ID: 1077102883

View in Genome Browser
Species Human (GRCh38)
Location 11:829982-830004
Sequence CGTCCTCACAGCCCGCTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077102883_1077102889 18 Left 1077102883 11:829982-830004 CCAGGCAGCGGGCTGTGAGGACG 0: 1
1: 0
2: 1
3: 11
4: 173
Right 1077102889 11:830023-830045 CGCGAGCGCCCCGAGCTGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 76
1077102883_1077102893 29 Left 1077102883 11:829982-830004 CCAGGCAGCGGGCTGTGAGGACG 0: 1
1: 0
2: 1
3: 11
4: 173
Right 1077102893 11:830034-830056 CGAGCTGCTGGGCTCTTTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 87
1077102883_1077102888 17 Left 1077102883 11:829982-830004 CCAGGCAGCGGGCTGTGAGGACG 0: 1
1: 0
2: 1
3: 11
4: 173
Right 1077102888 11:830022-830044 GCGCGAGCGCCCCGAGCTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077102883 Original CRISPR CGTCCTCACAGCCCGCTGCC TGG (reversed) Exonic
900137166 1:1122482-1122504 CGGCCTCACAGGCCGAGGCCAGG - Intergenic
903591434 1:24458847-24458869 CGTCTCCACAGCCCACTGACTGG + Intronic
904236832 1:29122082-29122104 CCTCCTCTCCGCCCGCTGGCCGG - Intronic
904267640 1:29326724-29326746 CCTCCCCACAGCCCCCTGCGAGG - Intronic
908657185 1:66400799-66400821 CTCCCTCACAGCCCCATGCCTGG + Intergenic
920509006 1:206536919-206536941 GGTCCTCACAGATAGCTGCCAGG - Intronic
923157717 1:231293229-231293251 CCTCCTCACAGCCCAGTGCAGGG - Intergenic
1062907347 10:1187695-1187717 CGTCCTCACAGCTGCCTTCCCGG - Intronic
1063072595 10:2680954-2680976 CGTCCACACAGGCAGCTGCAAGG + Intergenic
1067414335 10:46092180-46092202 TGTCCTCACAGCCTACTGCCAGG + Intergenic
1067576041 10:47409270-47409292 TGTCCCCACAGCCTACTGCCAGG - Intergenic
1067581552 10:47449701-47449723 TGTCCCCACAGCCTACTGCCAGG - Intergenic
1073451652 10:103613230-103613252 TGACCTCACAGCCCACTCCCAGG + Intronic
1075066799 10:119294348-119294370 TGTCCCCCCAGCCCTCTGCCAGG + Intronic
1075711813 10:124534680-124534702 CGTCCTTCCCGCCCGGTGCCTGG + Intronic
1076024405 10:127100328-127100350 CTTCCTCACAGCCCCCTTCTAGG - Intronic
1076882385 10:133245839-133245861 CTCCCTCACAGCCCGCAGCTGGG - Intergenic
1077102883 11:829982-830004 CGTCCTCACAGCCCGCTGCCTGG - Exonic
1079064332 11:17276578-17276600 CCTCCTCACCGCCCGCCTCCAGG + Intronic
1081870203 11:46379841-46379863 AGCCTTCTCAGCCCGCTGCCGGG - Exonic
1083628501 11:64084192-64084214 CCTCCTCTCAGCCCCCTCCCAGG + Intronic
1090258889 11:125304499-125304521 AGGGCTCCCAGCCCGCTGCCTGG + Intronic
1090798881 11:130158655-130158677 AGTCCTCAGAGCCCTTTGCCTGG - Intergenic
1091121953 11:133064515-133064537 CGTCCTCAGGGGCCGCTGCAGGG + Intronic
1091391849 12:130712-130734 CCTCCTCCCAGCCTGCTGTCTGG - Intronic
1092097614 12:5856615-5856637 CGTCCCCTTAACCCGCTGCCTGG + Intronic
1092155610 12:6279761-6279783 CTGACTCACAGCCCTCTGCCTGG + Intergenic
1102259681 12:111436485-111436507 CATCCTCACAGCAGGCTGCAGGG + Intronic
1102683191 12:114704324-114704346 AGTCCTCCCAGCACTCTGCCTGG + Intergenic
1104559687 12:129832636-129832658 CCTCCTCCCAGGCCTCTGCCCGG + Intronic
1104794991 12:131511131-131511153 CACCCTCACAGCCCGCCCCCAGG + Intergenic
1107495457 13:40921856-40921878 AGTCCTCCCAGCCCGCAACCCGG + Intergenic
1107898484 13:44989263-44989285 CGTCCTCGCTTCCCGCAGCCGGG - Exonic
1108593904 13:51934446-51934468 CCTCCTCACAGACCTCTGCTTGG - Exonic
1113446617 13:110373675-110373697 CGTCCTCACACCCTGCGGCTTGG - Intronic
1113847608 13:113401581-113401603 CGTGCTCCCAGCCCGCTTCGAGG - Intergenic
1113944198 13:114034435-114034457 GGGCCGCACAGCCTGCTGCCAGG - Intronic
1117995038 14:61470380-61470402 CGTCCTCACAGCCTGATGCAGGG - Intronic
1119286297 14:73458012-73458034 TCTCCTCACCGGCCGCTGCCGGG + Intronic
1120765390 14:88323401-88323423 CGCCCTCGCCGCGCGCTGCCCGG - Intronic
1124427002 15:29570826-29570848 CGGCCTCCCAGCCGGCTGCCAGG + Intergenic
1126668106 15:51093409-51093431 CATCCTCACAGCCCCTGGCCAGG - Intronic
1127884729 15:63189422-63189444 CGTCATCACCGCCCGCGCCCCGG - Intergenic
1128698947 15:69789943-69789965 CGTACCCAAAGCCCACTGCCAGG + Intergenic
1129814284 15:78538466-78538488 CTTCCTCACAGCACAGTGCCTGG + Intergenic
1131160532 15:90102172-90102194 CGTCCCGCCAGCCCGCAGCCCGG - Intronic
1131863571 15:96681241-96681263 CATCCTCAATGCCCTCTGCCTGG + Intergenic
1132484130 16:181394-181416 CGTCCTCGCAGCCCGCCGCCCGG - Intergenic
1132653140 16:1030614-1030636 CCCCCTGACAGCCCGCTCCCTGG + Intergenic
1134018722 16:10907121-10907143 CCTCCTCACAGCCCGGCCCCGGG + Exonic
1134025416 16:10949428-10949450 CCACCTGACACCCCGCTGCCTGG - Intronic
1134615883 16:15650662-15650684 GGTCCCCAAACCCCGCTGCCAGG + Intronic
1135852841 16:25980268-25980290 CGTGCTCTCAGCCCTCTTCCTGG + Intronic
1136115342 16:28091043-28091065 CTTCCGCTCAGCCCGCAGCCAGG + Intergenic
1137434987 16:48447658-48447680 TGTCCTCACAGCTTGCTGCTGGG - Intronic
1138146111 16:54613100-54613122 AGTCCTCACAGCCTGCGGCCTGG - Intergenic
1138431496 16:56972047-56972069 CGTCATCACAGCCTCCTACCTGG + Exonic
1142396578 16:89835374-89835396 CGTCCTCACTGCCACCTTCCAGG + Intronic
1143050901 17:4125003-4125025 CAACCTCACAGGCTGCTGCCTGG + Intronic
1144735636 17:17553903-17553925 CGCCCTCCCTCCCCGCTGCCCGG + Intronic
1147561673 17:41513162-41513184 CCTTTTCACAGCCTGCTGCCAGG - Intergenic
1148348737 17:46923122-46923144 CGTCCTCACAGCCCCCCTTCCGG - Exonic
1148899635 17:50866277-50866299 TCTCCACACAGCCCGGTGCCCGG + Exonic
1150466254 17:65395295-65395317 AGTCCTCAGAGCCATCTGCCTGG + Intergenic
1152401878 17:80071332-80071354 CGGCCTCACAGCCTCCTCCCAGG + Intronic
1152636200 17:81431447-81431469 CCTCCATACAGCCCTCTGCCAGG - Intronic
1152740538 17:82016578-82016600 GGACCTCAGAGCCAGCTGCCCGG + Intronic
1152846299 17:82601778-82601800 CGTCCTCACACAGCGATGCCTGG - Exonic
1153980089 18:10301330-10301352 CCTCTTAACAGCCTGCTGCCTGG - Intergenic
1154087197 18:11318956-11318978 CCTCATCTCAGCCTGCTGCCTGG - Intergenic
1154169144 18:12038326-12038348 AGTCCACACAGCCGGCTGCGAGG - Intergenic
1158992443 18:62883282-62883304 CGCCCTCCCAGCCTGCTGTCTGG - Intronic
1160343564 18:78110582-78110604 CGTCTTCGCAGCCCACTGGCTGG - Intergenic
1161390202 19:4016732-4016754 TGCCCTCACTGCCCTCTGCCTGG - Intronic
1161556564 19:4945938-4945960 CATCCTCATAGCCCCCCGCCAGG - Exonic
1164208261 19:23075450-23075472 CCTCCCCACAGTCCGCTCCCGGG + Intronic
1164229322 19:23273991-23274013 CCTCCCCACAGTCCGCTCCCGGG - Intergenic
1165093744 19:33399677-33399699 CGGCCCCACAGCCCGTTGCTGGG - Intronic
1165242738 19:34481265-34481287 CGTCCCCACGACCCCCTGCCTGG - Intergenic
1166478195 19:43147410-43147432 GGTGTTCACAGCCCTCTGCCAGG - Intronic
1166978176 19:46617274-46617296 CATCCTCTCTGCCAGCTGCCCGG - Intergenic
1167075001 19:47243246-47243268 CGCCCTCCCAGCCCCCAGCCCGG - Intergenic
1167697495 19:51024002-51024024 CCTCCTCACCACCCCCTGCCAGG + Intronic
1168148865 19:54434425-54434447 CCTCTGCACAGCCCTCTGCCTGG + Intronic
925380470 2:3421922-3421944 TCTCCTCACAGCCCACGGCCAGG + Exonic
932121657 2:69106453-69106475 CGGGGTCACAGCCCGCAGCCTGG - Intronic
935671492 2:105560392-105560414 CCTCCTAAGAGCCCGCGGCCCGG - Intergenic
937086549 2:119175638-119175660 CATCCTCACAGCCGGCTGGCAGG + Intergenic
937330724 2:121026594-121026616 CGTCCCCACAGGCAACTGCCTGG + Intergenic
937976277 2:127583832-127583854 GCTTCTCACAGCCCCCTGCCGGG - Intronic
938941450 2:136173021-136173043 GGACCTCACAGCCTGCTGCTAGG - Intergenic
941136434 2:161723138-161723160 AGTCCTCACAGCCCTGTGCTTGG + Intronic
943066351 2:183090781-183090803 CCCCCTCCCAGCCCGCTGTCTGG - Intronic
944715734 2:202375263-202375285 CGCCCTTACACCCCGCTGCGGGG - Intergenic
947462268 2:230313689-230313711 TGTCCTCAGAGCTCGCTTCCTGG - Intergenic
947471386 2:230404199-230404221 TGTCCTCAGAGCTCGCTTCCTGG - Intergenic
947590641 2:231383225-231383247 CCGACTCCCAGCCCGCTGCCTGG - Intergenic
948499219 2:238379362-238379384 CATCCTGACAGCCAGCTGCATGG - Intronic
948954171 2:241273760-241273782 GGTCCGCACAGCCTGCAGCCAGG + Intronic
1171174949 20:23044792-23044814 CCTCCTCACTTCCTGCTGCCTGG - Intergenic
1171406900 20:24917847-24917869 CTTCCTCACAGCCTGGTGGCCGG - Intergenic
1171427948 20:25060139-25060161 CTTCCTCACAGCTCGCAGCTGGG - Intergenic
1172094247 20:32452937-32452959 CGCTCTCACAGGCAGCTGCCAGG + Exonic
1173842817 20:46169590-46169612 CGTCATCACAGCCCACCCCCAGG - Intergenic
1175766679 20:61597399-61597421 CGTCCTCACCACCCTCTGCCTGG + Intronic
1176938264 21:14892555-14892577 CCTCCCCACACCCCGCTCCCTGG - Intergenic
1179189948 21:39115259-39115281 CCTCAGCACAGCCCCCTGCCAGG + Intergenic
1179271931 21:39858271-39858293 AGTCCTCACAGGGCACTGCCTGG - Intergenic
1179796804 21:43789700-43789722 CTTCCTCACCGCCCGGTCCCGGG - Exonic
1179993284 21:44959637-44959659 CGTGCTCCCTGCCCCCTGCCAGG - Intronic
1180096206 21:45556205-45556227 GGTCCTCACGGCCTGCGGCCCGG + Intergenic
1180613089 22:17110024-17110046 AATCCACACAGCCCGCTCCCAGG + Exonic
1180954797 22:19736855-19736877 CCCCCTCACCGCCCGCTGTCAGG + Intergenic
1181018107 22:20082957-20082979 GGTCCTCCCAGGCTGCTGCCAGG - Intronic
1182429066 22:30289603-30289625 CGTCCACGCCGCCCGCTGCGAGG + Exonic
1183340959 22:37281137-37281159 CTTGCTCTCAGCCCCCTGCCTGG - Intergenic
1184674776 22:46035828-46035850 CATCCGCACAGCCCGCGGCCTGG + Intergenic
1185314643 22:50173800-50173822 CGTCCTCAGAGCCGGCTGCGTGG + Intronic
1185333286 22:50261057-50261079 CGGCCCCACAGCAGGCTGCCTGG + Intronic
953117266 3:40005312-40005334 CTTTCTCACAGCACTCTGCCAGG - Intronic
953800875 3:46021509-46021531 CGTCCCCACCCTCCGCTGCCGGG - Exonic
954401027 3:50319752-50319774 CGTGCTCTCAGCCCACAGCCAGG + Exonic
954746110 3:52788429-52788451 GGCCCTCACTGCCCTCTGCCTGG + Intronic
956136062 3:66100280-66100302 CATCCCCACAGCCCCCTGACAGG + Intergenic
959398227 3:105868523-105868545 AGTCCTCACCGCCGTCTGCCTGG + Intronic
960988627 3:123296257-123296279 GGTCCTCAGAGCCCGCTGTGAGG - Intronic
961545502 3:127629987-127630009 CACCCACACAGCCCGCCGCCCGG - Intronic
961976023 3:131026462-131026484 GGCCCTCACAACCCGCCGCCCGG + Intronic
962883489 3:139601066-139601088 TGTCCTCACTGCCTGCTCCCTGG - Intronic
964041778 3:152269307-152269329 CGTCCGCAGAGCCCGCGGCAGGG - Intronic
966975801 3:185082291-185082313 TGTCCCCACAGCCCCCTGCAGGG + Exonic
968555018 4:1242460-1242482 CGGCCTCACAGCACACTACCAGG - Intronic
968703565 4:2067679-2067701 GGCCCACACAGCCCCCTGCCCGG - Exonic
969632411 4:8346353-8346375 GCTCCTCACCTCCCGCTGCCTGG - Intergenic
973700167 4:53529304-53529326 CGTCCCCACTGCCTGCTCCCAGG - Intronic
979965698 4:127074239-127074261 CTTCCTCTCAGCCTGCTTCCTGG + Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985769393 5:1799514-1799536 CGACCTCACAGCCCGCGCGCAGG - Intronic
986775934 5:11013808-11013830 CATCGCCACAGCCCCCTGCCAGG - Intronic
993500492 5:88660985-88661007 CGGCCTCCCAGCCTGCTACCCGG + Intergenic
997401400 5:133605939-133605961 AGTCCTCACAGTCCTCTCCCGGG - Intronic
997614979 5:135240110-135240132 CGCCCACACAGCCCTCAGCCAGG + Intronic
999330472 5:150670625-150670647 CTTACTCACCGCCCGCTGGCTGG - Exonic
999646242 5:153719556-153719578 CTTCCTCACAGCACGATGGCTGG + Intronic
999815051 5:155167727-155167749 CATCCTCACAGCATGATGCCTGG - Intergenic
999863085 5:155669343-155669365 CATCCTGTCAGCCCCCTGCCAGG - Intergenic
1001411093 5:171512519-171512541 GAGCCTCACAGCACGCTGCCAGG - Intergenic
1002461121 5:179374334-179374356 CGTCCTCCAAGTCCTCTGCCCGG - Intergenic
1002796046 6:471611-471633 CTACCACCCAGCCCGCTGCCTGG - Intergenic
1005576034 6:27190364-27190386 CGAGCTCACAGCTCTCTGCCTGG + Intergenic
1006427639 6:33976203-33976225 CATCCTGACCGCCCGCGGCCTGG - Intergenic
1007736056 6:43982956-43982978 CTTCCTTACAGCACGGTGCCTGG + Intergenic
1007794681 6:44338010-44338032 CGTCCTCCCAGGCCTCTCCCAGG + Intronic
1009622426 6:66094736-66094758 CGTCCTCGCTTCCCGCAGCCGGG - Intergenic
1018728491 6:166631486-166631508 TGTCCTCACAGCGGGCTGGCGGG - Intronic
1019833744 7:3359673-3359695 CATCCTCACAGCGCGCCACCCGG - Intronic
1019992646 7:4703020-4703042 CGTCCTCAGCTCCCCCTGCCAGG + Intronic
1021835624 7:24670702-24670724 CTTCCTCACCCCCTGCTGCCAGG + Intronic
1023054970 7:36283894-36283916 CTTCCTCAGCACCCGCTGCCTGG - Intronic
1023779693 7:43644160-43644182 AGTCCTCACAGCCATCTCCCAGG + Intronic
1024639251 7:51316511-51316533 CGTCCGCACCGCGCGCTCCCGGG - Intronic
1029657644 7:101937437-101937459 CCTCCTCACACCCCACTTCCAGG - Intronic
1029703267 7:102261607-102261629 TGTCCTCAAATCCCGCTCCCTGG - Intronic
1036182439 8:6597075-6597097 TGGACTCACAGCCCTCTGCCTGG + Intronic
1037911807 8:22748106-22748128 CTTCCTCACACCTCCCTGCCCGG - Intronic
1040568443 8:48587460-48587482 CGTCCTCACAGCCCCCACCAGGG - Intergenic
1040633744 8:49247571-49247593 CTACCTCACAGCCCTCTGGCAGG - Intergenic
1048880786 8:138870989-138871011 TGTCCCCACATCCCTCTGCCTGG - Intronic
1048895415 8:138988136-138988158 CTTCCTCACAGCCTGGTGGCTGG - Intergenic
1048972768 8:139654529-139654551 CCACCTCAAAGCCCCCTGCCAGG + Intronic
1049199052 8:141331052-141331074 CGTCCCCGCAGCCTCCTGCCTGG - Intergenic
1049333696 8:142070300-142070322 GGTCCTCACCTGCCGCTGCCAGG - Intergenic
1049448124 8:142641043-142641065 CGTCCTTACAGCCATCTGCAGGG - Intergenic
1054793344 9:69276224-69276246 CTTCCTCACAGCGCGGTGGCTGG + Intergenic
1056568989 9:87799468-87799490 GCTCCTCACAGCCTCCTGCCTGG + Intergenic
1057279344 9:93698786-93698808 CCTCCTCCCAGCCCGCTGCTCGG - Intergenic
1057726468 9:97572038-97572060 GGACCTCACAGCCCACTGTCTGG - Intronic
1059170080 9:112116576-112116598 CATCGTCACAGCCCAGTGCCTGG - Intronic
1061481751 9:130900867-130900889 CGTCCACACAGGCCTCTGGCTGG - Intergenic
1062342817 9:136101264-136101286 CGTCCACACAGCCCAGTGCCTGG - Intergenic
1062467513 9:136687659-136687681 CCTCCCCACAGCCTTCTGCCAGG + Intergenic
1062567013 9:137167969-137167991 CGCCCGCCCACCCCGCTGCCTGG + Exonic
1062726364 9:138076230-138076252 TGTCCTCCCAGACCTCTGCCTGG - Intronic
1186188277 X:7042989-7043011 GGTGTTCACAGCCCTCTGCCAGG - Intergenic
1196393534 X:115234167-115234189 CCTCCTCCCAGCCCGCCCCCTGG - Intergenic
1197728799 X:129793634-129793656 CCTCCTCACTGCCAGCTGCCAGG - Exonic