ID: 1077101901

View in Genome Browser
Species Human (GRCh38)
Location 11:826143-826165
Sequence CCTATAAGCCCAGCCTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6558
Summary {0: 1, 1: 1, 2: 56, 3: 780, 4: 5720}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077101893_1077101901 4 Left 1077101893 11:826116-826138 CCACCCCCCTTGGTCTCAAGGTC No data
Right 1077101901 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 1
2: 56
3: 780
4: 5720
1077101894_1077101901 1 Left 1077101894 11:826119-826141 CCCCCCTTGGTCTCAAGGTCCTG No data
Right 1077101901 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 1
2: 56
3: 780
4: 5720
1077101888_1077101901 26 Left 1077101888 11:826094-826116 CCTGATGTGCCTGTGCCAGAGGC No data
Right 1077101901 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 1
2: 56
3: 780
4: 5720
1077101891_1077101901 11 Left 1077101891 11:826109-826131 CCAGAGGCCACCCCCCTTGGTCT No data
Right 1077101901 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 1
2: 56
3: 780
4: 5720
1077101889_1077101901 17 Left 1077101889 11:826103-826125 CCTGTGCCAGAGGCCACCCCCCT No data
Right 1077101901 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 1
2: 56
3: 780
4: 5720
1077101896_1077101901 -1 Left 1077101896 11:826121-826143 CCCCTTGGTCTCAAGGTCCTGTC No data
Right 1077101901 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 1
2: 56
3: 780
4: 5720
1077101886_1077101901 27 Left 1077101886 11:826093-826115 CCCTGATGTGCCTGTGCCAGAGG No data
Right 1077101901 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 1
2: 56
3: 780
4: 5720
1077101895_1077101901 0 Left 1077101895 11:826120-826142 CCCCCTTGGTCTCAAGGTCCTGT No data
Right 1077101901 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 1
2: 56
3: 780
4: 5720
1077101898_1077101901 -3 Left 1077101898 11:826123-826145 CCTTGGTCTCAAGGTCCTGTCCT No data
Right 1077101901 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 1
2: 56
3: 780
4: 5720
1077101897_1077101901 -2 Left 1077101897 11:826122-826144 CCCTTGGTCTCAAGGTCCTGTCC No data
Right 1077101901 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 1
2: 56
3: 780
4: 5720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077101901 Original CRISPR CCTATAAGCCCAGCCTTTTG TGG Intronic
Too many off-targets to display for this crispr