ID: 1077101908

View in Genome Browser
Species Human (GRCh38)
Location 11:826172-826194
Sequence TGGGTCGCACGCTGGATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 156}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077101899_1077101908 11 Left 1077101899 11:826138-826160 CCTGTCCTATAAGCCCAGCCTTT 0: 1
1: 0
2: 0
3: 17
4: 264
Right 1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
1077101897_1077101908 27 Left 1077101897 11:826122-826144 CCCTTGGTCTCAAGGTCCTGTCC No data
Right 1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
1077101906_1077101908 -7 Left 1077101906 11:826156-826178 CCTTTTGTGGTTCAGCTGGGTCG 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
1077101900_1077101908 6 Left 1077101900 11:826143-826165 CCTATAAGCCCAGCCTTTTGTGG 0: 1
1: 0
2: 6
3: 185
4: 4443
Right 1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
1077101896_1077101908 28 Left 1077101896 11:826121-826143 CCCCTTGGTCTCAAGGTCCTGTC No data
Right 1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
1077101902_1077101908 -2 Left 1077101902 11:826151-826173 CCCAGCCTTTTGTGGTTCAGCTG 0: 1
1: 0
2: 2
3: 16
4: 225
Right 1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
1077101898_1077101908 26 Left 1077101898 11:826123-826145 CCTTGGTCTCAAGGTCCTGTCCT No data
Right 1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
1077101894_1077101908 30 Left 1077101894 11:826119-826141 CCCCCCTTGGTCTCAAGGTCCTG No data
Right 1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
1077101895_1077101908 29 Left 1077101895 11:826120-826142 CCCCCTTGGTCTCAAGGTCCTGT No data
Right 1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 156
1077101903_1077101908 -3 Left 1077101903 11:826152-826174 CCAGCCTTTTGTGGTTCAGCTGG 0: 1
1: 0
2: 3
3: 17
4: 169
Right 1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077101908 Original CRISPR TGGGTCGCACGCTGGATCCC AGG Intronic
903146096 1:21372966-21372988 TGGGTGGATTGCTGGATCCCAGG + Intergenic
910604149 1:89065206-89065228 TGTGTCTCTCACTGGATCCCTGG + Exonic
911214303 1:95175799-95175821 AGGGTCTCACTCTGGTTCCCAGG + Intronic
912848393 1:113098954-113098976 TGAGTCTCACTCTGTATCCCAGG + Intronic
920386440 1:205573033-205573055 TGGGACGCTCGCTTGAGCCCAGG + Intronic
920664147 1:207947966-207947988 TGGGTGGAACGCTTGAGCCCAGG + Intergenic
922236115 1:223723916-223723938 TGGGGAGCAGGCTGGAGCCCTGG - Intronic
922734431 1:227971733-227971755 TGGGCCGCACGCGGGCTGCCGGG - Intergenic
924797496 1:247302548-247302570 TGGGTGGCTCGCTTGAGCCCAGG - Intronic
1065657368 10:27965597-27965619 GGGGTGGCAGGCTGGATTCCTGG - Intronic
1067132431 10:43576620-43576642 TGGGACGATCGCTTGATCCCAGG - Intergenic
1072636233 10:97180171-97180193 TGGGCGTCACGCTGGATCCCAGG - Intronic
1073114016 10:101080823-101080845 TGGGTGGATCGCTTGATCCCAGG - Intergenic
1073656183 10:105419668-105419690 TGGGTCTCACTCTGTAGCCCAGG + Intergenic
1075107833 10:119553885-119553907 TGGGAGGAACGCTGGAGCCCAGG - Intergenic
1076791314 10:132778387-132778409 TGGGTGGAATGCTGGAGCCCAGG - Intronic
1076835825 10:133020592-133020614 TGGGGGGCAGGCGGGATCCCTGG - Intergenic
1077101908 11:826172-826194 TGGGTCGCACGCTGGATCCCAGG + Intronic
1079043184 11:17077618-17077640 TGGGTCGCATGCATGCTCCCGGG - Exonic
1083843327 11:65316704-65316726 TGCGTGGCAAGCTGGATCCTAGG + Intronic
1085115809 11:73930517-73930539 TGGGTGGATCGCTGGAGCCCAGG + Intergenic
1088685462 11:112281233-112281255 TGGGATGATCGCTGGATCCCAGG - Intergenic
1095706564 12:45243291-45243313 AGGGTCTCACTCTGGAGCCCAGG - Intronic
1098318384 12:69215653-69215675 TGGGTCTCACACTGTCTCCCAGG + Intergenic
1104656992 12:130580898-130580920 TGGGTCTCACTCTGTCTCCCGGG - Intronic
1109289527 13:60456921-60456943 TGGGTGGCTCGCTTGAACCCAGG - Intronic
1109440258 13:62361322-62361344 CGGGTTGCACGCTGGATCTAAGG + Intergenic
1119063957 14:71506889-71506911 TGGGTGGAACGCTTGAGCCCAGG - Intronic
1119646451 14:76351957-76351979 TGGGTCTCACTCTGTCTCCCAGG - Intronic
1121534912 14:94684724-94684746 TGGGTGGATCGCTGGAGCCCAGG + Intergenic
1122730110 14:103790218-103790240 AGGGTCTCACTCTGTATCCCAGG - Intronic
1122799243 14:104221549-104221571 TGGGTGGCATGCAGGCTCCCTGG + Intergenic
1122913285 14:104844042-104844064 TGGGTCCCGGGCTGGCTCCCTGG + Intergenic
1128710230 15:69866201-69866223 AGGGTCTCACTCTGGCTCCCAGG + Intergenic
1132949501 16:2552964-2552986 AGCCTCGCACGCTGGCTCCCTGG - Intronic
1132964847 16:2647202-2647224 AGCCTCGCACGCTGGCTCCCTGG + Intergenic
1135069737 16:19341378-19341400 TGGGTGGAACGTTGGAGCCCAGG + Intergenic
1139505401 16:67395905-67395927 TGGTTCAGAGGCTGGATCCCTGG - Intronic
1139684213 16:68590292-68590314 TGGCTCACACGTGGGATCCCAGG + Intergenic
1142368612 16:89664834-89664856 TGGGACGCAGGCTGAATTCCAGG - Intronic
1144955797 17:19018227-19018249 TGGGTGACCCGCTGGAACCCTGG - Intronic
1145764313 17:27447899-27447921 TGGGTCCCACTCTGGGCCCCGGG + Intergenic
1145776119 17:27530215-27530237 TGGGTGGATCGCTGGAGCCCAGG + Intronic
1146643261 17:34556932-34556954 TGGGACTCACTCTGGATTCCAGG - Intergenic
1147717965 17:42520840-42520862 TGCGTCGAACTCTTGATCCCAGG + Intronic
1150293646 17:63996536-63996558 TGGGTCTCACCCTGTTTCCCAGG + Intergenic
1151987447 17:77553187-77553209 TGGGTCTTGCGCTGTATCCCTGG + Intergenic
1153305403 18:3626263-3626285 TGGGTCTCACTCTGTAGCCCAGG - Intronic
1153524276 18:5979867-5979889 AGGGTCCCACGCAGGATCCCTGG - Intronic
1156512723 18:37654829-37654851 AGGGTCTCACGCTGTCTCCCCGG + Intergenic
1157375307 18:47158567-47158589 TGGGTCGATCGCTTGAGCCCAGG - Intronic
1157759503 18:50250191-50250213 GGGGTCTCACGCTGTAACCCAGG - Intronic
1158348874 18:56543992-56544014 TGGGTCTCACTCTGTTTCCCAGG - Intergenic
1160774057 19:846676-846698 TGGGCCTCCCGCTGGATACCTGG - Intronic
1160788183 19:911713-911735 AGGGGCGCACCCTGGGTCCCCGG + Intronic
1160850915 19:1191833-1191855 TGGGTGGATCACTGGATCCCAGG - Intronic
1161202137 19:3021061-3021083 TGGGTCTCACTCTGTCTCCCAGG - Intronic
1161246754 19:3257034-3257056 TGGGAGGCTCGCTTGATCCCAGG - Intronic
1162459269 19:10804461-10804483 TGGGTCGATTGCTGGAGCCCAGG + Intronic
1165409264 19:35648793-35648815 TGGGCCGCAGCCTGGCTCCCGGG + Intronic
1166114127 19:40642317-40642339 TGGGAGGATCGCTGGATCCCAGG + Intergenic
1166847401 19:45737405-45737427 TGGGTGGATCACTGGATCCCAGG - Intronic
1167488927 19:49780781-49780803 TGGGAGGATCGCTGGATCCCAGG + Intronic
925612288 2:5711697-5711719 TGGGTCTCACGCTGTCACCCAGG - Intergenic
927802552 2:26114661-26114683 TGGGTGGGTCGCTGGAGCCCAGG + Intronic
928903830 2:36350393-36350415 TGGGTGGATCGCTGGAGCCCAGG - Intergenic
930074622 2:47396589-47396611 TGGGTGGATCGCTTGATCCCTGG + Intergenic
933654786 2:84878745-84878767 TGGATTGGAGGCTGGATCCCAGG + Intronic
937262733 2:120596710-120596732 TGGGTCCCACGGTGGGGCCCTGG - Intergenic
937449841 2:121992943-121992965 TGGGGCACACACTGGATCCTTGG + Intergenic
937950131 2:127379047-127379069 TGGGTGGGTCGCTGGAGCCCAGG - Intronic
938657478 2:133448865-133448887 TGGGTGGCTCGCTGGAGCCCAGG - Intronic
938871026 2:135476727-135476749 TGGGTCTCACTCTGTCTCCCAGG + Intronic
941929611 2:170926833-170926855 TGGGTCTCACTCTGTCTCCCAGG - Intergenic
945063075 2:205925322-205925344 TGGGACGATCGCTGGAGCCCAGG + Intergenic
945100020 2:206255201-206255223 TGGGTCTCACTCTGTCTCCCAGG + Intergenic
948354657 2:237368544-237368566 TGGGTCACACGGTGCATACCTGG + Exonic
1171011665 20:21512558-21512580 AGGGTCGCACGGAGGATCCAGGG - Intronic
1172045433 20:32076760-32076782 TGGTTCCCAAGCTGGGTCCCTGG - Intronic
1173489324 20:43467010-43467032 TGGGACGATCGCTGGAGCCCAGG - Intergenic
1173613527 20:44388179-44388201 TGGGAGGATCGCTGGATCCCAGG - Intronic
1175868901 20:62198023-62198045 TGGGTCACACGGTGGCCCCCAGG - Intronic
1176277322 20:64279762-64279784 TGGGTCCCTCTCTGGACCCCAGG + Intronic
1177144554 21:17393198-17393220 TGGGAGGAACGCTTGATCCCAGG + Intergenic
1179231069 21:39504286-39504308 TGGGTCTCAGCCTGGGTCCCTGG + Intronic
1179732441 21:43375249-43375271 TGGGTCTCCCGCTGTGTCCCCGG + Intergenic
1180791450 22:18577591-18577613 TGGGGCGCACGCGGGACCCCTGG - Intergenic
1181230289 22:21417720-21417742 TGGGGCGCACGCGGGACCCCTGG + Intronic
1181248361 22:21517143-21517165 TGGGGCGCACGCGGGACCCCTGG - Intergenic
1182198060 22:28539405-28539427 TGGGTGGATCGCTGGAGCCCAGG + Intronic
1182961754 22:34481849-34481871 TGGGTCTCACTCTGTAGCCCAGG - Intergenic
1183294410 22:37021109-37021131 TGAGCCGCAGGCTGGATCCAGGG - Intronic
951203075 3:19896144-19896166 TGGGTAGCACTGGGGATCCCTGG - Intronic
952004344 3:28825385-28825407 TGGGTCGCACTCTGTCACCCAGG + Intergenic
953706769 3:45237173-45237195 TGGGTCACATGCTTGTTCCCTGG - Intergenic
954216966 3:49130093-49130115 GGGATCCCACCCTGGATCCCTGG + Intronic
954380182 3:50215189-50215211 TGTGTCGCACCCTGGATCAAAGG + Intronic
955399364 3:58580505-58580527 TGGGAGGCTCGCTTGATCCCAGG - Intronic
956113849 3:65898945-65898967 TGGGTCTCACTCTGCAGCCCAGG + Intronic
964489456 3:157219808-157219830 AGGGTCTCACTCTGTATCCCAGG + Intergenic
966830180 3:184001480-184001502 TGTGTCGCACGGTGCAGCCCAGG + Intronic
966849272 3:184155042-184155064 TGGGTCTGACTCTGGATCCCTGG - Intronic
968557099 4:1251043-1251065 TGGGGAAGACGCTGGATCCCTGG - Intergenic
968711919 4:2125720-2125742 AAGGTCGCAGGATGGATCCCGGG - Intronic
970181578 4:13402818-13402840 AGGGTCTCACGCTGTCTCCCAGG + Intronic
970669558 4:18380403-18380425 AGGGTCTCACTCTGTATCCCAGG - Intergenic
972077958 4:35109278-35109300 TGGGTGGATCGCTGGAGCCCAGG - Intergenic
974066692 4:57085014-57085036 TGGGTGGATCGCTTGATCCCAGG - Intronic
975754225 4:77556989-77557011 TGGGTCTCACTCTGCAGCCCAGG - Intronic
980956160 4:139431079-139431101 GTGGTGGCACGCTGGATTCCAGG - Intergenic
981883123 4:149639691-149639713 TGGGTAGAACACTTGATCCCAGG + Intergenic
981927577 4:150156417-150156439 TGGGTGGCTTGCTTGATCCCAGG + Intronic
983558491 4:169078834-169078856 TGGGTCTCACTCTGGCACCCAGG - Intergenic
984987524 4:185345881-185345903 TGGGTCTCACTCTGTCTCCCAGG + Intronic
988841536 5:35088140-35088162 TGGGACACAGGCTGGAGCCCAGG + Intronic
991353436 5:65744145-65744167 TGGGACGCTCACTTGATCCCAGG - Intronic
996963572 5:129280769-129280791 AGGGTCTCACTCTGGCTCCCAGG - Intergenic
997276220 5:132593887-132593909 TGGCTCTCACCCTGGTTCCCTGG - Intronic
997980020 5:138463345-138463367 GGGGTCTCACGCTGGCACCCAGG - Intergenic
998056315 5:139081278-139081300 TGGGTCTCACTCTGTAGCCCAGG + Intronic
1000927998 5:167216899-167216921 GGGGTCTCACGCTGTCTCCCAGG - Intergenic
1002889814 6:1322870-1322892 TGGGTCGCATGGTGGCTCCCAGG + Intergenic
1006525258 6:34599149-34599171 TGGGCTGCAGGCTGGAACCCAGG - Intronic
1010343517 6:74785173-74785195 TGGGTCTCACTCTGTCTCCCAGG + Intergenic
1012927712 6:105284311-105284333 TGGGGTGCATGCTGGATGCCCGG + Intronic
1013482555 6:110564976-110564998 TGGGTGCCACGCTGGGTGCCAGG - Intergenic
1013553891 6:111236915-111236937 TGGGAGGATCGCTGGATCCCAGG - Intergenic
1013618761 6:111869414-111869436 AGGGTCTCACTCTGGAGCCCAGG + Intronic
1015293475 6:131563894-131563916 TGGGTGGATCGCTGGAGCCCAGG - Intergenic
1017416734 6:154228861-154228883 TGGGTCTCACTCTGTAGCCCAGG - Intronic
1024074489 7:45811631-45811653 TGGGCCGCACGCGGGCTGCCGGG - Intergenic
1025052534 7:55742440-55742462 TGGGCCGCACGCGGGCTGCCGGG + Intergenic
1025130130 7:56370701-56370723 TGGGCCGCACGCGGGCTGCCGGG + Intergenic
1025130450 7:56371999-56372021 TGGGCCGCACGCGGGCTGCCGGG + Intergenic
1025131085 7:56374590-56374612 TGGGCCGCACGCGGGCTGCCGGG + Intergenic
1026005342 7:66596175-66596197 TGGGTCTCACTCTGTTTCCCAGG + Intergenic
1026035417 7:66826939-66826961 TGGGTGGATCGCTTGATCCCAGG - Intergenic
1029602591 7:101577498-101577520 TGGGTCTCACTCTGTCTCCCAGG + Intergenic
1029697274 7:102222029-102222051 TGGGTGGTTCGCTGGAGCCCAGG + Intronic
1029730342 7:102434239-102434261 TGGGCCTCACACTGGATCCCAGG - Intronic
1029998653 7:105034421-105034443 TGGGTCACACTCTGTAGCCCAGG + Intronic
1030517525 7:110556978-110557000 TGGGTCACTGGATGGATCCCCGG + Intergenic
1033022689 7:137742445-137742467 TGGGTCCCAGGCTAGATCACTGG - Intronic
1034390185 7:150780952-150780974 TGGGTCACAGGCTTTATCCCTGG + Intergenic
1034420287 7:150986982-150987004 TCGTTCTCACTCTGGATCCCCGG + Intergenic
1035948560 8:3993019-3993041 TGGGTCCCTGGCTGGAGCCCTGG + Intronic
1036704595 8:11037450-11037472 TGGGTGGATCGCTAGATCCCAGG - Intronic
1036942359 8:13063946-13063968 TGGGTGGATCGCTGGAGCCCAGG - Intergenic
1037505278 8:19523495-19523517 TGGGTGGATCGCTGGAGCCCAGG - Intronic
1037873339 8:22521130-22521152 TGGGACCCAAGCTGGGTCCCAGG + Intronic
1038013923 8:23497408-23497430 TGGGTCCCAGGCAGGATCCAGGG + Intergenic
1039059080 8:33559278-33559300 TGGGTCTCACGCTGTCACCCAGG - Intronic
1041141041 8:54819927-54819949 TGGGTCTCACGCAAGATCCGCGG + Intergenic
1042830786 8:73025965-73025987 TGGGTAGATCGCTTGATCCCAGG + Intronic
1044831636 8:96255609-96255631 TGGGTCTCACTCTGTCTCCCAGG - Intronic
1045432041 8:102123791-102123813 CGGGGCACCCGCTGGATCCCGGG - Intronic
1045459809 8:102415629-102415651 TGGGTCGATCGCTTGAGCCCAGG - Intergenic
1048985683 8:139733572-139733594 TGGGGCTCAGGCTGGCTCCCAGG - Intronic
1049503189 8:142979358-142979380 TGGGTCTCACTCTGTTTCCCAGG - Intergenic
1051226200 9:14901875-14901897 GGGGTCTCACGCTGTAGCCCAGG + Intronic
1057087067 9:92220869-92220891 TGGGAGGATCGCTGGATCCCAGG + Intronic
1057473203 9:95376272-95376294 AGGGTCTCACTCTGGAGCCCGGG + Intergenic
1062240253 9:135533810-135533832 TGGCTGGCAAGCTGGATGCCAGG + Intergenic
1062558562 9:137128849-137128871 TTAGACGCACGCTGGAGCCCAGG + Intergenic
1192119856 X:68445299-68445321 TGGGTGGATCGCTTGATCCCAGG + Intergenic
1201062844 Y:10063288-10063310 TGGGTCTTACTCTGGATCCTAGG - Intergenic