTAGTCCCAGCCTGAGGCAGG - Intronic
1029747384 7:102523937-102523959 CTGAACACCCAGACTGAAGTAGG + Intergenic
1029765337 7:102623027-102623049 CTGAACACCCAGACTGAAGTAGG + Intronic
1029862319 7:103586105-103586127 CTGTAATCCCAGACTTTGGGAGG + Intronic
1030027100 7:105334910-105334932 CTGTAATCCCAGACTTTGGGAGG + Intronic
1030219826 7:107086581-107086603 CTGTAGTCCCAGCTTGTGGGAGG - Intronic
1030531692 7:110718758-110718780 GTGTGGTTCCAAACTGAGGTGGG + Intronic
1030533207 7:110735751-110735773 CTGTAGTCCCAGCTTGAGCCTGG + Intronic
1030835661 7:114281356-114281378 CTGTAATCCCAGACTTTGGGAGG - Intronic
1030924686 7:115437550-115437572 CTGTAGTCCCAGCCTGAGGCAGG - Intergenic
1031476394 7:122227829-122227851 CTGTAGTCCCATATTTAGGAGGG - Intergenic
1032058946 7:128707576-128707598 CTGTGTTCCCAGGCTGAGGTGGG - Intergenic
1032141955 7:129339785-129339807 CTGTAGTCCCACACTTTGGGAGG - Intronic
1032412921 7:131712329-131712351 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1032744631 7:134773394-134773416 CTGTAGTCCCAGCCCTAGGGAGG - Intronic
1032965825 7:137096040-137096062 CTATAGTCCTAGAGTGTGGTTGG - Intergenic
1033589276 7:142796783-142796805 CTGCTGTCCCAGACTCAGCTCGG - Intergenic
1034069901 7:148174424-148174446 CTGAAGCACCAGCCTGAGGTGGG - Intronic
1034161351 7:148996194-148996216 CTGTAATCCCAGAGTTTGGTTGG - Intergenic
1034628332 7:152511452-152511474 CTGTAATGCCAGGCTGAGGCAGG - Intergenic
1034680950 7:152926754-152926776 CTGTAATCCCAGGCTGAGGGAGG + Intergenic
1035998769 8:4578423-4578445 ATGTAGTCCCTTGCTGAGGTGGG - Intronic
1036493161 8:9246394-9246416 CTGTAATCCCAGGCCAAGGTGGG - Intergenic
1037790056 8:21930963-21930985 CTGTAGTCCCAGCCTCACTTGGG - Intronic
1038543832 8:28410966-28410988 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1038859647 8:31373480-31373502 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1039477501 8:37847784-37847806 CTGTAATCCCAGACTTTGGGAGG - Intronic
1039625572 8:39048165-39048187 CTGTAATCCCAGACCAAGGCGGG - Intronic
1039731405 8:40282605-40282627 CTGTAATCCCAGACTTTGGGAGG + Intergenic
1040433119 8:47363450-47363472 CTGTAATCTCAGGCTGAGGTGGG - Intronic
1040838237 8:51754967-51754989 CTGTAATCCCAGTCTCAGGCAGG - Intronic
1041442092 8:57908073-57908095 CTGTAATCCCAGGCCGAGGCGGG - Intergenic
1042262303 8:66871786-66871808 CTATAGTCCCAGGCTGAGAAGGG + Intronic
1042764531 8:72306422-72306444 CTGTAGTCTGAGAATGTGGTTGG + Intergenic
1042839278 8:73107613-73107635 CTGTAGTCCCAGCCCTGGGTGGG - Intronic
1043458624 8:80437334-80437356 CTGTAATCCCAGCCCAAGGTGGG - Intergenic
1043785379 8:84391765-84391787 CTGAAGTCTCAGAATGAGCTAGG - Intronic
1044006244 8:86940421-86940443 CTGTAATCCCAGGCCGAGGGAGG - Intronic
1044771126 8:95635379-95635401 CTGTGGTCTGAGACTGTGGTTGG - Intergenic
1045366507 8:101481309-101481331 CTGTAGTCCCAGGCAAAGGTGGG - Intergenic
1045472639 8:102526045-102526067 CTGTAGTCCCAGGCTGCAGCAGG - Intergenic
1045651427 8:104345044-104345066 CTATAATCCCACACTGAGGTGGG - Intronic
1045676320 8:104612058-104612080 CTGTGGTCCAAGAGTGTGGTTGG + Intronic
1046288306 8:112125240-112125262 GTGTGGTCCCAGACTCAGATAGG - Intergenic
1046411417 8:113848045-113848067 CTGTAGTCCAAGAGTGTGTTTGG - Intergenic
1047273949 8:123390773-123390795 CTGTAATCCCAGACTTTGGGAGG + Intronic
1047478610 8:125259145-125259167 CTGTAATCCCAGCATGAAGTGGG - Intronic
1049115456 8:140682661-140682683 CTGTGGTCCTAGAGTGTGGTTGG - Intronic
1050565050 9:6873241-6873263 CTGTAATCCCAGGCCGAGGCGGG - Intronic
1050677280 9:8070841-8070863 CTGTAGTCCAAGAGTGTGCTTGG + Intergenic
1050878511 9:10671668-10671690 CTGTAGTCCAAGAGTATGGTCGG + Intergenic
1051541161 9:18219613-18219635 CTGTAATCCCAGGCCAAGGTGGG - Intergenic
1052296935 9:26907281-26907303 CTGTAATCCCAGGCTGAGGCGGG + Intronic
1052985011 9:34480522-34480544 CTGTAATCCCAGGCTGAGGTGGG - Intronic
1053018092 9:34675531-34675553 CTGCAGTCCCAGAGTGTGGGTGG + Intergenic
1053233729 9:36433979-36434001 CTGTAATTCCAGACTTAGGGAGG + Intronic
1053392185 9:37743940-37743962 CTGTAATCCCAGGCCTAGGTAGG + Intronic
1053548427 9:39048590-39048612 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1053812549 9:41868654-41868676 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1054618046 9:67318785-67318807 CTGTGGTCCAAGAGTGTGGTTGG + Intergenic
1055444481 9:76369044-76369066 CTGTAATCCCAGGCCGAGGCAGG - Intergenic
1055739940 9:79376910-79376932 CTGTGGTCCCAGGCTGAGGCAGG + Intergenic
1056162336 9:83909351-83909373 CTGTAATCCCAGACTTTGGGAGG + Intronic
1056358007 9:85822159-85822181 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1057362129 9:94382947-94382969 CTGTAATCCCAGACTTTGGGAGG - Intronic
1057661216 9:97005151-97005173 CTGTAATCCCAGACTTTGGGAGG + Intronic
1057831233 9:98408897-98408919 CTGTAATCGCAGGCTGAGGCAGG - Intronic
1057882910 9:98807082-98807104 CTGTAATCCCAGGCCGAGATAGG - Intergenic
1058858309 9:109088571-109088593 CTGTAATCCCAGGCCGAGGCGGG + Intronic
1058865345 9:109156791-109156813 CTGTAGTCCCGGGGTGAGGTAGG - Intronic
1058965909 9:110038216-110038238 CTGTCATCCAAGGCTGAGGTGGG + Intronic
1060140645 9:121206859-121206881 CTGTGGTCCCAGGCTGAGGTGGG - Intronic
1060591263 9:124818494-124818516 TTGTAGTTGCAGACTGGGGTGGG - Intergenic
1060648270 9:125301324-125301346 CTGTAATCCCAGACTTTGGGAGG - Intronic
1060693053 9:125681880-125681902 CTGCAGTCCCAGGCTGGGGTGGG - Intronic
1060693526 9:125686198-125686220 CTGTACTCCCAGGCTGAGGCGGG + Intronic
1060694827 9:125699742-125699764 CTGTAGTTCCAGGCTGAGGTAGG - Intronic
1060793090 9:126498665-126498687 CTGAGGTCCCAGAGTGAGCTGGG - Intronic
1061082680 9:128381571-128381593 CTGTAATCCCAGGTTGAGGCAGG + Intronic
1061355021 9:130098137-130098159 CTGTAATCCCACACTTAGGGAGG - Intronic
1185516052 X:699887-699909 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1186467183 X:9792830-9792852 CTGTAACGCCAGGCTGAGGTGGG - Intronic
1187239674 X:17501239-17501261 CTGTGGGCCCAGGCTGAGATGGG + Intronic
1187888726 X:23913634-23913656 CTGTAATCCCAGCGTGAGCTGGG + Intronic
1188342476 X:29021099-29021121 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1188496234 X:30785854-30785876 CTGTAGTCCCACACTTTGGGAGG - Intergenic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189808913 X:44762940-44762962 CTGTAGTCCCAGGCTGAGGGAGG + Intergenic
1189873283 X:45406488-45406510 CTGTGGTCCTAGGGTGAGGTTGG - Intergenic
1190101288 X:47524468-47524490 CTGCAGTCCCAGACTAAGGAAGG + Intergenic
1190974056 X:55382214-55382236 CTGTAGTCAAAGAGTGTGGTTGG - Intergenic
1191061984 X:56308118-56308140 CTGTGGTCCAAGAATGTGGTCGG + Intergenic
1192177084 X:68892921-68892943 AAGCAGTCCCAGACTGAGCTGGG - Intergenic
1192778095 X:74266010-74266032 CTGTAGTCCCAGGCTGACGTAGG - Intergenic
1193068299 X:77280620-77280642 CTGTAGTCCAAGATTGTGTTTGG - Intergenic
1193084764 X:77439093-77439115 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1193877343 X:86876951-86876973 CTGTAGTCCAAGAGTGTGGTTGG + Intergenic
1194019671 X:88671189-88671211 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1194082286 X:89483658-89483680 CTGTGGTCCAAGAATGTGGTTGG - Intergenic
1194373707 X:93107189-93107211 CTGTAGTCCAAGAGTGTGGCTGG + Intergenic
1194848042 X:98836536-98836558 CTGTGGTCCAAGAATGTGGTTGG + Intergenic
1195034519 X:100960233-100960255 CTGTAATCCCAGGCTGAGGTGGG + Intergenic
1195097008 X:101512257-101512279 CTGTAATCTCAGGCTGAGGCAGG + Intronic
1195855626 X:109329354-109329376 CTGTGGTCCAAGACAGTGGTTGG + Intergenic
1195924237 X:110009735-110009757 CTGTAATCCCAGACTTTGGGAGG + Intronic
1196475077 X:116074346-116074368 CTGTGGTCCAAGAGTGTGGTTGG - Intergenic
1196551125 X:117026861-117026883 CTGTAGCACCAGAGTGTGGTTGG + Intergenic
1197406715 X:126062773-126062795 CTGTGGTCTGAGACAGAGGTTGG - Intergenic
1198102562 X:133434809-133434831 CTGTAGCCTGAGACTGAGGCAGG - Intergenic
1198180118 X:134199262-134199284 CTGTAGTCCCAGATGGTGGCGGG - Intergenic
1199216783 X:145268395-145268417 CTGTAGTCTGAGAGTGTGGTTGG - Intergenic
1199494873 X:148441733-148441755 CTGTAGTCTCAGTCTGATGAAGG + Intergenic
1200414076 Y:2889993-2890015 CTGTAATCCCAGACTTCGGGAGG + Intronic
1200434954 Y:3139849-3139871 CTGTGGTCCAAGAATGTGGTTGG - Intergenic
1200579737 Y:4935774-4935796 CTGTAATCCAAGAGTGTGGTTGG + Intergenic
1200681736 Y:6221223-6221245 CTGTAGTCCAAGAGTGTGGCTGG + Intergenic
1200794521 Y:7328615-7328637 CTGTAATCCCAGGCCGAGGAGGG - Intergenic
1201259357 Y:12143200-12143222 CTGTAATCCCAGACTTTGGGAGG - Intergenic
1201354245 Y:13081471-13081493 CTGTAATCCCAGGCTGAGGCAGG - Intergenic