ID: 1077101907

View in Genome Browser
Species Human (GRCh38)
Location 11:826164-826186
Sequence GGTTCAGCTGGGTCGCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077101900_1077101907 -2 Left 1077101900 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 0
2: 6
3: 185
4: 4443
Right 1077101907 11:826164-826186 GGTTCAGCTGGGTCGCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077101899_1077101907 3 Left 1077101899 11:826138-826160 CCTGTCCTATAAGCCCAGCCTTT 0: 1
1: 0
2: 0
3: 17
4: 264
Right 1077101907 11:826164-826186 GGTTCAGCTGGGTCGCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077101898_1077101907 18 Left 1077101898 11:826123-826145 CCTTGGTCTCAAGGTCCTGTCCT No data
Right 1077101907 11:826164-826186 GGTTCAGCTGGGTCGCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077101893_1077101907 25 Left 1077101893 11:826116-826138 CCACCCCCCTTGGTCTCAAGGTC No data
Right 1077101907 11:826164-826186 GGTTCAGCTGGGTCGCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077101896_1077101907 20 Left 1077101896 11:826121-826143 CCCCTTGGTCTCAAGGTCCTGTC No data
Right 1077101907 11:826164-826186 GGTTCAGCTGGGTCGCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077101895_1077101907 21 Left 1077101895 11:826120-826142 CCCCCTTGGTCTCAAGGTCCTGT No data
Right 1077101907 11:826164-826186 GGTTCAGCTGGGTCGCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077101894_1077101907 22 Left 1077101894 11:826119-826141 CCCCCCTTGGTCTCAAGGTCCTG No data
Right 1077101907 11:826164-826186 GGTTCAGCTGGGTCGCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077101902_1077101907 -10 Left 1077101902 11:826151-826173 CCCAGCCTTTTGTGGTTCAGCTG 0: 1
1: 0
2: 2
3: 16
4: 225
Right 1077101907 11:826164-826186 GGTTCAGCTGGGTCGCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 51
1077101897_1077101907 19 Left 1077101897 11:826122-826144 CCCTTGGTCTCAAGGTCCTGTCC No data
Right 1077101907 11:826164-826186 GGTTCAGCTGGGTCGCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077101907 Original CRISPR GGTTCAGCTGGGTCGCACGC TGG Intronic
900014157 1:137341-137363 GGAGGAGCTGGGCCGCACGCGGG + Intergenic
900044020 1:492543-492565 GGAGGAGCTGGGCCGCACGCGGG + Intergenic
900065430 1:727449-727471 GGAGGAGCTGGGCCGCACGCGGG + Intergenic
907286595 1:53384379-53384401 GGTTCAGCTGGGAACCATGCTGG + Intergenic
914943637 1:152044713-152044735 GCTTCAGGTGGGTGGCACTCAGG - Intronic
922734433 1:227971741-227971763 GGAGGAGCTGGGCCGCACGCGGG - Intergenic
922734489 1:227971946-227971968 GGAGGAGCAGGGTCGCACGCGGG + Intergenic
922734770 1:227973077-227973099 GGAGGAGCAGGGTCGCACGCGGG + Intergenic
924343442 1:243054759-243054781 GGAGGAGCAGGGTCGCACGCGGG - Intergenic
924343484 1:243054916-243054938 GGAGGAGCTGGGCCGCACGCGGG + Intergenic
1064140456 10:12785731-12785753 GGTTCGGCTGGTTCTCAGGCAGG + Intronic
1065879554 10:30027161-30027183 GGTTCAGCTGGATAGGACGCGGG + Exonic
1066629676 10:37446806-37446828 TCTTCAGCTGGGTCCCACCCAGG - Intergenic
1072271437 10:93780906-93780928 GGTCCAGCTGGTTCCCACTCTGG + Intronic
1076970357 11:129018-129040 GGAGGAGCTGGGCCGCACGCGGG + Intergenic
1077101907 11:826164-826186 GGTTCAGCTGGGTCGCACGCTGG + Intronic
1090617685 11:128530669-128530691 GGTGCAGCTGGGTGGGAAGCTGG + Intronic
1098070911 12:66673766-66673788 GCTGCAGCTGGGTCCCAGGCAGG - Intronic
1107014176 13:35695533-35695555 GGCTCAGCTGGGTTCCAGGCGGG + Intergenic
1126392795 15:48177912-48177934 GGTGCAGCTGGGCCGCTCCCAGG - Intronic
1128912980 15:71533131-71533153 GGTTGAGCTGGGTTGCCCGTGGG + Intronic
1133053380 16:3131833-3131855 GGTCCAGCTGGGTATCACACTGG - Intronic
1139419978 16:66844277-66844299 GGTTCAACTGGCTCGCCGGCGGG + Intronic
1141475529 16:84270621-84270643 GGCTCAGCTGGGTCGTCTGCTGG + Intergenic
1141805446 16:86338565-86338587 TGTTCAGGTGGGTGGCACCCAGG - Intergenic
1142457192 17:63382-63404 GGAGGAGCTGGGCCGCACGCGGG + Intergenic
1145935237 17:28711325-28711347 GGCCCTGCTGGGTCGCCCGCGGG - Intronic
1152495856 17:80670933-80670955 GGTGGAGCTGGGTTGCACACTGG + Intronic
1160647551 19:200487-200509 GGAGGAGCTGGGCCGCACGCGGG + Intergenic
1161097768 19:2403119-2403141 GGTTCACCTTGGTCACACACTGG - Exonic
1163430148 19:17262599-17262621 GGATGAGCTGGTCCGCACGCAGG - Exonic
1168145033 19:54415849-54415871 GGTTCTCCTGGGACGCGCGCTGG + Intronic
925397187 2:3543293-3543315 TCTTCAGCTGGGTAGCACTCAGG - Intronic
925649552 2:6074596-6074618 GGTTTAGCTGTGTCTCTCGCTGG + Intergenic
934710002 2:96508517-96508539 GGTCCCGCTGGGCCGCACGCTGG - Intergenic
937990145 2:127657605-127657627 GGTGCAGATGGGGCACACGCGGG + Intronic
1176200081 20:63856105-63856127 GGTCCACCTGGGACGCAGGCTGG + Intergenic
1183524105 22:38313793-38313815 GGGTCAGCTGGGTCACCAGCTGG - Intronic
978154553 4:105474093-105474115 GGCTCGGCCGGGCCGCACGCCGG + Intergenic
988133250 5:27134781-27134803 GGTACAGCTGGGTCTCATGAAGG - Intergenic
1002729823 5:181326386-181326408 GGAGGAGCTGGGCCGCACGCGGG - Intergenic
1009320762 6:62285985-62286007 GGTTCCGCTCGCTCGGACGCAGG + Exonic
1019212438 6:170417445-170417467 CGTGCAGCTGGGTGGCACGTCGG - Intergenic
1025052917 7:55743889-55743911 GGAGGAGCTGGGCCGCACGCGGG + Intergenic
1025289321 7:57700029-57700051 GGTCCAGCTGTGTCTCAAGCAGG + Intergenic
1032051595 7:128653708-128653730 GGAGGAGCAGGGTCGCACGCGGG + Intergenic
1037947440 8:22998338-22998360 GGTTCAGGTGGGTGGCAGGCTGG + Intronic
1039916246 8:41862423-41862445 GGTCCACCTGGGGCGCAGGCTGG - Intronic
1043081818 8:75775529-75775551 GGTTCAGCTGGGTGACTGGCTGG - Intergenic
1049311040 8:141933999-141934021 GGGGCAGCTGAGTCGCACACGGG + Intergenic
1057885741 9:98828223-98828245 GGGGCAGCTGGGTCACACCCAGG - Intronic
1059437532 9:114285615-114285637 GGGTCGGCTGGGCAGCACGCCGG - Intronic
1061041370 9:128142690-128142712 GGCTCAGCTGTGTCCCAGGCAGG - Intergenic
1062288893 9:135785861-135785883 GGTCCAGATGGGTCCCAGGCCGG + Intronic
1062754235 9:138278898-138278920 GGAGGAGCTGGGCCGCACGCGGG - Intergenic