ID: 1077101905

View in Genome Browser
Species Human (GRCh38)
Location 11:826153-826175
Sequence CAGCCTTTTGTGGTTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 139}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077101893_1077101905 14 Left 1077101893 11:826116-826138 CCACCCCCCTTGGTCTCAAGGTC No data
Right 1077101905 11:826153-826175 CAGCCTTTTGTGGTTCAGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1077101898_1077101905 7 Left 1077101898 11:826123-826145 CCTTGGTCTCAAGGTCCTGTCCT No data
Right 1077101905 11:826153-826175 CAGCCTTTTGTGGTTCAGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1077101899_1077101905 -8 Left 1077101899 11:826138-826160 CCTGTCCTATAAGCCCAGCCTTT 0: 1
1: 0
2: 0
3: 17
4: 264
Right 1077101905 11:826153-826175 CAGCCTTTTGTGGTTCAGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1077101896_1077101905 9 Left 1077101896 11:826121-826143 CCCCTTGGTCTCAAGGTCCTGTC No data
Right 1077101905 11:826153-826175 CAGCCTTTTGTGGTTCAGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1077101889_1077101905 27 Left 1077101889 11:826103-826125 CCTGTGCCAGAGGCCACCCCCCT No data
Right 1077101905 11:826153-826175 CAGCCTTTTGTGGTTCAGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1077101897_1077101905 8 Left 1077101897 11:826122-826144 CCCTTGGTCTCAAGGTCCTGTCC No data
Right 1077101905 11:826153-826175 CAGCCTTTTGTGGTTCAGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1077101894_1077101905 11 Left 1077101894 11:826119-826141 CCCCCCTTGGTCTCAAGGTCCTG No data
Right 1077101905 11:826153-826175 CAGCCTTTTGTGGTTCAGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1077101895_1077101905 10 Left 1077101895 11:826120-826142 CCCCCTTGGTCTCAAGGTCCTGT No data
Right 1077101905 11:826153-826175 CAGCCTTTTGTGGTTCAGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 139
1077101891_1077101905 21 Left 1077101891 11:826109-826131 CCAGAGGCCACCCCCCTTGGTCT No data
Right 1077101905 11:826153-826175 CAGCCTTTTGTGGTTCAGCTGGG 0: 1
1: 0
2: 1
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077101905 Original CRISPR CAGCCTTTTGTGGTTCAGCT GGG Intronic
902774827 1:18667928-18667950 CATCCTTTGATGGCTCAGCTGGG - Intronic
903910256 1:26719280-26719302 CAGATTTTTCTGGTTCACCTGGG - Intronic
906933247 1:50189677-50189699 CAGGCTTTTGTGGGCCAGCCTGG - Intronic
908110347 1:60890814-60890836 CAAACTTTTGTGCTGCAGCTGGG - Intronic
912323714 1:108738446-108738468 CAGCCTTTTAGGGGACAGCTTGG + Intronic
913463335 1:119113190-119113212 CAGCCTTTTCTGCTTTAGGTAGG - Intronic
914829772 1:151162205-151162227 CAGCCCTTTGTACTTTAGCTTGG - Intronic
918268319 1:182869317-182869339 CAGTCTTATCTGGTTCAGCCCGG + Intronic
920436944 1:205953230-205953252 CAGCCTAGTGTGGTTCACCTTGG - Intergenic
920928337 1:210363825-210363847 CAGCCTTTTGTGGGCTGGCTTGG + Intronic
921276800 1:213528715-213528737 CTGACTTCTGTGGTTCATCTAGG + Intergenic
922477413 1:225916197-225916219 CAGTCTTTTGTTGTTCAGACAGG + Intronic
923670593 1:236037328-236037350 CAGCCTTCTGTGGCCCTGCTGGG + Intronic
1065445016 10:25789157-25789179 CAGACTTTGGGGGTGCAGCTGGG + Intergenic
1068894469 10:62184453-62184475 CTGCCTTTTGTGATTCTGATTGG - Intronic
1073174086 10:101540623-101540645 CAGACTTTTTTGGTTGAACTTGG - Intronic
1073848856 10:107591249-107591271 AAGCCTTTTGTGGGTGGGCTAGG - Intergenic
1076710164 10:132328896-132328918 CAGCCTTTTGGGGTCATGCTTGG - Intronic
1077101905 11:826153-826175 CAGCCTTTTGTGGTTCAGCTGGG + Intronic
1077204267 11:1334592-1334614 CAGTCATTTGTGCATCAGCTTGG + Intergenic
1079022570 11:16921948-16921970 CAGCCTTCTCTGGTCCAGCCAGG - Intronic
1079352238 11:19701404-19701426 CAGCCCTTTGTGGTACCCCTTGG + Intronic
1081670337 11:44938917-44938939 CAGCCTTCTCTGGCTCTGCTGGG - Intronic
1083144991 11:60751430-60751452 CAGCCCCATGTGGTTCAGCTGGG - Intergenic
1084755550 11:71236273-71236295 CAGCATTTTGTGGTTCAACCAGG - Intronic
1085065489 11:73491771-73491793 CAAGCTTATGTGGTTCAGTTTGG - Intronic
1085638149 11:78173931-78173953 GAGCCTCTTGAGGTTCTGCTTGG + Exonic
1086769381 11:90743142-90743164 CAGAGTTTTGTGGTCCAGATGGG - Intergenic
1090406793 11:126480834-126480856 CTGCCTTTTGTGGTTTTGCCCGG + Intronic
1092333267 12:7605184-7605206 CAGCCTTTTCTGTACCAGCTGGG - Intergenic
1094153055 12:27307491-27307513 AAGCTTTTAGTGGTTCAGTTTGG - Intronic
1094581050 12:31734309-31734331 CAGCCTGTTGTGATCCAGCCAGG + Intergenic
1096536788 12:52279972-52279994 CACCCTTTTCTGTTTCTGCTCGG - Intronic
1100050857 12:90446588-90446610 CAGGCTTTTGTGGGTCAAATTGG + Intergenic
1101595206 12:106158597-106158619 CAGTCTTCTGTGGCTCTGCTGGG + Intergenic
1101843360 12:108343003-108343025 CTTCCTTTTGAGGTCCAGCTCGG + Intergenic
1107254428 13:38406716-38406738 CAGTACTTTGTGGTTCACCTAGG + Intergenic
1112037337 13:95508809-95508831 CAGCTCTTTGTGCTTCAGCCTGG - Intronic
1112596893 13:100815737-100815759 CAGCCTTTTCTAGTTCAGAGAGG - Intergenic
1116986866 14:51229689-51229711 AAGCCTTTTGTATATCAGCTTGG - Intergenic
1121633832 14:95440191-95440213 CAGCCTCTTGTGGTGCTACTTGG - Intronic
1123947120 15:25244216-25244238 CAGCCTTCCGAGTTTCAGCTGGG - Intergenic
1124434089 15:29633526-29633548 CCTCCTTTCCTGGTTCAGCTGGG - Intergenic
1128472539 15:67967589-67967611 CTGCCTTTTATGGCTGAGCTTGG + Intergenic
1129099664 15:73248433-73248455 CAGTGTTAAGTGGTTCAGCTTGG - Intronic
1130066297 15:80607818-80607840 CAGGCTTTTCTGGGTCAGCGTGG - Intergenic
1133433862 16:5762458-5762480 CAACCTTTTGTGGGGCAGTTTGG + Intergenic
1134531562 16:14988369-14988391 CTTCCTCTTCTGGTTCAGCTTGG - Intronic
1134741105 16:16546854-16546876 TTGCCTTTTGTGTTTCAGTTTGG + Intergenic
1134926393 16:18165274-18165296 TTGCCTTTTGTGTTTCAGTTTGG - Intergenic
1135948134 16:26883891-26883913 CACCTTTGTGTGCTTCAGCTTGG - Intergenic
1137682225 16:50358950-50358972 CAGCCTTGTGTTGTACAGATGGG - Intronic
1138051102 16:53779421-53779443 GATCCCTTTGTGTTTCAGCTTGG + Intronic
1138482731 16:57314571-57314593 CAGCTTTTTGTGATTCATCTGGG - Intergenic
1141239313 16:82250349-82250371 CAGCCCTTTGTCTTTCAGATGGG + Intergenic
1142698363 17:1645617-1645639 CTGCCCTTTGGGGTCCAGCTCGG + Exonic
1144029357 17:11305694-11305716 CAGACTGTTGTGGTCCAGCTTGG - Intronic
1146377477 17:32304271-32304293 TGGCCTTTTGTGATTTAGCTGGG + Intronic
1148678506 17:49459149-49459171 CAGTCTTCTCTGGCTCAGCTGGG + Intronic
1151941794 17:77297119-77297141 CGGCCTTCTGTGGTACATCTTGG - Intronic
1156505500 18:37588094-37588116 CAGCCTTTTGTTCTACAGCTGGG - Intergenic
1157743933 18:50118210-50118232 CAGCCTTTTGTTGCTGAGCCAGG - Intronic
1160685593 19:435074-435096 CTGCCTTTTGTGCTACAGCTCGG - Intronic
1161118608 19:2512930-2512952 CAGCCTCCTGTGGTTGGGCTGGG - Exonic
1161482293 19:4517145-4517167 CAGCCTCCTGTGGCTCAGCTTGG - Intronic
1165570728 19:36772728-36772750 CAGCATTCTCTGGTTCCGCTCGG + Exonic
1167255002 19:48422048-48422070 CAGCCCTGGGTGGGTCAGCTTGG + Intronic
1167782274 19:51606660-51606682 CATCATTTTGGGGTACAGCTTGG - Intergenic
1167857071 19:52250804-52250826 CACACTTTTGTGCTTCAGCCTGG - Intergenic
927475173 2:23409067-23409089 GAGCCTGTTGTTGTTGAGCTTGG + Intronic
928314280 2:30233666-30233688 CAGCCATTGGTGGGCCAGCTTGG + Intronic
929543247 2:42838452-42838474 AAGCCTTTTGCCTTTCAGCTGGG + Intergenic
930772077 2:55138899-55138921 CATCCTTTTGTTGACCAGCTTGG - Intergenic
931350963 2:61488662-61488684 CACCCCTTTGTAATTCAGCTTGG - Exonic
933461064 2:82586399-82586421 CAGATTTTTTTGGTTCATCTGGG + Intergenic
943271040 2:185804918-185804940 CATCTTTTTGTACTTCAGCTTGG - Exonic
943760375 2:191601377-191601399 CTTCCTTGTGTGGGTCAGCTGGG - Intergenic
944895030 2:204155489-204155511 CACCATTCTGTGGTTCTGCTGGG + Intergenic
948251645 2:236534775-236534797 CAGCCTCTTGGGATGCAGCTGGG + Intergenic
948338093 2:237226969-237226991 CAGCCTTTCATGGTTCTGCAAGG - Intergenic
1169010532 20:2246356-2246378 CAGCCTGCTGTGGGTCAACTTGG - Intergenic
1170246331 20:14225866-14225888 CAGCCTTTTGTGGGTGGGCCTGG - Intronic
1170684804 20:18559535-18559557 CAGCCTTTGCTGGTTCAGGTGGG + Intronic
1172221872 20:33279804-33279826 GAGGCTTCTGTGGATCAGCTTGG + Intronic
1172297689 20:33824998-33825020 TACCCTTTTGTTGTTCTGCTGGG + Intronic
1175797048 20:61778284-61778306 GAGCGCTTTGAGGTTCAGCTGGG + Intronic
1178835508 21:36094185-36094207 CAGTCTTTTGTGGTTCTGACCGG + Intergenic
1181909208 22:26224899-26224921 CAGCCATCTGCAGTTCAGCTGGG + Intronic
1183962907 22:41423128-41423150 AAGGTTTTTGTGGTTTAGCTGGG + Intergenic
1184192128 22:42901879-42901901 CTTCCTTCCGTGGTTCAGCTCGG + Intronic
1184477838 22:44730950-44730972 CAGCTGTTTGGGGCTCAGCTGGG + Intronic
950619345 3:14191152-14191174 CAGCTTTTTGAGGTGCTGCTGGG + Intronic
951439128 3:22702546-22702568 CAGCCATTTTTGGACCAGCTTGG - Intergenic
955530107 3:59864136-59864158 ATGCCTTTTGTGGGTTAGCTAGG - Intronic
956001164 3:64731396-64731418 CAGCCTTGTGTGATACAGTTTGG - Intergenic
956208074 3:66774529-66774551 CAGAGTTGTGTGGTTCAGATTGG + Intergenic
959672315 3:108992874-108992896 CAGCCTTTATTGGGTGAGCTAGG - Intronic
962036982 3:131662473-131662495 CACCCTTATGTAGTTCAGCACGG - Intronic
966892230 3:184415901-184415923 CTGCCTTTTCTGCTCCAGCTAGG + Intronic
967829264 3:193904826-193904848 ATGCCTTTTGTGGGTCAACTGGG - Intergenic
971617702 4:28813484-28813506 CAGCCCTTTCTGCTGCAGCTGGG + Intergenic
975634684 4:76435875-76435897 CAGCATCTTGGAGTTCAGCTTGG + Exonic
981289831 4:143061600-143061622 CAGCCTTTTGAAGTCCAGATTGG + Intergenic
988089281 5:26514857-26514879 CAGCATTTTATAGATCAGCTTGG - Intergenic
994534905 5:101017721-101017743 CAGCCTTTAGTGGTAGAGCCTGG - Intergenic
996058744 5:119009482-119009504 CACCCTTTTGTGTTTCAGAAAGG - Intergenic
996608066 5:125346981-125347003 CAGCCTCTTGTCCATCAGCTTGG - Intergenic
1002423666 5:179163657-179163679 CTGGCTTCTGTGGTTCAGCCTGG + Intronic
1002530053 5:179838951-179838973 CAGCCTTTTGTTTTTGAGATGGG - Intronic
1004043858 6:12008853-12008875 CAGACTTTTGTGTTGCAGTTCGG + Intronic
1005397126 6:25394543-25394565 CAGCTCTTTGTGATTCAGGTTGG + Intronic
1006391214 6:33759953-33759975 CATCCTTTGGTGCTTCAGCAGGG - Intergenic
1012053953 6:94381281-94381303 CAGACTTTTGTGGTTTAGGGTGG - Intergenic
1012617076 6:101290525-101290547 CAGGCATGGGTGGTTCAGCTCGG - Intergenic
1014532853 6:122579765-122579787 CAACCTCTTCAGGTTCAGCTTGG + Intronic
1016035538 6:139379120-139379142 CATACTTGTGTGGTGCAGCTAGG + Intergenic
1018834644 6:167473779-167473801 CAGCTATTTTTGGTTCTGCTAGG + Intergenic
1019159998 6:170063276-170063298 CAGACTTTGGGGGATCAGCTTGG - Intergenic
1020096964 7:5374679-5374701 CTGCCTTTTGGGGTTCTGCGTGG - Intronic
1022896669 7:34756926-34756948 CAGCCTTTTGTGGTTATTGTAGG - Intronic
1025765979 7:64450611-64450633 CAGCCTTTTTAGTTTCAGCGTGG + Intergenic
1029179396 7:98689047-98689069 GAGCCCTCTGTGTTTCAGCTGGG - Intergenic
1031120543 7:117716654-117716676 CTGCCTTTTTTTGTTCAACTGGG - Intronic
1033471951 7:141658381-141658403 AACCCTTTTGTGATTCAGGTAGG - Exonic
1036145259 8:6249136-6249158 CAGCTTTTTCTGGCTAAGCTTGG + Intergenic
1036929687 8:12943052-12943074 CAGCCTTTTGAAATGCAGCTTGG + Intergenic
1040809513 8:51436050-51436072 CAGTCATCTGTAGTTCAGCTAGG - Intronic
1042513874 8:69639693-69639715 GAGCTTTTTGTGGTGCCGCTGGG + Intronic
1045103062 8:98864848-98864870 CAGCTTTTTGTGGTCCATATTGG + Intronic
1048709383 8:137191232-137191254 CAGCATTTTGTTGTTCAGTAAGG + Intergenic
1049681682 8:143921517-143921539 CAGCAGCTTGTGGTGCAGCTCGG + Exonic
1050716853 9:8538756-8538778 CAGCCTCTCTTGGTTCAGCTAGG - Intronic
1050821620 9:9886702-9886724 ATGACTTTTGTGGTTCAGTTAGG + Intronic
1053277798 9:36796511-36796533 AAGCTCTTTGTGATTCAGCTTGG - Intergenic
1059585243 9:115598952-115598974 CATCCTTCTGGGGTCCAGCTGGG - Intergenic
1203341470 Un_KI270420v1:1233-1255 CTTCCTTTCGTAGTTCAGCTGGG - Intergenic
1186311109 X:8320103-8320125 CAGCATTTTGAGGTTCTGATTGG - Intergenic
1186928619 X:14362255-14362277 CATGATTGTGTGGTTCAGCTTGG + Intergenic
1187022518 X:15399033-15399055 CAGCCTTCTGTGGTGCACTTTGG - Intronic
1187151264 X:16683876-16683898 CAGACTTTTGTGGGTCAGCTGGG - Intronic
1189544546 X:42028017-42028039 CAGCCTTTTTTGGTAAAACTTGG + Intergenic
1190797922 X:53761118-53761140 CAGCCCTTTATGGTTCCCCTCGG + Intergenic
1190917237 X:54820092-54820114 CAGCCCTTTATGGTTCCCCTCGG - Intergenic
1190931049 X:54950041-54950063 CAGCCCTTTATGGTTCCCCTCGG - Intronic
1191998656 X:67124374-67124396 GAGCCTTTTGAGGTCCAGCCTGG + Intergenic
1193278677 X:79622818-79622840 TTGCATTTGGTGGTTCAGCTTGG + Intergenic
1196458561 X:115906844-115906866 AAGCCTCTTGAGTTTCAGCTTGG + Intergenic
1198326978 X:135583809-135583831 CAGCTTCTTGTAGTTCATCTTGG + Intergenic
1200959352 Y:8982825-8982847 CAAACTTTTGTGGTTCAGAGAGG + Intergenic
1201864327 Y:18633156-18633178 CTGCCCTTGGTGGATCAGCTGGG - Intergenic
1201868995 Y:18687222-18687244 CTGCCCTTGGTGGATCAGCTGGG + Intergenic