ID: 1077101896

View in Genome Browser
Species Human (GRCh38)
Location 11:826121-826143
Sequence GACAGGACCTTGAGACCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077101896_1077101908 28 Left 1077101896 11:826121-826143 CCCCTTGGTCTCAAGGTCCTGTC No data
Right 1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
1077101896_1077101905 9 Left 1077101896 11:826121-826143 CCCCTTGGTCTCAAGGTCCTGTC No data
Right 1077101905 11:826153-826175 CAGCCTTTTGTGGTTCAGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1077101896_1077101907 20 Left 1077101896 11:826121-826143 CCCCTTGGTCTCAAGGTCCTGTC No data
Right 1077101907 11:826164-826186 GGTTCAGCTGGGTCGCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077101896_1077101904 8 Left 1077101896 11:826121-826143 CCCCTTGGTCTCAAGGTCCTGTC No data
Right 1077101904 11:826152-826174 CCAGCCTTTTGTGGTTCAGCTGG 0: 1
1: 0
2: 2
3: 12
4: 119
1077101896_1077101901 -1 Left 1077101896 11:826121-826143 CCCCTTGGTCTCAAGGTCCTGTC No data
Right 1077101901 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 1
2: 56
3: 780
4: 5720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077101896 Original CRISPR GACAGGACCTTGAGACCAAG GGG (reversed) Intergenic
No off target data available for this crispr