ID: 1077103989

View in Genome Browser
Species Human (GRCh38)
Location 11:833953-833975
Sequence CATCATGGAATGGAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1575
Summary {0: 1, 1: 0, 2: 6, 3: 80, 4: 1488}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077103989_1077104003 20 Left 1077103989 11:833953-833975 CCCTCCAGCTCCATTCCATGATG 0: 1
1: 0
2: 6
3: 80
4: 1488
Right 1077104003 11:833996-834018 TGCCGCTGTTTGTGGGGGAAGGG 0: 1
1: 0
2: 0
3: 17
4: 140
1077103989_1077104001 15 Left 1077103989 11:833953-833975 CCCTCCAGCTCCATTCCATGATG 0: 1
1: 0
2: 6
3: 80
4: 1488
Right 1077104001 11:833991-834013 GTAGCTGCCGCTGTTTGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 132
1077103989_1077104002 19 Left 1077103989 11:833953-833975 CCCTCCAGCTCCATTCCATGATG 0: 1
1: 0
2: 6
3: 80
4: 1488
Right 1077104002 11:833995-834017 CTGCCGCTGTTTGTGGGGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 203
1077103989_1077103998 12 Left 1077103989 11:833953-833975 CCCTCCAGCTCCATTCCATGATG 0: 1
1: 0
2: 6
3: 80
4: 1488
Right 1077103998 11:833988-834010 GCTGTAGCTGCCGCTGTTTGTGG 0: 1
1: 0
2: 0
3: 15
4: 196
1077103989_1077103993 -10 Left 1077103989 11:833953-833975 CCCTCCAGCTCCATTCCATGATG 0: 1
1: 0
2: 6
3: 80
4: 1488
Right 1077103993 11:833966-833988 TTCCATGATGCCTCTTTCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 257
1077103989_1077103999 13 Left 1077103989 11:833953-833975 CCCTCCAGCTCCATTCCATGATG 0: 1
1: 0
2: 6
3: 80
4: 1488
Right 1077103999 11:833989-834011 CTGTAGCTGCCGCTGTTTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 119
1077103989_1077104005 30 Left 1077103989 11:833953-833975 CCCTCCAGCTCCATTCCATGATG 0: 1
1: 0
2: 6
3: 80
4: 1488
Right 1077104005 11:834006-834028 TGTGGGGGAAGGGCCAGTGATGG 0: 1
1: 0
2: 6
3: 55
4: 574
1077103989_1077104000 14 Left 1077103989 11:833953-833975 CCCTCCAGCTCCATTCCATGATG 0: 1
1: 0
2: 6
3: 80
4: 1488
Right 1077104000 11:833990-834012 TGTAGCTGCCGCTGTTTGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077103989 Original CRISPR CATCATGGAATGGAGCTGGA GGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900410196 1:2509151-2509173 CATCAGGGAATTGAGCGGTAGGG - Intronic
901847293 1:11991513-11991535 CAGCAGGGAATGGAGCCAGAGGG + Intronic
902159825 1:14520897-14520919 GCCCAGGGAATGGAGCTGGATGG - Intergenic
902771981 1:18650438-18650460 CATCCTGGGATGGTGCTGGAAGG + Intronic
904413146 1:30337133-30337155 CATCAAAGGAAGGAGCTGGAAGG - Intergenic
905994822 1:42372666-42372688 CATCATGGATTGATGCTTGAGGG + Intergenic
906794087 1:48682868-48682890 CCTCATTTAATGGAGCTGGTGGG + Intronic
907832319 1:58076885-58076907 GTTCATGGAATGAAGCTGGAAGG + Intronic
908090883 1:60684775-60684797 TATCATGGGATGGATCTGGAGGG + Intergenic
910072324 1:83232055-83232077 CATCATGGAATCCAGCCTGAAGG + Intergenic
910538207 1:88324047-88324069 CATCATGGGAGGGACCTGGTAGG - Intergenic
912747464 1:112257229-112257251 CATCATGGTGTTGAGCTGTATGG - Intergenic
913937585 1:125068248-125068270 CATCATTGAATGGAATTGAATGG + Intergenic
913937654 1:125069048-125069070 CATCATCGAATGGAATTGAATGG + Intergenic
913937706 1:125069803-125069825 CATCATGTAATGGAATTGAAAGG + Intergenic
913937734 1:125070117-125070139 CATCATCAAATGGAGTCGGATGG + Intergenic
913937840 1:125071537-125071559 CATCATAGAATGGAATTGAATGG + Intergenic
913937871 1:125071942-125071964 CATCATCGAATGGAACCGAAAGG + Intergenic
913937878 1:125072020-125072042 CATCATTGAATGGAATTGAAAGG + Intergenic
913937885 1:125072141-125072163 CATCATCGAATGGAATTGAAAGG + Intergenic
913938070 1:125074532-125074554 CATCATTGAATGGAATTGAATGG + Intergenic
913938117 1:125075182-125075204 CATCATCGAATGGAATTGAATGG + Intergenic
913938122 1:125075257-125075279 CATCATCGAATGGAATTGAATGG + Intergenic
913938149 1:125075609-125075631 CATCATAGAATGGAATTGAATGG + Intergenic
913938235 1:125076795-125076817 CATCATAGAATGGAATTGAATGG + Intergenic
913938240 1:125076844-125076866 CATCATTGAATGGAATCGGATGG + Intergenic
913938480 1:125079864-125079886 CATCATGAAATAGAACTGAATGG - Intergenic
913938566 1:125081009-125081031 CATCATCGAATGGAATTGAATGG - Intergenic
913938579 1:125081208-125081230 CATCATCGAATGGAATTGAATGG - Intergenic
913938667 1:125082540-125082562 CATCATCGAATGGAATTGAAAGG - Intergenic
913938856 1:125084967-125084989 CATCATCGAATGGAATTGAATGG - Intergenic
913944592 1:125147157-125147179 CATCATTGAATGGAATCGGATGG - Intergenic
913944780 1:125149702-125149724 CATCATAGAATGGAACCGAAAGG - Intergenic
913944807 1:125150090-125150112 CATCATAGAATGGAATTGAATGG - Intergenic
913945071 1:125153549-125153571 CATCATCGAATGGAATTGAATGG - Intergenic
913945217 1:125155589-125155611 CATCATTGAATGGAGTAGAATGG - Intergenic
913945376 1:125157547-125157569 CATCATAGAATGGAATTGAATGG - Intergenic
913945444 1:125158460-125158482 CATCAACGAATGGAATTGGATGG - Intergenic
913945490 1:125159128-125159150 CATCATAGAATGGAATTGAATGG - Intergenic
913945532 1:125159677-125159699 CATCATCGAATTGATCTGAATGG - Intergenic
913945724 1:125162444-125162466 AATCATCGAATGGAGTTGAATGG - Intergenic
913945802 1:125163550-125163572 CATCATCGAATGGAATTGAATGG - Intergenic
913945927 1:125165397-125165419 CATCATTGAATGGAATTGAATGG - Intergenic
913946014 1:125166442-125166464 CATCATCGAATGGATTTGAAAGG - Intergenic
913946229 1:125169446-125169468 CATCATCGAATGGATTTGAATGG - Intergenic
913946231 1:125169472-125169494 TATCATGGAATTGAAATGGATGG - Intergenic
913946242 1:125169576-125169598 CATCATCGAATGGAGTCGAATGG - Intergenic
913946287 1:125170139-125170161 CATCATCGAATGGAAATGAAAGG - Intergenic
913946565 1:125175899-125175921 CATCATCGAATGGACTTGAATGG - Intergenic
913946861 1:125179457-125179479 CATCATCGAATGGACCCGAATGG - Intergenic
913946904 1:125179973-125179995 CATCATCGAATGGAAATGAAAGG - Intergenic
913947117 1:125182555-125182577 CATCATCGAATGGACCCGAATGG - Intergenic
913947158 1:125183072-125183094 CATCATCGAATGGAAATGAAAGG - Intergenic
913947308 1:143184918-143184940 CATCATCGAATGGAAATGAAAGG + Intergenic
913947349 1:143185435-143185457 CATCATCGAATGGACCCGAATGG + Intergenic
913947493 1:143187208-143187230 CATCATCGAATGGACCCGAATGG + Intergenic
913947523 1:143187556-143187578 CATCATTGAATGGAATTGAATGG + Intergenic
913947692 1:143189830-143189852 CATCATCGAATGGAAATGAAAGG + Intergenic
913947768 1:143190766-143190788 CATCATCGAATGGAAATGAAAGG + Intergenic
913947806 1:143191234-143191256 CATCATCGAATGGAAATGAAAGG + Intergenic
913947952 1:143192998-143193020 CATCATCGAATGGAAATGAAAGG + Intergenic
913947994 1:143193516-143193538 CATCATCGAATGGACCCGAATGG + Intergenic
913948097 1:143194764-143194786 CATCATCGAATGGAAATGAAAGG + Intergenic
913948133 1:143195229-143195251 CATCATCGAATGGAAATGAAAGG + Intergenic
913948589 1:143200840-143200862 CATCATCGAATGGAAATGAAAGG + Intergenic
913948766 1:143202941-143202963 CATCATCGAATGGACCCGAATGG + Intergenic
913949103 1:143207237-143207259 CATCATCGAATGGAAATGAAAGG + Intergenic
913949461 1:143211949-143211971 CATCATCGAATGGAAATGAAAGG + Intergenic
913949497 1:143212391-143212413 CATCATCGCATGGAACTGAATGG + Intergenic
913949502 1:143212466-143212488 CATCATCGAATGGACCCGAATGG + Intergenic
913949608 1:143213725-143213747 CATCATCGAATGGAAATGAAAGG + Intergenic
913949688 1:143214710-143214732 CATCATCGAATGGACCCGAATGG + Intergenic
913949796 1:143215968-143215990 CATCATCGAATGGAAATGAAAGG + Intergenic
913949938 1:143217744-143217766 CATCATCGAATGGAAATGAAAGG + Intergenic
913950007 1:143218609-143218631 CATCATTGAATGGAATTGAATGG + Intergenic
913950111 1:143219988-143220010 CATCATCGAATGGAAATGAAAGG + Intergenic
913950113 1:143220014-143220036 CATCATGCAATGGAATTGCATGG + Intergenic
913950148 1:143220456-143220478 CATCATCGAATGGAAATGAAAGG + Intergenic
913950190 1:143220972-143220994 CATCATCGAATGGACCCGAATGG + Intergenic
913950220 1:143221320-143221342 CATCATTGAATGGAATTGAATGG + Intergenic
913950333 1:143222699-143222721 CATCATCGAATGGAAATGAAAGG + Intergenic
913950375 1:143223216-143223238 CATCATCGAATGGACCCGAATGG + Intergenic
913950478 1:143224474-143224496 CATCATCGAATGGAAATGAAAGG + Intergenic
913950512 1:143224945-143224967 CATCATCGAATGGAAATGAAAGG + Intergenic
913950549 1:143225416-143225438 CATCATGGAATGGAATAGAATGG + Intergenic
913950568 1:143225644-143225666 CATCATCGAATGGATTTGAATGG + Intergenic
913950770 1:143228318-143228340 CATCATCGGATGGAACTGAATGG + Intergenic
913950930 1:143230364-143230386 CATCATCGAATGGACCCGAATGG + Intergenic
913950960 1:143230713-143230735 CATCATTGAATGGAATTGAATGG + Intergenic
913951068 1:143232091-143232113 CATCATCGAATGGAAATGAAAGG + Intergenic
913951109 1:143232605-143232627 CATCATCGAATGGACCCGAATGG + Intergenic
913951341 1:143235544-143235566 CATCATTGAATGGAATTGAATGG + Intergenic
913951445 1:143236897-143236919 CATCATCGGATGGAACTGAATGG + Intergenic
913951455 1:143237024-143237046 CATCATCGAATGGAAATGAAAGG + Intergenic
913951551 1:143238134-143238156 CATCATCGAATGGAAATGAAAGG + Intergenic
913951590 1:143238651-143238673 CATCATCGAATGGACCCGAATGG + Intergenic
913951728 1:143240378-143240400 CATCATCGAATGGAAATGAAAGG + Intergenic
913951770 1:143240894-143240916 CATCATCGAATGGACCCGAATGG + Intergenic
913951938 1:143243063-143243085 CATCATCGAATGGAAATGAAAGG - Intergenic
913952258 1:143247065-143247087 CATCATCAAATGGAACTGAATGG - Intergenic
913952482 1:143249985-143250007 CATCATCGAATGGAAATGAAAGG - Intergenic
913952690 1:143252578-143252600 CATCATCGAATGGACCCGAATGG - Intergenic
913952734 1:143253095-143253117 CATCATCGAATGGAAATGAAAGG - Intergenic
913952826 1:143254207-143254229 CATCATCGAATGGAAATGAAAGG - Intergenic
913952882 1:143254828-143254850 CATCATCGAATGGACCCGAATGG - Intergenic
913952988 1:143256126-143256148 CATCATCGAATGGACCTGAATGG - Intergenic
913953479 1:143262388-143262410 CATCATCGAATGGACCCGAATGG + Intergenic
913953664 1:143264626-143264648 CATCATCGAATGGAAATGAAAGG + Intergenic
913953738 1:143265611-143265633 CATCATCGAATGGAAATGAAAGG + Intergenic
913953814 1:143266597-143266619 CATCATCGAATGGACCCGAATGG + Intergenic
913953958 1:143268364-143268386 CATCATGGAATGGACTCGAATGG + Intergenic
913954231 1:143271897-143271919 CATCATCGAATGGATTTGAATGG + Intergenic
913954238 1:143272021-143272043 CATCATAGAATGGAATTGAATGG + Intergenic
913954242 1:143272067-143272089 AATCATCGAATGGAGTTGAATGG + Intergenic
913954503 1:143275516-143275538 CATCATCGAATGGAAATGAAAGG + Intergenic
913954586 1:143276641-143276663 CATCATAGAATGGAATTGAATGG + Intergenic
913954591 1:143276690-143276712 CATCATTGAATGGAATCGGATGG + Intergenic
913982852 1:143538728-143538750 CATCATTGAATGGAATCGGATGG - Intergenic
913982857 1:143538777-143538799 CATCATAGAATGGAATTGAATGG - Intergenic
915243769 1:154542149-154542171 CATCAGGGGACTGAGCTGGAAGG - Intronic
919414474 1:197290499-197290521 GGTCATGGAAAGGAGCTGGGGGG - Intronic
920267189 1:204732869-204732891 CAGCATGAAAGGGAGCTGGTTGG + Intergenic
921338618 1:214112095-214112117 CATCAGGGAATGGCCCTGGCAGG + Intergenic
922183785 1:223256733-223256755 CAGAATGGAAAGGAGTTGGAAGG - Intronic
924416409 1:243860890-243860912 CTTCATGGCATGGAGGAGGAAGG + Intergenic
1062817655 10:512617-512639 CATTATAGAAAGGAGCTGGCCGG + Intronic
1063828098 10:9921382-9921404 CACCATGGTAAGGAGCTGCATGG - Intergenic
1063867413 10:10380929-10380951 CAGGGTGGAATGGAGCTGGCGGG - Intergenic
1066743728 10:38583257-38583279 AATCATAGAATGGAATTGGAAGG + Intergenic
1066743762 10:38583694-38583716 AATCATGGAATGGAATTGAATGG + Intergenic
1066743773 10:38583843-38583865 CATCAAGGAATGGAATTGAATGG + Intergenic
1066743793 10:38584104-38584126 CATCATTGAATGGAATTGAATGG + Intergenic
1066743820 10:38584425-38584447 CATCATAGAATGGAATTGAATGG + Intergenic
1066743875 10:38585186-38585208 CATCATCGAATGGAAATGAATGG + Intergenic
1066743916 10:38585770-38585792 CATCATCGAATGGAAATGAATGG + Intergenic
1066744090 10:38587979-38588001 CATCATCGAATGGAATTGAAAGG + Intergenic
1066744140 10:38588586-38588608 CATCATCGAATGGATTTGAATGG + Intergenic
1066744150 10:38588710-38588732 CATCATAGAATGGAATTGAATGG + Intergenic
1066744224 10:38589628-38589650 CATCATGGAATGGAATAGAATGG + Intergenic
1066744270 10:38590248-38590270 CATCATTGAATGGAATTGAATGG + Intergenic
1066744398 10:38591835-38591857 AATCATCGAATGGAACTGAATGG + Intergenic
1066744504 10:38593218-38593240 CATCATGGAATGGAATCGAAAGG + Intergenic
1066744521 10:38593436-38593458 CATCATCGAATGGAATTGAATGG + Intergenic
1066744543 10:38593794-38593816 CATCATCGAATGGAATTGAATGG + Intergenic
1066744590 10:38594451-38594473 CATCATCGAATGGAATTGAACGG + Intergenic
1066744604 10:38594595-38594617 AATCATGGAATGGAATTGAATGG + Intergenic
1066772518 10:38858134-38858156 TAGAATGGAATGGAGTTGGATGG + Intergenic
1066936728 10:41848046-41848068 CATCATCGAATGGAATTGAATGG - Intergenic
1066936764 10:41848514-41848536 CATCATCGAATGGAAGTGAAAGG - Intergenic
1066936909 10:41850337-41850359 CATCATCGAATGGAAATGAAAGG - Intergenic
1066937083 10:41852524-41852546 CATCATAGAATGGAAATGAAAGG - Intergenic
1066937346 10:41855908-41855930 CATCATCGAATGGAAATGAAAGG - Intergenic
1066946792 10:42066860-42066882 CATCATTGAATGGAATTGAATGG + Intergenic
1066946804 10:42067013-42067035 CATCATGAAATGGAACCGAATGG + Intergenic
1066946807 10:42067039-42067061 CATCATTGAATGGAAATGAAAGG + Intergenic
1066946840 10:42067507-42067529 CATCATCGAATGGAAATGAAAGG + Intergenic
1066946929 10:42068686-42068708 CATCATTGAATGGAATTGAATGG + Intergenic
1066946941 10:42068839-42068861 CATCATGAAATGGAACCGAATGG + Intergenic
1066946944 10:42068865-42068887 CATCATTGAATGGAAATGAAAGG + Intergenic
1066946981 10:42069323-42069345 CATCATCGAATGGAAATGAAGGG + Intergenic
1066947033 10:42070019-42070041 CATCATCGAATGGATTTGAATGG + Intergenic
1066947123 10:42071116-42071138 CATCATCGAATGGAAATGAAAGG + Intergenic
1066947212 10:42072295-42072317 CATCATTGAATGGAATTGAATGG + Intergenic
1066947224 10:42072448-42072470 CATCATGAAATGGAACCGAATGG + Intergenic
1066947227 10:42072474-42072496 CATCATTGAATGGAAATGAAAGG + Intergenic
1066947263 10:42072932-42072954 CATCATCGAATGGAAATGAAAGG + Intergenic
1066947408 10:42074758-42074780 CATCATCGAATGGAAATGAAAGG + Intergenic
1066947446 10:42075226-42075248 CATCATCGAATGGAAATGAAAGG + Intergenic
1066947549 10:42076558-42076580 CATCATGAAATGGAACCGAATGG + Intergenic
1066947552 10:42076584-42076606 CATCATTGAATGGAAATGAAAGG + Intergenic
1066947588 10:42077042-42077064 CATCATCGAATGGAAATGAAAGG + Intergenic
1066947679 10:42078221-42078243 CATCATTGAATGGAATTGAATGG + Intergenic
1066947694 10:42078400-42078422 CATCATTGAATGGAAATGAAAGG + Intergenic
1066947731 10:42078858-42078880 CATCATCGAATGGAAATGCAAGG + Intergenic
1066947868 10:42080684-42080706 CATCATCGAATGGAAATGAAAGG + Intergenic
1066947959 10:42081863-42081885 CATCATTGAATGGAATTGAATGG + Intergenic
1066947974 10:42082042-42082064 CATCATTGAATGGAAATGAAAGG + Intergenic
1066948009 10:42082500-42082522 CATCATCGAATGGAAATGAAAGG + Intergenic
1066948061 10:42083196-42083218 CATCATCGAATGGATTTGAATGG + Intergenic
1066948107 10:42083825-42083847 CATCATTGAATGGAAATGAAAGG + Intergenic
1066948144 10:42084293-42084315 CATCATCGAATGGAAATGAAAGG + Intergenic
1066948291 10:42086119-42086141 CATCATCGAATGGAAATGAAAGG + Intergenic
1066948445 10:42088020-42088042 CATCATCGAATGGAAATGAAAGG + Intergenic
1066948470 10:42088410-42088432 CATCATCGAATGGATTTGAATGG + Intergenic
1066948744 10:42091936-42091958 CATCATCGAATGGAAATGAAAGG + Intergenic
1066948934 10:42094300-42094322 CATCATCGAATGGAAATGAAGGG + Intergenic
1066949231 10:42098068-42098090 CATCATCGAATGGAAATGAAAGG + Intergenic
1066949434 10:42100595-42100617 CATCATCGAATGGATTTGAATGG + Intergenic
1066949703 10:42104174-42104196 CATCATCGAATGGAAATGAAAGG + Intergenic
1066949829 10:42105839-42105861 CATCATCGAATGGAATTGAATGG + Intergenic
1066949854 10:42106213-42106235 CATCATCTAATGGAGTTGAATGG + Intergenic
1066949862 10:42106314-42106336 CATCATACAATGGAACTGAATGG + Intergenic
1066949867 10:42106363-42106385 CATCATTGAATGGAATCGGATGG + Intergenic
1066955473 10:42166255-42166277 CATCATTGAATGGAATTGAATGG + Intergenic
1066955498 10:42166623-42166645 CATCATCGAATGGAATTGAATGG + Intergenic
1066955703 10:42168989-42169011 CATCATCGAATGGATATGAATGG + Intergenic
1066955761 10:42169717-42169739 CATCATCGAATGGAATTGAATGG + Intergenic
1066955773 10:42169890-42169912 CATCATTGAATGGAATTGAATGG + Intergenic
1070161866 10:73871745-73871767 CAGCAAGAGATGGAGCTGGATGG + Intronic
1070990782 10:80730343-80730365 CATCAGGGAAGGGAGCTTTAAGG - Intergenic
1071116014 10:82221402-82221424 CATTATGGAGGGGGGCTGGAAGG - Intronic
1072828086 10:98628749-98628771 TATGAAGGAATGGAGCTAGAAGG - Intronic
1074244581 10:111676188-111676210 CAACTTGGAATGGAGATGTATGG + Intergenic
1074289291 10:112126445-112126467 CACCATTGCATGCAGCTGGAAGG + Intergenic
1075015062 10:118904395-118904417 AGTCATGGAAGAGAGCTGGATGG + Intergenic
1076388332 10:130075661-130075683 CATGTTGGAAGGGAGCTGGTGGG + Intergenic
1076422153 10:130339103-130339125 AGTCATGGAATGGTGCTGGCGGG + Intergenic
1077103989 11:833953-833975 CATCATGGAATGGAGCTGGAGGG - Intronic
1077558251 11:3237932-3237954 CAGAAGGGAATGGAGGTGGATGG + Intergenic
1077718595 11:4605221-4605243 CATCCAGGAATGGGGCTGAAGGG - Exonic
1078153491 11:8778618-8778640 CATGGTAGATTGGAGCTGGAGGG - Intronic
1079317393 11:19420751-19420773 CATAATAGAATGGAGCATGAGGG + Intronic
1079599680 11:22295523-22295545 CATAGTGTGATGGAGCTGGACGG + Intergenic
1080079125 11:28193604-28193626 AATTATGGAATGGGGGTGGAAGG - Intronic
1080179503 11:29407019-29407041 CATCATGGAAGCAAACTGGAGGG - Intergenic
1080729001 11:34929053-34929075 CATGGTGGACTGGAGTTGGATGG + Intronic
1083314644 11:61806923-61806945 CACCATGGCCTGCAGCTGGATGG + Intronic
1083919335 11:65773343-65773365 CATCATGGACTGGTTCTGGCTGG - Intergenic
1085179269 11:74519957-74519979 GATCCTGGCAGGGAGCTGGAGGG - Intronic
1087081230 11:94172919-94172941 CATTCTGGAGTGCAGCTGGAGGG - Intronic
1089608240 11:119654453-119654475 CAGCAGGGAATGGGGGTGGAGGG - Intronic
1089975962 11:122731633-122731655 CCTAGTGGAATGGAGTTGGATGG + Intronic
1093756118 12:22853792-22853814 CATCATGCATTAGATCTGGAAGG - Intergenic
1094072610 12:26434556-26434578 TATCATGGAATGGAACTCAAGGG + Intronic
1095140480 12:38656895-38656917 CATCTTGGAACGGACCTGAAAGG - Intronic
1095722564 12:45416656-45416678 CATCATGGAGTGGTGGTGGATGG - Intronic
1096474349 12:51899077-51899099 CATGATGGCATGGAGGTGGGTGG - Intergenic
1096647335 12:53046019-53046041 CTTCATGGAATGGAGCTAATGGG - Intergenic
1097315828 12:58170706-58170728 CATCATGGGAGGGACCTGGTGGG + Intergenic
1098824196 12:75272089-75272111 CTTATTGGAATTGAGCTGGAGGG + Intergenic
1099548114 12:84010922-84010944 AACAATGGAATGAAGCTGGATGG - Intergenic
1100256916 12:92893045-92893067 TATCAAGTATTGGAGCTGGATGG - Intronic
1101056872 12:100926677-100926699 CATCTTGGAATGGAGAGTGAAGG - Intronic
1101953222 12:109192331-109192353 CATCATGAAATGGACCAGAATGG + Intronic
1103454443 12:121053807-121053829 CTTCCTGGACTGGACCTGGAGGG + Intergenic
1103853057 12:123945988-123946010 CATCATGGACTGGAAATGGATGG - Intronic
1104472092 12:129037338-129037360 AATCATGGTGTGAAGCTGGAAGG + Intergenic
1105260171 13:18773189-18773211 AATCATGGATTGGAGGTGGTTGG - Intergenic
1105262847 13:18792500-18792522 AATCATGGATTGGAGGTGGTTGG - Intergenic
1107574162 13:41698953-41698975 GATCAAGGAGAGGAGCTGGAGGG - Intronic
1108158219 13:47610559-47610581 CATCATGCTAAGGTGCTGGAAGG + Intergenic
1108672255 13:52703621-52703643 CATCATGCCATGTAGCTGGTGGG - Exonic
1113762752 13:112861208-112861230 CATCATGGGAGGGACCTGGTGGG - Intronic
1114581176 14:23761728-23761750 CAGCATGGAACAAAGCTGGATGG - Intergenic
1114706678 14:24734379-24734401 CATCCTGTAATGCAGTTGGAGGG + Intergenic
1116590732 14:46768871-46768893 TATTCTGGAATGGTGCTGGAAGG + Intergenic
1117756655 14:58981361-58981383 CATGAGGAAATGGAGCTGTAGGG - Intergenic
1118138891 14:63057722-63057744 CATCATGGATTTGAACTGTAGGG + Intronic
1119150665 14:72356631-72356653 TATCATGGAAGGGACCTGGTGGG + Intronic
1121712017 14:96045496-96045518 CCTCATGGAGTGGAGTTGGATGG + Intronic
1123185368 14:106511534-106511556 CACCATGGACTGGACCTGGAGGG - Intergenic
1126114794 15:45198934-45198956 CATCCAGGAATGGGGCTGGGCGG + Exonic
1127646854 15:60967401-60967423 CAACATCGAATGGAGCTAGGAGG + Intronic
1127902588 15:63351929-63351951 CATCCTTGAATGGATGTGGAGGG + Intronic
1128856344 15:71019947-71019969 CATCATGTAAAAGAACTGGAAGG + Intronic
1128912618 15:71529994-71530016 CAACATGGAATGGTGCTAGGTGG + Intronic
1129448330 15:75634451-75634473 TATCATAGAAAGGAGATGGAGGG + Intergenic
1130148580 15:81294013-81294035 CATCACGGAATGGCCCTGCAGGG + Intronic
1131984025 15:98023231-98023253 CATCATGGGAGGGACCTGGTGGG + Intergenic
1132041202 15:98525620-98525642 CTTCCTGGGATGGAGATGGAGGG - Intergenic
1133198980 16:4190824-4190846 CATCAGGGAATGGAGAAGAAAGG + Exonic
1133825453 16:9274385-9274407 CATCATGGGAAGGAGCAGGGGGG - Intergenic
1136079564 16:27842813-27842835 CATCTCAGAATGGAGCAGGAGGG - Intronic
1136903686 16:34066615-34066637 CATCATCGAACGGAGTTGAATGG + Intergenic
1136903938 16:34069135-34069157 CATCATCGAATGGACATGAAAGG + Intergenic
1136903954 16:34069363-34069385 CATCATCGAATGGACTTGAATGG + Intergenic
1136903976 16:34069643-34069665 CATCATGGAATGGACTCGAATGG + Intergenic
1136903983 16:34069721-34069743 CATCGTGGAATGGACTTGAATGG + Intergenic
1136904016 16:34070147-34070169 CATCATGGAATGGACATGAATGG + Intergenic
1136904018 16:34070173-34070195 CATCATCGAATGGACTTGAATGG + Intergenic
1136904082 16:34070871-34070893 CATCATGGAATGGACTTGAATGG + Intergenic
1136904266 16:34072439-34072461 CATCATCGAACGGAGTTGAATGG + Intergenic
1136904557 16:34075493-34075515 CATCATTGAATGGAACAGAATGG + Intergenic
1136904571 16:34075650-34075672 CATCATGGAATGGAATCGAATGG + Intergenic
1136904606 16:34076100-34076122 CATCATCGAATGGAATTGAATGG + Intergenic
1136904618 16:34076283-34076305 CATCATCGAATGGAATTGAATGG + Intergenic
1136904624 16:34076358-34076380 CATCATCGAATGTAAATGGATGG + Intergenic
1136904630 16:34076452-34076474 CATCATCGAATGGAATTGAATGG + Intergenic
1136904797 16:34078652-34078674 CATCATCGAATGGAATTGAAAGG + Intergenic
1136904916 16:34080168-34080190 CATCATCGAATGGAAATGAATGG + Intergenic
1136905020 16:34081416-34081438 CATCATCGAATGGACTTGAATGG + Intergenic
1136905198 16:34083217-34083239 CATCATGGAATGGAATCGAATGG + Intergenic
1136905327 16:34085052-34085074 CATCATCGAATGGACTTGAATGG - Intergenic
1136905515 16:34086576-34086598 CTTCATGGAATGGAATTGAATGG - Intergenic
1136905529 16:34086746-34086768 CATCATCAAATGGAGTTGAATGG - Intergenic
1136905630 16:34088215-34088237 CATCATGGAATGGAATCGAATGG - Intergenic
1136905679 16:34088937-34088959 CATCATCGAATGGAGTCGAACGG - Intergenic
1136905756 16:34089975-34089997 CATCATCGAATGGAATTGAATGG - Intergenic
1136905937 16:34092403-34092425 CATCATGGAATGGAATCGAATGG - Intergenic
1136906004 16:34093276-34093298 CATCATCGAATGGAAATGAATGG - Intergenic
1136906026 16:34093531-34093553 CATCATCGAATGGACCCGAATGG - Intergenic
1136906042 16:34093687-34093709 CATCATCGAATGGAATTGAATGG - Intergenic
1136906195 16:34095906-34095928 CATCATCGAATGGAATTGAATGG - Intergenic
1136934807 16:34450886-34450908 TATCATGGAATGGAATTGAAAGG + Intergenic
1136934973 16:34453101-34453123 CATCATAGAATGGAATTGAATGG + Intergenic
1136935034 16:34453865-34453887 CATCATTGAATGGAATTGAATGG + Intergenic
1136935055 16:34454142-34454164 CATCATCGAATGGAATTGAATGG + Intergenic
1136935071 16:34454350-34454372 CATCATCGAATGGAATTGCATGG + Intergenic
1136935109 16:34454838-34454860 CATCATGGAATGGAATCGAATGG + Intergenic
1136935129 16:34455089-34455111 CATCATCGAATGGACTTGAATGG + Intergenic
1136937145 16:34481703-34481725 TATCATGGAATGGAATTGAAAGG + Intergenic
1136937170 16:34482000-34482022 CACCGTGGAATGGAGTTGAATGG + Intergenic
1136937183 16:34482170-34482192 CATCATCGAATGGAATTGAATGG + Intergenic
1136937252 16:34483118-34483140 CATCATGGAATGGAATCGAATGG + Intergenic
1136937284 16:34483568-34483590 CATCATGGAATGGAATCGAATGG + Intergenic
1136937313 16:34483983-34484005 CATCATCGAATGGAGTCGAATGG + Intergenic
1136937322 16:34484110-34484132 CATCATCGAATGGAATTGAATGG + Intergenic
1136937355 16:34484509-34484531 CATCATGGAATGGAATCGAATGG + Intergenic
1136937380 16:34484833-34484855 CATCATGGAATTGAATTGAAAGG + Intergenic
1136937392 16:34484980-34485002 CATCATTGAATGGAATTGAATGG + Intergenic
1136937575 16:34487339-34487361 CATCATCAAATGGAATTGGATGG + Intergenic
1136937595 16:34487581-34487603 CATCATCGAATGGAGTCGAATGG + Intergenic
1136937599 16:34487627-34487649 AATCATGGAATGGACTTGAATGG + Intergenic
1136937617 16:34487926-34487948 CATCATAGAATGGAATTGAATGG + Intergenic
1136937636 16:34488178-34488200 CATCATCGAATGGAATTGAATGG + Intergenic
1136937688 16:34488893-34488915 CATCATCGAATGGAATTGAATGG + Intergenic
1136937705 16:34489079-34489101 CATCATCGAATGGAATTGAATGG + Intergenic
1136937733 16:34489493-34489515 CATCATCGAATGGAATTGAATGG + Intergenic
1136937739 16:34489542-34489564 CATCATCGAATGGAATTGAATGG + Intergenic
1136937810 16:34490641-34490663 CATCATCGAATGGAATTGAATGG + Intergenic
1136937826 16:34490895-34490917 CATCATTGAATGGAACAGAATGG + Intergenic
1136937905 16:34492092-34492114 CATCATCGAATGGAATTGAACGG + Intergenic
1136937925 16:34492320-34492342 CATCATTGAATGGAACCGAAAGG + Intergenic
1136938041 16:34493843-34493865 AATCATTGAATGGACCTGAAAGG + Intergenic
1136938048 16:34493918-34493940 CATCATTGAATGGAACAGAATGG + Intergenic
1136940576 16:34572086-34572108 CATCATCGAATGGAATTGGGTGG + Intergenic
1136940590 16:34572305-34572327 CATCATGGAATGGAATTGAAAGG + Intergenic
1136940662 16:34573168-34573190 CATCATCGAATGGAATTGAATGG + Intergenic
1136940733 16:34574072-34574094 CATCATAGAATGGAATTGAAAGG + Intergenic
1136940776 16:34574642-34574664 CATCATCGAATGGAATTGAATGG + Intergenic
1136940860 16:34575714-34575736 CATCATAGAATGGAATTGAAAGG + Intergenic
1136941027 16:34581925-34581947 CATCATGGAATGGAAAGGAATGG + Intergenic
1136941099 16:34582975-34582997 CATCATCGAATGGAGTCGAATGG + Intergenic
1136941206 16:34584759-34584781 CATCATCGAATGGATTTGAATGG + Intergenic
1136941297 16:34585963-34585985 CATCATCGAATGGAATTGAAAGG + Intergenic
1136941321 16:34586312-34586334 CATCATTGAATGGAGTCGAATGG + Intergenic
1136941354 16:34586722-34586744 CATCATCGAATGGAATTGAATGG + Intergenic
1136941511 16:34588780-34588802 CATCATCGAATGGAATTGAATGG + Intergenic
1136941518 16:34588881-34588903 CATCATCGAATGGAATTGAATGG + Intergenic
1136941536 16:34589128-34589150 CATCATCGAATGGAATTGAACGG - Intergenic
1136941639 16:34590424-34590446 CATCATCGAATGGAATTGAATGG - Intergenic
1136941810 16:34592593-34592615 CATCATCGAATGGAACTGAATGG - Intergenic
1136941872 16:34593406-34593428 CATCATCGAATGGAACAGAATGG - Intergenic
1136942089 16:34596111-34596133 CATCATCGAATGGAATTGAATGG - Intergenic
1136942114 16:34596456-34596478 CATCATCGAATGGAATTGAATGG - Intergenic
1136942137 16:34596781-34596803 CATCATAGAATGGAATTGAATGG - Intergenic
1136942199 16:34597558-34597580 CATCATGGTATGGAATCGGATGG - Intergenic
1136942205 16:34597607-34597629 CATCATCGAATGGAATTGAATGG - Intergenic
1136942223 16:34597852-34597874 CATCATAGAATGGAATTGAATGG - Intergenic
1136942332 16:34599357-34599379 CATCATCGAATGGAATTGAATGG - Intergenic
1136942383 16:34599940-34599962 CATCATTGAATGGAACCGAATGG - Intergenic
1136942418 16:34600329-34600351 CATCATGGAAAGGAATTGAATGG - Intergenic
1136942425 16:34600427-34600449 CATCATCGAATGGAACTGAATGG - Intergenic
1136942742 16:34604832-34604854 CATCATTGAATGGAATTGAATGG - Intergenic
1136942808 16:34605656-34605678 CATCATGGAATGGAATCGAATGG - Intergenic
1136942894 16:34606738-34606760 CATCATGGAATGGAATCGAATGG - Intergenic
1136942943 16:34607358-34607380 CATCATTGAATGGAGTCGAATGG - Intergenic
1136942987 16:34607990-34608012 CATCATCGAATGGAATTGAATGG - Intergenic
1136942997 16:34608140-34608162 CATCATCGAATGGAATTGAATGG - Intergenic
1136943003 16:34608218-34608240 CATCATCGAATGGAATTGAATGG - Intergenic
1136943019 16:34608420-34608442 CATCATTGAATGGAATCGGACGG - Intergenic
1136943043 16:34608760-34608782 CATCATTGAATGGAATTGAATGG - Intergenic
1136943082 16:34609239-34609261 CATCATCGAATGGAAATGAATGG - Intergenic
1136943162 16:34610285-34610307 CATCACGGAATGGAATTGAATGG - Intergenic
1136943191 16:34610633-34610655 CATCATGGAATGGAATCGAATGG - Intergenic
1136943274 16:34611781-34611803 CATCACTGAATGGAACTGAATGG - Intergenic
1136944164 16:34626731-34626753 CATCATAGAATGGAATTGAATGG - Intergenic
1136944376 16:34629643-34629665 CATCATCAAATGGAATTGGATGG - Intergenic
1136944411 16:34630062-34630084 CATCATTGAATGGAATTGAATGG - Intergenic
1136944428 16:34630258-34630280 CATCATTGAATGGAATTGAAAGG - Intergenic
1136944520 16:34631461-34631483 CATCATTGAATGGAATTGAATGG - Intergenic
1136946465 16:34657604-34657626 CATCATTGAATGGAATCGGATGG - Intergenic
1136946581 16:34659162-34659184 AATCATTGAATGGAGTTGAATGG - Intergenic
1136946596 16:34659355-34659377 CATCATTGAATGGAATTGAATGG - Intergenic
1136946651 16:34659969-34659991 AATCATGGAATGGATTTGGATGG - Intergenic
1136946688 16:34660315-34660337 CATCATCGAATGGAATTGAATGG - Intergenic
1136946938 16:34663674-34663696 CATCATTGAATGGAATTGAATGG - Intergenic
1136947125 16:34666046-34666068 CATCATCGAATGGAGCCTAATGG - Intergenic
1136947135 16:34666190-34666212 CATCATCGAATGGAATTGAATGG - Intergenic
1136947157 16:34666479-34666501 CATCATCAAATGGAGCCGAATGG - Intergenic
1136947213 16:34667283-34667305 CATCATCGAATGGAATTGAATGG - Intergenic
1136949327 16:34696296-34696318 CATCATCGAATGGAATTGAATGG - Intergenic
1136949425 16:34697590-34697612 CATCATCGAATGGAATTGAATGG - Intergenic
1136949447 16:34697914-34697936 CATCATGGAATGGAATCGAATGG - Intergenic
1136949452 16:34697966-34697988 CATCATCGAATGGAAATGAAAGG - Intergenic
1136949486 16:34698481-34698503 CATCATTGAATGGAACCGAAAGG - Intergenic
1136949488 16:34698507-34698529 CATCATCGAATGGAACTGAATGG - Intergenic
1136949518 16:34698954-34698976 CATCATAGAATGGAATTGAATGG - Intergenic
1136949672 16:34700969-34700991 CATCATCGAATGGAATTGAATGG - Intergenic
1136949730 16:34701767-34701789 AATCATCGAATGGAGTTGAATGG - Intergenic
1136949928 16:34704305-34704327 CATCATTGAATGGAATTGAAGGG - Intergenic
1136949955 16:34704596-34704618 AATCATCGAATGGACTTGGAGGG - Intergenic
1136949987 16:34705004-34705026 CATCATAGAATGGAATTGAATGG - Intergenic
1136950188 16:34707852-34707874 CATCATTGAATGGAATTGAATGG - Intergenic
1136950303 16:34709482-34709504 CATCATCAAATGGAATTGGATGG - Intergenic
1136950386 16:34710538-34710560 CATCATCAAATGGAATTGGATGG - Intergenic
1136950438 16:34711206-34711228 AATCATGGAATGGACTTGAATGG - Intergenic
1136950510 16:34712104-34712126 CATCATCGAATGGAATTGAAAGG - Intergenic
1136950621 16:34713591-34713613 CATCATCGAATGGAGTTGAATGG - Intergenic
1136950704 16:34714725-34714747 CATCATTGAATGGATTTGAATGG - Intergenic
1136950792 16:34715786-34715808 CATCATTGAATGGAATTGAATGG - Intergenic
1136950880 16:34717112-34717134 CATCATTGAATGGAATTGAATGG - Intergenic
1136950952 16:34717980-34718002 CATCATCGAATGGAATTGAAAGG - Intergenic
1136951055 16:34719376-34719398 CATCATAGAATGGAATTGAATGG - Intergenic
1136951115 16:34720130-34720152 CATCATCGAATGGAACTGAAAGG - Intergenic
1136951280 16:34722307-34722329 CATCATTGAATGGAATTGAATGG - Intergenic
1136951457 16:34724711-34724733 CATCATCGAATGGAGTTGAGTGG - Intergenic
1136951468 16:34724858-34724880 CATCATCGAATGGAATTGAATGG - Intergenic
1136951509 16:34725411-34725433 CATCATTGAATGGATTTGAATGG - Intergenic
1136951586 16:34726392-34726414 CATCATGGAATGGAATTGAATGG - Intergenic
1136951660 16:34727310-34727332 CATCATTGAATGGACTTGAATGG - Intergenic
1136951771 16:34728780-34728802 CATCATTGAATGGAACTGAATGG - Intergenic
1136952048 16:34733079-34733101 CATCATAGAATGGAATTGAATGG - Intergenic
1136952074 16:34733423-34733445 CATCATCGAATGGAACTGCATGG - Intergenic
1136952316 16:34736666-34736688 CATCATCGAATGGAATTGAATGG - Intergenic
1136952448 16:34738259-34738281 CATCATCGAATGGAATTGAAAGG - Intergenic
1136952633 16:34740620-34740642 CATCATTGAATGGATTTGAATGG - Intergenic
1136952692 16:34741271-34741293 CATCATCGAATGGAATTGAAAGG - Intergenic
1136952816 16:34742874-34742896 CATCATGGAATGGAATTGAGTGG - Intergenic
1136952827 16:34742997-34743019 CATCATGGAATGGAATCGAAGGG - Intergenic
1136953030 16:34745539-34745561 AATCATCGAATGGACCTGAATGG - Intergenic
1136953208 16:34747795-34747817 AATCATGGAATGGACTTGAATGG - Intergenic
1136953273 16:34748631-34748653 CATCATAGAATGGAATTGAATGG - Intergenic
1136953473 16:34751277-34751299 CATCATTGAATGGAACCGAATGG - Intergenic
1136953510 16:34751753-34751775 CATCATAGAATGGAATTGAATGG - Intergenic
1136953568 16:34752594-34752616 CATCATCGAATGGAATTGAAAGG - Intergenic
1136953828 16:34756253-34756275 CATCATTGAATGGAATTGAATGG - Intergenic
1136953902 16:34757222-34757244 CATCATCGAATGGAACTGAGTGG - Intergenic
1136953942 16:34757773-34757795 CATCATCGAATGGAATTGAATGG - Intergenic
1136954003 16:34758566-34758588 CATCATGGAATGGAATTGAGTGG - Intergenic
1136954025 16:34758836-34758858 CATCATCGAATGGAATTGAATGG - Intergenic
1136954029 16:34758888-34758910 CATCATTGAATGGAATTGAATGG - Intergenic
1136954262 16:34762022-34762044 AATCATCGAATGGACCTGAATGG - Intergenic
1136954272 16:34762192-34762214 CATCATCGAATGGAATTGAATGG - Intergenic
1136954353 16:34763274-34763296 CATCATCGAATGGAATTGAATGG - Intergenic
1136954361 16:34763378-34763400 AATCATGGAATGGAGTCGAATGG - Intergenic
1136954365 16:34763404-34763426 CATCATTGAATGGAACCGAATGG - Intergenic
1136954405 16:34763923-34763945 CATCATGGATTAGAATTGGATGG - Intergenic
1136954439 16:34764494-34764516 CATCATAGAATGGAATTGAATGG - Intergenic
1136954699 16:34767913-34767935 CATCATCGAATGGAGTCGAATGG - Intergenic
1136954764 16:34768880-34768902 CATCATGGAATGGAATCGAATGG - Intergenic
1136954769 16:34768929-34768951 CATCATCGAATGGACATGAATGG - Intergenic
1136954811 16:34769471-34769493 CATCATTGAATAGAGTTGAATGG - Intergenic
1136961771 16:34854639-34854661 CATCATTGAATGGAACAGAATGG - Intergenic
1136961778 16:34854714-34854736 AATCATTGAATGGACCTGAAAGG - Intergenic
1136961894 16:34856237-34856259 CATCATTGAATGGAACCGAAAGG - Intergenic
1136961914 16:34856465-34856487 CATCATCGAATGGAATTGAACGG - Intergenic
1136961992 16:34857662-34857684 CATCATTGAATGGAACAGAATGG - Intergenic
1136962008 16:34857916-34857938 CATCATCGAATGGAATTGAATGG - Intergenic
1136962078 16:34859005-34859027 CATCATTGAATGGAATTGAATGG - Intergenic
1136962084 16:34859054-34859076 CATCATCGAATGGAATTGAATGG - Intergenic
1136962112 16:34859468-34859490 CATCATCGAATGGAATTGAATGG - Intergenic
1136962129 16:34859654-34859676 CATCATCGAATGGAATTGAATGG - Intergenic
1136962181 16:34860369-34860391 CATCATCGAATGGAATTGAATGG - Intergenic
1136962200 16:34860621-34860643 CATCATAGAATGGAATTGAATGG - Intergenic
1136962218 16:34860920-34860942 AATCATGGAATGGACTTGAATGG - Intergenic
1136962222 16:34860966-34860988 CATCATCGAATGGAGTCGAATGG - Intergenic
1136962242 16:34861208-34861230 CATCATCAAATGGAATTGGATGG - Intergenic
1136962425 16:34863567-34863589 CATCATTGAATGGAATTGAATGG - Intergenic
1136962463 16:34864061-34864083 CATCATGGAATGGAATCGAATGG - Intergenic
1136962496 16:34864460-34864482 CATCATCGAATGGAATTGAATGG - Intergenic
1136962505 16:34864587-34864609 CATCATGGAATGGAGTCGAATGG - Intergenic
1136962535 16:34865002-34865024 CATCATGGAATGGAATCGAATGG - Intergenic
1136962567 16:34865452-34865474 CATCATGGAATGGAATCGAATGG - Intergenic
1136962636 16:34866400-34866422 CATCATCGAATGGAATTGAATGG - Intergenic
1136962649 16:34866570-34866592 CACCGTGGAATGGAGTTGAATGG - Intergenic
1136962674 16:34866867-34866889 TATCATGGAATGGAATTGAAAGG - Intergenic
1136964689 16:34893491-34893513 CATCATCGAATGGACTTGAATGG - Intergenic
1136964709 16:34893742-34893764 CATCATGGAATGGAATCGAATGG - Intergenic
1136964747 16:34894230-34894252 CATCATCGAATGGAATTGCATGG - Intergenic
1136964763 16:34894438-34894460 CATCATCGAATGGAATTGAATGG - Intergenic
1136964784 16:34894715-34894737 CATCATTGAATGGAATTGAATGG - Intergenic
1136964845 16:34895479-34895501 CATCATAGAATGGAATTGAATGG - Intergenic
1136965053 16:34898250-34898272 CATCATGTAATGGAACCGAATGG - Intergenic
1136965072 16:34898498-34898520 CATCATCGAATGGAATTGAAGGG - Intergenic
1136965138 16:34899318-34899340 CATCATGGAATGGAATCGAATGG - Intergenic
1136965146 16:34899416-34899438 CATCATTGAATGGAATTGAATGG - Intergenic
1136965282 16:34901280-34901302 CATCATTGAATGGAATTGAATGG - Intergenic
1136965293 16:34901401-34901423 CATCATGGAATGGAATCGAATGG - Intergenic
1136965409 16:34903129-34903151 CATCATCGAATGGAATTGAATGG - Intergenic
1136965425 16:34903363-34903385 CATCATTGAATGGAATTGAATGG - Intergenic
1136965461 16:34903908-34903930 CATCATTGAATGGAATTGAATGG - Intergenic
1136965477 16:34904078-34904100 CATCATCGAATGGAATTGAATGG - Intergenic
1136965495 16:34904343-34904365 CATCATAGAATGGAATTGAATGG - Intergenic
1136965505 16:34904518-34904540 CATCATCGAATGGAATTGAATGG - Intergenic
1136965535 16:34904929-34904951 CATCATTAAATGGAATTGGATGG - Intergenic
1136965713 16:34907337-34907359 CATCATTGAATGGAATTGAATGG - Intergenic
1136965795 16:34908499-34908521 CATCATCGAATGGAATTGAATGG - Intergenic
1136965806 16:34908643-34908665 CATCATCGAATGGACTTGAATGG - Intergenic
1136965822 16:34908868-34908890 CATCATCTAATGGAACTGAATGG - Intergenic
1136965829 16:34908946-34908968 CATCATTGAATGGAATTGAAAGG - Intergenic
1136965936 16:34910502-34910524 CATCATTGAATGGAACCGAATGG - Intergenic
1136966067 16:34912109-34912131 AATCATCGAATGGACCTGAATGG - Intergenic
1136966236 16:34914195-34914217 CATCATTGAATCGAACTGAATGG - Intergenic
1136966276 16:34914693-34914715 CATCATCGAATGGAATTGAAAGG - Intergenic
1136966304 16:34915061-34915083 CATCATTGAATGGAATTGAATGG - Intergenic
1136966312 16:34915136-34915158 CATCATCGAATGGAATAGGATGG - Intergenic
1136966325 16:34915309-34915331 CATCATCGAATGGATTTGAACGG - Intergenic
1136966398 16:34916274-34916296 CATCATGGAATGGAATTGAGTGG - Intergenic
1136966423 16:34916596-34916618 CATCATGGAATGGAATCGAATGG - Intergenic
1136966510 16:34917659-34917681 CATCATCGAATGGAATTGAAAGG - Intergenic
1136966565 16:34918322-34918344 CATCATTGAATGGAATTGAATGG - Intergenic
1136966589 16:34918642-34918664 CATCATCGAATGGAACTGAAAGG - Intergenic
1136966617 16:34919010-34919032 CATCATCGAATGGAATTGAATGG - Intergenic
1136966633 16:34919189-34919211 AATCATCGAATGGACCTGAATGG - Intergenic
1136966763 16:34920843-34920865 CATCATCGAATGGAATTGAATGG - Intergenic
1136968689 16:34946241-34946263 CATCATGGAATGGAATCGAATGG - Intergenic
1136968697 16:34946339-34946361 CATCATTGAATGGAATTGAATGG - Intergenic
1136968757 16:34947229-34947251 CATCATCGAATGGAATTGAATGG - Intergenic
1136968788 16:34947618-34947640 CATCATGGAATGGAATTGAACGG - Intergenic
1136968831 16:34948199-34948221 CATCATCGAATGGAATTGAATGG - Intergenic
1136968863 16:34948679-34948701 CATCATCGAATGGAATTGAAAGG - Intergenic
1136968922 16:34949619-34949641 CCTCATCGAATGGAACTGAATGG - Intergenic
1136968933 16:34949717-34949739 CATCATCGAATGGAATTGAATGG - Intergenic
1136968953 16:34949916-34949938 CATCATGGAATGGAATAGAATGG - Intergenic
1136968961 16:34950004-34950026 CATCATCGAATGGAATTGAAAGG - Intergenic
1136969044 16:34951136-34951158 CATCATAGAATGGAATTGAATGG - Intergenic
1136969183 16:34953020-34953042 CATCATCGAATGGAACCGAATGG - Intergenic
1136969280 16:34954253-34954275 CATCATCGAATGGAGTCGAATGG - Intergenic
1136969303 16:34954600-34954622 CATCATTGAATGGAATTGAATGG - Intergenic
1136969321 16:34954819-34954841 CATCATCGAATGGAATTGAATGG - Intergenic
1136969338 16:34955070-34955092 CATCATCGAATGGAATTGAATGG - Intergenic
1136969559 16:34958204-34958226 CATCATCGAATGGAATTGAATGG - Intergenic
1136969617 16:34958982-34959004 CATCATCGAATGGACTTGAATGG - Intergenic
1136969662 16:34959628-34959650 CATCATCGAATGGAATTGCATGG - Intergenic
1136969765 16:34960928-34960950 TATCATGGAATGGAATTGAAAGG - Intergenic
1136999403 16:35216189-35216211 CCTCATGGGATGGACATGGAAGG + Intergenic
1137003552 16:35251817-35251839 CCTCATGGGATGGACATGGAAGG - Intergenic
1137017846 16:35394273-35394295 CCTCATGGGATGGACATGGAAGG - Intergenic
1137032132 16:35533138-35533160 CCTCATGGGATGGACATGGAAGG - Intergenic
1137085806 16:36121759-36121781 CATCATGCAATGGACTTGAATGG + Intergenic
1137085812 16:36121837-36121859 CATCATTGAATGGAAGTGAATGG + Intergenic
1137085960 16:36123920-36123942 CATCATCGAATGGAATTGAATGG + Intergenic
1137085973 16:36124072-36124094 CATCATCGAATGGAATTGAATGG + Intergenic
1137085998 16:36124372-36124394 CATCATCGAATAGAACTGAAAGG + Intergenic
1137086058 16:36125182-36125204 CATCATCGAATGGAATTGAACGG + Intergenic
1137086188 16:36126768-36126790 AATCATCGAATGGAGTTGAATGG + Intergenic
1137086233 16:36127465-36127487 AATCATGGAATGGACTTGAATGG - Intergenic
1137086304 16:36128438-36128460 CATCATTGAATGGAATTGAATGG - Intergenic
1137086375 16:36129360-36129382 CATCATCGAATGGAATTGAATGG - Intergenic
1137086684 16:36133696-36133718 AATCATTGAATGGAGTTGAATGG - Intergenic
1137086782 16:36135075-36135097 AATCATCGAATGGAGTTGAATGG - Intergenic
1137086786 16:36135124-36135146 CATCATAGAATGGAATTGAATGG - Intergenic
1137086862 16:36136201-36136223 CATCATTGAATGGAATTGAATGG - Intergenic
1137086893 16:36136617-36136639 CATCATCGAATGGAATTGAATGG - Intergenic
1137086935 16:36137172-36137194 CATCATCGAATGGAGTTGAATGG - Intergenic
1137086980 16:36137844-36137866 CATCATGGAATTGAATTGAATGG - Intergenic
1137087028 16:36138608-36138630 CATCATCGAATGGAATTGAATGG - Intergenic
1137087064 16:36139026-36139048 TATCATGGAATGGAATTGAAAGG - Intergenic
1137087219 16:36140961-36140983 CATCATTGAATGGAATTGAATGG - Intergenic
1137087232 16:36141134-36141156 CATCATCGAATGGAATTGAAAGG - Intergenic
1137087295 16:36142128-36142150 CATCATTGAATGGAATTGAATGG - Intergenic
1137087318 16:36142443-36142465 CATCATCGAATGGAATTGAATGG - Intergenic
1137089174 16:36167003-36167025 CATCATAGAATGGAATTGAATGG - Intergenic
1137089236 16:36167752-36167774 CATCATGGAATGGAATGGAATGG - Intergenic
1137089250 16:36167899-36167921 CATCATCGAATGGAATTGAATGG - Intergenic
1137089425 16:36170128-36170150 CATCATGGAATGGAATTGAATGG - Intergenic
1137089530 16:36171557-36171579 AATCATCGAATGGACCTGAATGG - Intergenic
1137089561 16:36171942-36171964 CATCATTGAATGGAAATGAAAGG - Intergenic
1137089587 16:36172317-36172339 AATCATGGAATGGACTTGAATGG - Intergenic
1137089667 16:36173325-36173347 CATCGTGGAATGGACTTGAATGG - Intergenic
1137089827 16:36175444-36175466 CATCATCGAATGGAATTGAAAGG - Intergenic
1137089842 16:36175613-36175635 CATCATGGAATGGAATTGAAAGG - Intergenic
1137090060 16:36178408-36178430 CATCATCGAATGGAATTGAATGG - Intergenic
1137090123 16:36179154-36179176 CATCATCGAATGGAATTGAATGG - Intergenic
1137090132 16:36179232-36179254 CATCATCGAATGGAATTGAATGG - Intergenic
1137090138 16:36179310-36179332 CATTATGGAATGGAATTGAAAGG - Intergenic
1137090161 16:36179561-36179583 CATCATCGAATGGAATTGAATGG - Intergenic
1137090228 16:36180499-36180521 CATCATTGAATGGAATTGAATGG - Intergenic
1137090254 16:36180845-36180867 CATCATGGAATGGAATCGAATGG - Intergenic
1137090345 16:36182117-36182139 CATCATGGAATGGAATTGAGTGG - Intergenic
1137090424 16:36183250-36183272 AATCATTGAATGGAGTTGAAAGG - Intergenic
1137090485 16:36184041-36184063 CATCATCAAATGGAATTGGATGG - Intergenic
1137090498 16:36184185-36184207 CATCATTGAATGGACTTGAATGG - Intergenic
1137090513 16:36184358-36184380 CATCATCGAATGGAATTGAAAGG - Intergenic
1137090542 16:36184732-36184754 CATCATGGAATGGATTTGAAAGG - Intergenic
1137090576 16:36185124-36185146 CATCATCGAATGGAATTGAATGG - Intergenic
1137090663 16:36186332-36186354 CATCATCGAATGGAATTGAATGG - Intergenic
1137090988 16:36190511-36190533 CATCATTGAATGGAATTGAATGG - Intergenic
1137091081 16:36191720-36191742 CATCATGGAATGGAATCGAATGG - Intergenic
1137091321 16:36195051-36195073 CATCATGGAATGGAATCGAATGG - Intergenic
1137091361 16:36195508-36195530 CATCATCAAATGGAACTGAATGG - Intergenic
1137091377 16:36195654-36195676 CATCATCAAATGGAAATGGATGG - Intergenic
1137091468 16:36196806-36196828 CATCATCGAATGGAATTGAATGG - Intergenic
1137091498 16:36197276-36197298 CATCATGGAATGGAATCGAATGG - Intergenic
1137091536 16:36197691-36197713 CATCATCGAATGGAATTGAATGG - Intergenic
1137091580 16:36198331-36198353 CAACATGGAATGGAATTGAATGG - Intergenic
1137091583 16:36198357-36198379 AATCATTGAATGGAGTTGAATGG - Intergenic
1137091589 16:36198445-36198467 AATCATTGAACGGAGTTGGATGG - Intergenic
1137091603 16:36198638-36198660 CATCATGGAATGGAAGCGAATGG - Intergenic
1137091634 16:36198971-36198993 CATCATCGAATGGAATTGAATGG - Intergenic
1137091815 16:36201286-36201308 CATCATCGAATGGAATTGAATGG - Intergenic
1137091827 16:36201485-36201507 CATCATTGAATGGAATTGAATGG - Intergenic
1137093711 16:36226251-36226273 CATCATAGAATGGAATTGAATGG - Intergenic
1137093792 16:36227382-36227404 CATCATAGAATGGAATTGAATGG - Intergenic
1137093866 16:36228480-36228502 CATCATTGAATGAAGTTGAATGG - Intergenic
1137093929 16:36229255-36229277 CATCATCGAATGGAATTGAATGG - Intergenic
1137094180 16:36232600-36232622 CATCATGAAATGGAAATGAATGG - Intergenic
1137094252 16:36233426-36233448 CATCATTGAATGGAATTGAAGGG - Intergenic
1137094302 16:36234092-36234114 CATCATAGAATGGAATTGAATGG - Intergenic
1137094349 16:36234647-36234669 CATCATCGAATGGAATTGAATGG - Intergenic
1137094456 16:36236124-36236146 CCTCATCGAATGGAACTGAATGG - Intergenic
1137094582 16:36237843-36237865 CATCATGGAATTGAATTGAAAGG - Intergenic
1137094620 16:36238417-36238439 CATCATTGAATGGAATTGAATGG - Intergenic
1137094675 16:36239076-36239098 CACCATCGAATGGAGTTGAATGG - Intergenic
1137095003 16:36243293-36243315 AATCATCGAATGGAGTTGAATGG - Intergenic
1137095158 16:36245462-36245484 CATCATCGAATGGAATTGAAAGG - Intergenic
1137095164 16:36245534-36245556 CATCATCGAATGGAATTGAAAGG - Intergenic
1137095168 16:36245583-36245605 CATCATTGAATGGAATTGAATGG - Intergenic
1137095207 16:36246123-36246145 CATCATCGAATGGAATTGAAAGG - Intergenic
1137095267 16:36246912-36246934 AATCATGGAATGGAACTGAATGG - Intergenic
1137095336 16:36247774-36247796 CATCATCGAATGGAATTGAATGG - Intergenic
1137095496 16:36249932-36249954 CATCATCAAATGGAACTGAATGG - Intergenic
1137095567 16:36250871-36250893 CATCATTGAATGGATTTGAATGG - Intergenic
1137215222 16:46381363-46381385 CATCATGGAATGGAATCGAATGG - Intergenic
1137215361 16:46383265-46383287 CATCATCGAATGGAATTGAATGG + Intergenic
1137215394 16:46383731-46383753 CATCATCGAATGGAGTCGAATGG + Intergenic
1137215457 16:46384447-46384469 CATCATGGAATGGAATCGAACGG + Intergenic
1137215527 16:46385251-46385273 CATCATCGAATGGAATTGAATGG + Intergenic
1137215548 16:46385473-46385495 CATCATGTAATGGAGTCGAATGG + Intergenic
1137215609 16:46386326-46386348 CATCATAGAATGGAATTGAAAGG + Intergenic
1137215626 16:46386548-46386570 CATCATCGAATGGAATTGAACGG + Intergenic
1137215820 16:46389113-46389135 CATCATCGAATGGAGTCGAATGG + Intergenic
1137215915 16:46390326-46390348 CATCATCGAATGGAATTGAATGG + Intergenic
1137216085 16:46392586-46392608 CATCATCGAATGGAATTGAATGG + Intergenic
1137216094 16:46392668-46392690 AATCATCGAATGGACTTGGATGG + Intergenic
1137216120 16:46393052-46393074 CATCATCGAATGGAGTCGAATGG + Intergenic
1137216164 16:46393562-46393584 CATCATCCAATGGAATTGGATGG + Intergenic
1137216183 16:46393836-46393858 CATCATCGAATGGATTTGAATGG + Intergenic
1137216285 16:46395234-46395256 CATCATCGAATGGAACTGAATGG + Intergenic
1137216382 16:46396507-46396529 CATCATGGAATGGAATCGAACGG + Intergenic
1137216451 16:46397311-46397333 CATCATCGAATGGAATTGAATGG + Intergenic
1137216537 16:46398386-46398408 CATCATAGAATGGAATTGAAAGG + Intergenic
1137216554 16:46398608-46398630 CATCATCGAATGGAATTGAACGG + Intergenic
1137216751 16:46401158-46401180 CATCATCGAATGGAGTTGAATGG + Intergenic
1137216952 16:46403621-46403643 CATCATCGAATGGAATTGAATGG + Intergenic
1137216973 16:46403889-46403911 AATCATGGAATGGACTTGAATGG + Intergenic
1137217000 16:46404267-46404289 CATCATCGAATGGAATTGAAGGG + Intergenic
1137217029 16:46404652-46404674 AATCATCGAATGGACCTGAATGG + Intergenic
1137217111 16:46405687-46405709 CATCATCAAATGGAATTGGATGG + Intergenic
1137217176 16:46406588-46406610 CATTATGGAATGGAGTCGAATGG + Intergenic
1137217277 16:46408119-46408141 CATCATCGAATGGAATTGAATGG + Intergenic
1137217294 16:46408338-46408360 CATCATTGAATGGAATTGAATGG + Intergenic
1137217382 16:46409485-46409507 CATCATAGAATGGAATTGAATGG + Intergenic
1137217405 16:46409850-46409872 AATCATCGAATGGAACTGAATGG + Intergenic
1137217407 16:46409876-46409898 CATCATCGAATGGAAATGAAAGG + Intergenic
1137217538 16:46411740-46411762 CATCATAGAATGGAATTGAATGG + Intergenic
1137217608 16:46412609-46412631 CATCATGGAATGGAATTGAACGG + Intergenic
1137217636 16:46413000-46413022 CATCATCGAATGGAATTGAATGG + Intergenic
1137217711 16:46413998-46414020 CATCATGGAATGGAATTCAATGG + Intergenic
1137217890 16:46416488-46416510 AATCATCGAATGGAGCCGAATGG + Intergenic
1137218000 16:46417971-46417993 AATCATCGAATGGACTTGGATGG + Intergenic
1137218032 16:46418334-46418356 CATCATCGAATGGTGTTGAATGG + Intergenic
1137218226 16:46420805-46420827 CATCATAGAATGGAATTGAATGG + Intergenic
1137218350 16:46422486-46422508 CATCATAGAATGGAATTGAATGG + Intergenic
1137218355 16:46422535-46422557 CATCATTGAATGGAATCGGATGG + Intergenic
1137222067 16:46464877-46464899 CATCATTGAATGGAATTGAATGG + Intergenic
1137222162 16:46466185-46466207 CATCATCGAATGGAATTGAAAGG + Intergenic
1137314260 16:47299828-47299850 CATCCTGGAATTGGGCTGGGAGG - Intronic
1137596243 16:49725898-49725920 GATCAGGGAACGGAGCTGAAGGG + Intronic
1138087292 16:54144419-54144441 CATAATGGAATGTAACTTGAAGG + Intergenic
1138956187 16:61973054-61973076 CAACATGGATTGGAGTTGCAGGG + Intronic
1141415955 16:83874838-83874860 CATCATGGCAGGGAGTTAGAAGG + Intergenic
1142687458 17:1585959-1585981 CATCATGGACTGGAGGCTGAAGG - Exonic
1142868928 17:2808212-2808234 CATAATAGCATGGGGCTGGAGGG + Intronic
1145329806 17:21861896-21861918 CCTAATGGAATGGAGTTGAATGG + Intergenic
1145334852 17:21903637-21903659 TATAATGGAATGGAATTGGAGGG + Intergenic
1145336816 17:21920024-21920046 CAGAATGGAATGGAGTCGGATGG + Intergenic
1145337384 17:21924473-21924495 CAGAATGGAATGGAATTGGATGG + Intergenic
1145340587 17:21950938-21950960 CAGCATGGAATGGAATTGAATGG + Intergenic
1146940987 17:36844385-36844407 CTTCCTGGAATGGGGCTGAATGG - Intergenic
1147386345 17:40084551-40084573 CATTATGGAAAGGGGATGGAGGG + Intronic
1148204537 17:45771614-45771636 CATCCTCGGATGGAGCTGGCAGG + Intergenic
1150985926 17:70197122-70197144 CATGATTCTATGGAGCTGGAAGG - Intergenic
1152889021 17:82869577-82869599 CACTTTTGAATGGAGCTGGAAGG + Intronic
1203177807 17_KI270729v1_random:32345-32367 CATTATGGAATGGAACGGAATGG + Intergenic
1203181693 17_KI270729v1_random:62719-62741 CATCATTGAATGGAATTGAATGG - Intergenic
1203181764 17_KI270729v1_random:63731-63753 CATCATGAAATAGAACTGAATGG - Intergenic
1203181775 17_KI270729v1_random:63939-63961 CATCATGGAATGGAATCGAATGG - Intergenic
1203181792 17_KI270729v1_random:64137-64159 CATCATCGAATGGAATTGAATGG - Intergenic
1203181806 17_KI270729v1_random:64336-64358 CATCATTGAATGGAATTGAATGG - Intergenic
1203181846 17_KI270729v1_random:64849-64871 CATCATCGAATGGAATTGAATGG - Intergenic
1203181869 17_KI270729v1_random:65139-65161 CATCATGGAATGGAATCGAATGG - Intergenic
1203181927 17_KI270729v1_random:65851-65873 CATCATCGAATGGAATTGAATGG - Intergenic
1203181948 17_KI270729v1_random:66197-66219 CATCATCGAATGGAACAGAATGG - Intergenic
1203181973 17_KI270729v1_random:66572-66594 CATCATCGAATGGAATTGAATGG - Intergenic
1203182016 17_KI270729v1_random:67120-67142 CATCATTGAATGGAATTGAACGG - Intergenic
1203182023 17_KI270729v1_random:67195-67217 AATCATGGAATGGACTTGAATGG - Intergenic
1203182060 17_KI270729v1_random:67671-67693 CATCATCGAATGGAATTGAATGG - Intergenic
1203182068 17_KI270729v1_random:67775-67797 CATCATGCAATGGACTTGAATGG - Intergenic
1203182092 17_KI270729v1_random:68061-68083 CATCATGCAATGGACTTGAATGG - Intergenic
1203184255 17_KI270729v1_random:97615-97637 CATCATTGAATGGAATCGGATGG - Intergenic
1203184260 17_KI270729v1_random:97664-97686 CATCATAGAATGGAATTGAATGG - Intergenic
1203184575 17_KI270729v1_random:101794-101816 CATGATGGAATTGAACTGAATGG - Intergenic
1203184592 17_KI270729v1_random:102018-102040 CATGATGGAATTGAACTGAATGG - Intergenic
1203184650 17_KI270729v1_random:102889-102911 CATCATTGAATGGAATTGAATGG - Intergenic
1203184669 17_KI270729v1_random:103130-103152 CATCATTGAATGGAATTGAATGG - Intergenic
1203184696 17_KI270729v1_random:103480-103502 CATCATCGAATGGAGTAGAATGG - Intergenic
1203184798 17_KI270729v1_random:104743-104765 CATCATTGAATGGAGTAGAATGG - Intergenic
1203184815 17_KI270729v1_random:104988-105010 CATCATCGAATGGAATTGAATGG - Intergenic
1203184842 17_KI270729v1_random:105282-105304 CATCATCGAATGGAATTGAATGG - Intergenic
1203184904 17_KI270729v1_random:106068-106090 CATCTTCGAATGGAACTGAATGG - Intergenic
1203184918 17_KI270729v1_random:106271-106293 CATCATCGAATGGAAATGAATGG - Intergenic
1203184938 17_KI270729v1_random:106575-106597 AATCATTGAATGGAGTTGAAAGG - Intergenic
1203185146 17_KI270729v1_random:109278-109300 CATCATTGAATGGAATTGAATGG - Intergenic
1203185250 17_KI270729v1_random:110630-110652 CATCATTGAATGGAATTGAATGG - Intergenic
1203185315 17_KI270729v1_random:111573-111595 AATCATCGAATGGAGTTGAATGG - Intergenic
1203185407 17_KI270729v1_random:112742-112764 CATCATGGAATGGAATTGAATGG - Intergenic
1203185438 17_KI270729v1_random:113135-113157 CATCATCGAATGGAACCGAAAGG - Intergenic
1203185478 17_KI270729v1_random:113611-113633 CATCATAGAATGGAATTGAATGG - Intergenic
1203185533 17_KI270729v1_random:114368-114390 CATCATCGAATGGAATTGAAAGG - Intergenic
1203185539 17_KI270729v1_random:114440-114462 CATCATCGAATGGAATTGAAAGG - Intergenic
1203185542 17_KI270729v1_random:114489-114511 CATCATCGAATGGAATTGAATGG - Intergenic
1203185557 17_KI270729v1_random:114729-114751 CATCATCGAATGGAATTGAATGG - Intergenic
1203185581 17_KI270729v1_random:115008-115030 CATCATTGAATGGATTTGAACGG - Intergenic
1203185625 17_KI270729v1_random:115567-115589 CATCATCAAATGGAATTGGATGG - Intergenic
1203185698 17_KI270729v1_random:116508-116530 CATCATCGAATGGAACCGAATGG - Intergenic
1203185740 17_KI270729v1_random:117032-117054 CATCATCGAATGGAAATGAATGG - Intergenic
1203185744 17_KI270729v1_random:117081-117103 CATCATCGAATGGATTTGAATGG - Intergenic
1203185866 17_KI270729v1_random:118816-118838 CATCATCGAATGGAATTGAATGG - Intergenic
1203186242 17_KI270729v1_random:123734-123756 AATCATCGAATGGAGCAGAATGG - Intergenic
1203186282 17_KI270729v1_random:124239-124261 CATCATTGAATGGAATTGAATGG - Intergenic
1203186320 17_KI270729v1_random:124708-124730 CATCATCGAATGGAATTGAATGG - Intergenic
1203186342 17_KI270729v1_random:124998-125020 CATCATCGAATGGAATTGAAAGG - Intergenic
1203186359 17_KI270729v1_random:125203-125225 CATCATCGAATGGAGTCGAATGG - Intergenic
1203186366 17_KI270729v1_random:125301-125323 CATCATGGAATGGAATCGAATGG - Intergenic
1203186563 17_KI270729v1_random:127796-127818 CATCATCAAATGGAACTGAATGG - Intergenic
1203186688 17_KI270729v1_random:129461-129483 CATCATTGAATGGAATTGAAAGG - Intergenic
1203186712 17_KI270729v1_random:129775-129797 CATCATCGAATGGAATTGAAAGG - Intergenic
1203186866 17_KI270729v1_random:131930-131952 CATCATTGAATGGAGTCGAATGG - Intergenic
1203186902 17_KI270729v1_random:132325-132347 CATCATCGAATGGAATTGAATGG - Intergenic
1203186918 17_KI270729v1_random:132495-132517 CATCATTGAATGGAATTGAATGG - Intergenic
1203187353 17_KI270729v1_random:138192-138214 AATCATCGAATGGAGCCGAATGG - Intergenic
1203187355 17_KI270729v1_random:138215-138237 CATCATTGAATGGAGTAGAATGG - Intergenic
1203187573 17_KI270729v1_random:141087-141109 CATCATCGAATGGAATTGAATGG - Intergenic
1203187590 17_KI270729v1_random:141322-141344 CATCATAGAATGGAATTGAATGG - Intergenic
1203187665 17_KI270729v1_random:142338-142360 CATCATCGAATGGAATTGAATGG - Intergenic
1203187968 17_KI270729v1_random:146367-146389 CATCATGGAATGGAATTGAAAGG - Intergenic
1203188025 17_KI270729v1_random:147100-147122 CATCATCGAATGGAATTGAATGG - Intergenic
1203188130 17_KI270729v1_random:148480-148502 CATCGTCGAATGGAGTTGAATGG - Intergenic
1203188134 17_KI270729v1_random:148555-148577 AATCATCGAATGGAGTTGAATGG - Intergenic
1203188242 17_KI270729v1_random:149947-149969 CATCATGGAATGGAAATGAATGG - Intergenic
1203188276 17_KI270729v1_random:150347-150369 CATCATCGAATGGAACCGAAAGG - Intergenic
1203188297 17_KI270729v1_random:150627-150649 CATCATCGAATGGAATTGAATGG - Intergenic
1203188389 17_KI270729v1_random:151920-151942 CATCATTGAATGGAATTGAATGG - Intergenic
1203188444 17_KI270729v1_random:152658-152680 CATCATTGAATGGAATTGAATGG - Intergenic
1203188470 17_KI270729v1_random:152998-153020 CATCATCGAATGGAATTGAATGG - Intergenic
1203188499 17_KI270729v1_random:153445-153467 AATCATCGAATGGAGATGAATGG - Intergenic
1203188534 17_KI270729v1_random:153960-153982 AATCATTGAATGGAGTTGAATGG - Intergenic
1203188679 17_KI270729v1_random:155830-155852 CATCATCGAATGGAACCGAAAGG - Intergenic
1203188720 17_KI270729v1_random:156358-156380 CATCATAGAATGGAATTGAATGG - Intergenic
1203188776 17_KI270729v1_random:157145-157167 CATCATCGAATGGAATTGAATGG - Intergenic
1203188846 17_KI270729v1_random:158080-158102 CATCATCGAATGGAATTGAAAGG - Intergenic
1203188918 17_KI270729v1_random:159107-159129 CATCATCGAATGGAATTGAAAGG - Intergenic
1203189073 17_KI270729v1_random:161135-161157 CATCATTGAATGGAATTGAATGG - Intergenic
1203189093 17_KI270729v1_random:161408-161430 CATCATTGAATGGAATTGAAAGG - Intergenic
1203189141 17_KI270729v1_random:162071-162093 CATCATCGAATGGAATTGAATGG - Intergenic
1203189154 17_KI270729v1_random:162215-162237 GATCATGAAATGGAGTTGAAGGG - Intergenic
1203189233 17_KI270729v1_random:163265-163287 CATCATTGAATGGAATTGAATGG - Intergenic
1203189303 17_KI270729v1_random:164111-164133 CATCATTGAATGGACTTGAATGG - Intergenic
1203189311 17_KI270729v1_random:164235-164257 CATCATCGAATGGAAATGAATGG - Intergenic
1203189448 17_KI270729v1_random:166076-166098 CATCATCGAATGGAGTCGAATGG - Intergenic
1203189522 17_KI270729v1_random:166990-167012 CATCATGGAATGGAATCGAATGG - Intergenic
1203189553 17_KI270729v1_random:167376-167398 CATCATTGAATGGAATTGAAAGG - Intergenic
1203189568 17_KI270729v1_random:167581-167603 CATCATCGAATGGAGTCGAATGG - Intergenic
1203189755 17_KI270729v1_random:169922-169944 CATCATCAAATGGAACTGAATGG - Intergenic
1203189804 17_KI270729v1_random:170534-170556 CATCATGAAATGGAGTCGAATGG - Intergenic
1203190018 17_KI270729v1_random:173444-173466 CATCATCGAATGGAATTGAATGG - Intergenic
1203197810 17_KI270729v1_random:248281-248303 CAGAATGGAATGGAATTGGATGG + Intergenic
1203207415 17_KI270730v1_random:49035-49057 CAGAATGGAATGGAATTGGATGG + Intergenic
1153048053 18:874400-874422 CATCTGGGAATGCAGCTGGTAGG + Intergenic
1153602499 18:6795256-6795278 CAGCAAGGAAGAGAGCTGGAGGG + Intronic
1153642724 18:7170230-7170252 CATCATGGCATGGGGCAGGGGGG - Intergenic
1154428600 18:14291205-14291227 AATCATGGATTGGAGGTGGTTGG + Intergenic
1154430873 18:14307549-14307571 AATCATGGATTGGAGGTGGTCGG + Intergenic
1154433545 18:14326853-14326875 AATCATGGATTGGAGGTGGTTGG + Intergenic
1155026366 18:21944340-21944362 CATGATGGAAGGGAGCAGGGAGG - Intergenic
1155381648 18:25228968-25228990 GACCATGGAGTGGAGCTGGTGGG + Intronic
1156685899 18:39646009-39646031 CATCATGTAATACAACTGGAAGG - Intergenic
1157999172 18:52596109-52596131 CTTTATGGAATAGATCTGGAAGG + Intronic
1158238419 18:55347529-55347551 CATCATGCCATGGATCTGGCAGG - Intronic
1158286903 18:55893623-55893645 CATCATGGAGTAAAACTGGATGG - Intergenic
1158859067 18:61574393-61574415 CTTCACGAGATGGAGCTGGAAGG - Intergenic
1160130166 18:76218354-76218376 CCTCATGCACTGGAACTGGAAGG - Intergenic
1160314579 18:77829944-77829966 TAGCATGGGATGGAGCAGGAGGG + Intergenic
1160340390 18:78084398-78084420 CATCCTAGAAAGGATCTGGAGGG - Intergenic
1160810457 19:1010884-1010906 GATCATGGAATGCTGCGGGAGGG + Exonic
1161340297 19:3738227-3738249 GGTCATGGCATGGAGCTCGATGG - Intronic
1166203214 19:41252276-41252298 GATGATGGAGTGGAGGTGGAGGG + Intronic
1167007208 19:46783866-46783888 CAGCATGGAATGGGGTTGGGGGG + Intronic
1167812066 19:51841916-51841938 TATCATGAAATGGAGAGGGATGG + Intergenic
1202668131 1_KI270709v1_random:18074-18096 CATCATCGAATGGAATTGGATGG - Intergenic
1202668144 1_KI270709v1_random:18226-18248 CATCATCGAATGGAATTGAATGG - Intergenic
1202668269 1_KI270709v1_random:19940-19962 CATCATGCAATGGACTTGAATGG - Intergenic
925170624 2:1748176-1748198 CAGCAGGAGATGGAGCTGGAGGG - Intergenic
927351681 2:22124180-22124202 CATATTCGAAGGGAGCTGGAGGG + Intergenic
928331246 2:30359659-30359681 TCTCATGGAACGCAGCTGGAAGG + Intergenic
932794361 2:74681785-74681807 GATCATTGACTGGAGCTTGAGGG - Exonic
932850273 2:75177878-75177900 CGTCATGTTGTGGAGCTGGAGGG - Intronic
933270392 2:80226845-80226867 CATCCTGGAGATGAGCTGGAGGG - Intronic
934153342 2:89171308-89171330 CAGCAGGGAATGGAGCAGGCTGG + Intergenic
934189416 2:89773227-89773249 CATCATTGAATGGAAGTGAATGG - Intergenic
934189430 2:89773446-89773468 CATCATCGAATGGAATTGAATGG - Intergenic
934189480 2:89774152-89774174 CATCATTGAATGGAATTGAATGG - Intergenic
934189819 2:89778416-89778438 CATCATCGAATGGAATTGAAAGG - Intergenic
934189944 2:89780020-89780042 CATCATCGAATGGAATTGAATGG - Intergenic
934190051 2:89781301-89781323 CATCATAGAATGGATCCGAATGG - Intergenic
934190113 2:89782110-89782132 CATCATAGAATGGAATTGAATGG - Intergenic
934190176 2:89782922-89782944 CATCATCGAATGGAATTGAACGG - Intergenic
934190380 2:89785738-89785760 CATCATCGAATGGAATTGAATGG - Intergenic
934190614 2:89788793-89788815 CATCATCGAATGGAATTGAATGG - Intergenic
934190621 2:89788891-89788913 CATCATCGAATGGAATTGAATGG - Intergenic
934190723 2:89790317-89790339 CGTCATGGAATGGAATTGAATGG - Intergenic
934190765 2:89790882-89790904 CATCATAGAATGGAATTGAATGG - Intergenic
934190884 2:89792411-89792433 CATCATGGAATTGAAATGAATGG - Intergenic
934190950 2:89793311-89793333 CATCATCGAATGGAATTGAACGG - Intergenic
934191004 2:89794129-89794151 CATCATCGAATGGAATTGAATGG - Intergenic
934191008 2:89794178-89794200 CATCATTGAATGGAATTGAATGG - Intergenic
934191040 2:89794606-89794628 CATCATTGAATGGAATTGAATGG - Intergenic
934191072 2:89795021-89795043 CATCATTGCATGGAATTGGATGG - Intergenic
934191146 2:89795980-89796002 CATCATCGAATGGAATTGAAAGG - Intergenic
934191175 2:89796380-89796402 CATCATGGAATGGAATAGAATGG - Intergenic
934191313 2:89798329-89798351 AATCATTGAATGGATCTGAAAGG - Intergenic
934191371 2:89799037-89799059 CATCATCGAATGGAACCGAATGG - Intergenic
934191396 2:89799382-89799404 CATCATCGAATGGAATTGAATGG - Intergenic
934191422 2:89799685-89799707 CATCATCGAATGGAATTGAATGG - Intergenic
934191451 2:89800112-89800134 CATCATGGAATGGAATAGAATGG - Intergenic
934191559 2:89801506-89801528 CATCATGAAATGGATTTGAATGG - Intergenic
934191571 2:89801702-89801724 CATCATTGAATGGAATTGAATGG - Intergenic
934191627 2:89802452-89802474 CATCATTGAATGGACTTGAATGG - Intergenic
934191635 2:89802560-89802582 CATCATCGAATGGAATTGAATGG - Intergenic
934191746 2:89804094-89804116 CATCATCGAATGGAATTGAATGG + Intergenic
934191784 2:89804563-89804585 CATCATTGAATGGAATTGAATGG + Intergenic
934191938 2:89806620-89806642 CATCATCGAATGGAATTGAATGG + Intergenic
934191977 2:89807132-89807154 CATCATCGAATGGAATTGAATGG + Intergenic
934191995 2:89807393-89807415 CATCATAGAATGGAATTGAATGG + Intergenic
934192024 2:89807772-89807794 CATCATTGAATGGAATTGAAAGG + Intergenic
934192224 2:89809875-89809897 CATCATCGAATGGAATTGCATGG + Intergenic
934192227 2:89809901-89809923 CATCATGGAATGGAATCGAATGG + Intergenic
934192263 2:89810337-89810359 AATCATCGAATGGACCTGAATGG + Intergenic
934192819 2:89815225-89815247 CATAATGGAATCGAACAGGACGG - Intergenic
934213893 2:90010623-90010645 CAGCAGGGAATGGAGCAGGCTGG - Intergenic
934253066 2:90380153-90380175 CATCATCAAATGGAACTGAAAGG + Intergenic
934253157 2:90381250-90381272 CATCATCGAATGGAGTCGAATGG + Intergenic
934253214 2:90381942-90381964 CATCATGGAATGGAACCGGAAGG + Intergenic
934253454 2:90384871-90384893 TATCATGGAATGGAATTGAATGG + Intergenic
934253464 2:90384987-90385009 CATCATCGAATGGAACTGAATGG + Intergenic
934253474 2:90385085-90385107 CATCATGGAATGGAATTGAATGG + Intergenic
934253636 2:90387093-90387115 CATCATCGAATGGAGTCGAATGG + Intergenic
934253691 2:90387759-90387781 CATCATGGAATGGAACCGGAAGG + Intergenic
934253877 2:90390080-90390102 CATCATCGAATGGAGAAGAATGG + Intergenic
934253950 2:90390955-90390977 TATCATGGAATGGAATTGAATGG + Intergenic
934253959 2:90391071-90391093 CATCATCGAATGGAATTGAATGG + Intergenic
934253968 2:90391169-90391191 CATCATGGAATGGAATTGAATGG + Intergenic
934254049 2:90392253-90392275 CATCATGGAATGGAGTCTAATGG + Intergenic
934254195 2:90394085-90394107 CATCATGGAATGGAACCGGAAGG + Intergenic
934254484 2:90397595-90397617 TATCATGGAATGGAATTGAATGG + Intergenic
934254493 2:90397711-90397733 CATCATCGAATGGAATTGAATGG + Intergenic
934254502 2:90397809-90397831 CATCATGGAATGGAATTGAATGG + Intergenic
934254678 2:90400104-90400126 CATCATCGAATGGAGTCGAATGG + Intergenic
934254735 2:90400796-90400818 CATCATGGAATGGAACCGGAAGG + Intergenic
934254959 2:91403584-91403606 CATCATTGAATGGAATTGGATGG + Intergenic
934255082 2:91405296-91405318 CATCATCGAATGGAATTGAATGG + Intergenic
934255140 2:91406182-91406204 CATCATTGAATGGAATTGAATGG + Intergenic
934255170 2:91406605-91406627 CATCATGGAATAGAATTGAATGG + Intergenic
934255213 2:91407196-91407218 CATCATCGAATGGAATTGAATGG + Intergenic
934255240 2:91407541-91407563 CATCATCGAATGGAATTGAATGG + Intergenic
934255260 2:91407772-91407794 CATCATCGAATGGAATCGGATGG + Intergenic
934255370 2:91409289-91409311 CATCATCGAATGGAATTGAATGG + Intergenic
934255389 2:91409520-91409542 CATCATCGAATGGAATCGGATGG + Intergenic
934255629 2:91412525-91412547 CATCATTGAATGGAATTGAATGG + Intergenic
934255818 2:91415124-91415146 CATCATGGAATGGAATAGAATGG + Intergenic
934255825 2:91415219-91415241 CATCATCGAATGGAATTGAAAGG + Intergenic
934255895 2:91416054-91416076 CATCATGGAATGGAATCGAATGG - Intergenic
934255903 2:91416152-91416174 CATCATCGAATGGAATTGAATGG - Intergenic
934255946 2:91416743-91416765 CATCATGGAATAGAATTGAATGG - Intergenic
934255976 2:91417166-91417188 CATCATTGAATGGAATTGAATGG - Intergenic
934256034 2:91418052-91418074 CATCATCGAATGGAATTGAATGG - Intergenic
934256157 2:91419764-91419786 CATCATTGAATGGAATTGGATGG - Intergenic
934256383 2:91422854-91422876 CATCATCAAATGGAACTGAATGG - Intergenic
934256395 2:91423007-91423029 CATCATCGAATGGAATTGGATGG - Intergenic
934332265 2:92080357-92080379 CATCATCGAATGGAATTGAATGG - Intergenic
934332298 2:92080811-92080833 CATCATTGAATGGACTTGAATGG - Intergenic
934332388 2:92081934-92081956 CATCATCAAATGGAACTGAAAGG - Intergenic
934332447 2:92082599-92082621 CATCATGGAATTGAATTGAATGG - Intergenic
934332480 2:92083092-92083114 CATCATGGAATGGAATCGAATGG - Intergenic
934332561 2:92084102-92084124 CATCGTGGAATGGATTTGAATGG - Intergenic
934332572 2:92084243-92084265 CATCATCAAATGGAATTGGATGG - Intergenic
934546916 2:95225408-95225430 CATCATGGGATGATGCTGCAAGG - Intronic
935346591 2:102113773-102113795 CATCATGGGGAGGAGATGGATGG - Intronic
935425671 2:102916370-102916392 CATCAAGGAAGGGATCTGGTGGG - Intergenic
936249427 2:110856271-110856293 CAGGATGGGATGGAGCAGGATGG - Intronic
937742082 2:125367056-125367078 TGTCATGGAAGGGAGCTGGTGGG + Intergenic
939208566 2:139141040-139141062 CATCAAGGGATGAAGGTGGAGGG + Intergenic
940920207 2:159297523-159297545 CCTAACGAAATGGAGCTGGAAGG - Intergenic
941273583 2:163461462-163461484 CACTGTAGAATGGAGCTGGATGG - Intergenic
943516741 2:188898035-188898057 AATCATGAAATAGAGTTGGAAGG + Intergenic
944509494 2:200450814-200450836 CAAGCTGGAATGGAGCTGGGGGG + Intronic
944515325 2:200507462-200507484 CAGCATGGAATTGAGCTGCTAGG + Intronic
946212703 2:218160288-218160310 CTGCAGGGATTGGAGCTGGAAGG + Intergenic
946896089 2:224326013-224326035 AATCCTGGGCTGGAGCTGGATGG + Intergenic
1169358613 20:4928578-4928600 AATCATGGGATGGAGCTGCTGGG - Intronic
1169605320 20:7311393-7311415 CATCAGGGAATAGATGTGGAAGG + Intergenic
1170983610 20:21238275-21238297 CATCATGTACTTGAGCTGCAGGG + Intronic
1171919588 20:31087715-31087737 CATAATGGAATGGAGTTGAATGG + Intergenic
1171928086 20:31205874-31205896 CATAATGGAATGGAGTTGAATGG + Intergenic
1175670559 20:60899454-60899476 CACCATGGACTGGGGCTGGGAGG - Intergenic
1175758217 20:61543849-61543871 CCTGATGGAATGGAGCTGGCAGG + Intronic
1177889008 21:26782181-26782203 CATTATGAAATGGAACTGCATGG - Intergenic
1178371356 21:32030141-32030163 CTCGATGGAATGGACCTGGATGG - Intronic
1178417838 21:32418150-32418172 CATCATGAAATGCAGAGGGAAGG - Intronic
1179089243 21:38248831-38248853 CATCAGGGAATGCAGCTCCATGG - Intronic
1180083163 21:45495901-45495923 CATCATGGAATGGGCCAGGGAGG - Intronic
1180525863 22:16259726-16259748 CATCATTGAATGGAATTGAATGG - Intergenic
1180525979 22:16261268-16261290 CATCATCGAATGGAATTGAATGG - Intergenic
1180526035 22:16261915-16261937 CATCATCGAATGGAACCGAATGG - Intergenic
1180526037 22:16261941-16261963 CATCATCGCATGGAACTGAATGG - Intergenic
1180526056 22:16262172-16262194 CATCATCGAATGGAACTGAAAGG - Intergenic
1180526070 22:16262351-16262373 CATCATCGAATGGAATTGAATGG - Intergenic
1180526083 22:16262524-16262546 CATCATAGAATGGAATTGAATGG - Intergenic
1180526151 22:16263488-16263510 CATCATCGAATGGAATTGAATGG - Intergenic
1180526170 22:16263716-16263738 CATCATTGAATGGAATTGAATGG - Intergenic
1180526260 22:16264780-16264802 CATCATAGAATGGAATTGAATGG - Intergenic
1180526284 22:16265090-16265112 CATCATTGAATGGAATTGAATGG - Intergenic
1180526304 22:16265384-16265406 CATCATCGAATGGAATTGAAAGG - Intergenic
1180526346 22:16265975-16265997 CATCATTGAATGGAGTTGAATGG - Intergenic
1180526350 22:16266050-16266072 AATCATCGAATGGAGTTGAATGG - Intergenic
1180526514 22:16268158-16268180 CATCATGGAAAGGAATTGAAGGG - Intergenic
1180527301 22:16305737-16305759 CATCATCGAATGGAATTGAATGG - Intergenic
1180527463 22:16308477-16308499 CATCATCGAATGGAACCGAAAGG - Intergenic
1180527466 22:16308503-16308525 CATCATCGAATGGAACCGAATGG - Intergenic
1180527480 22:16308704-16308726 CATCATCGAATGGAATTGAATGG - Intergenic
1180527594 22:16310268-16310290 CATCATGGAATGGAATAGAATGG - Intergenic
1180527687 22:16311419-16311441 CATCATTGAATGGAATTGAATGG - Intergenic
1180527707 22:16311713-16311735 CATCATCGAATGGAATTGAAAGG - Intergenic
1180527737 22:16312147-16312169 CATCATTGAATGGAATTGAATGG - Intergenic
1180527865 22:16314354-16314376 CATCATCGAATGGAATTGAAAGG - Intergenic
1180527911 22:16315054-16315076 CATCATTGAATGGAATTGAATGG - Intergenic
1180527951 22:16315585-16315607 CATCATTGAATGGAAATGAATGG - Intergenic
1180527955 22:16315634-16315656 CATCATCGAATGGATTTGAATGG - Intergenic
1180528032 22:16316778-16316800 CATCATCGAATGGAATTGAATGG - Intergenic
1180528228 22:16319276-16319298 CATCATCGAATGGAACCGAATGG - Intergenic
1180528264 22:16319751-16319773 CATCATCGAATGCAGTTGAATGG - Intergenic
1180528316 22:16320537-16320559 CATCATCGAATGGAGTGGAAGGG - Intergenic
1180528353 22:16321077-16321099 CATCATTGAATGGAACTGAATGG - Intergenic
1180528384 22:16321452-16321474 CATCATCAAATGGAACTGAATGG - Intergenic
1180528397 22:16321599-16321621 CATCATCGAATGGAATTGAATGG - Intergenic
1180528553 22:16323618-16323640 CATCATAGAATGGAATTGAATGG - Intergenic
1180528555 22:16323644-16323666 CATCATCGAATGGAATTGAAGGG - Intergenic
1180528573 22:16323889-16323911 CATCATCGAATAGAGTTGAATGG - Intergenic
1180528760 22:16326243-16326265 CATCATCGAATGGAATTGAATGG - Intergenic
1180528835 22:16327233-16327255 CATCATCGAATGGAATTGAATGG - Intergenic
1180528899 22:16328117-16328139 CATCATCAAATGGAACTGAATGG - Intergenic
1180529066 22:16330313-16330335 CATCATGGAATGGACTCGAATGG - Intergenic
1180529069 22:16330339-16330361 CATCATGGAATGGACTCGAATGG - Intergenic
1180529153 22:16331336-16331358 CATCATCGAATGGAATTGAATGG - Intergenic
1180529210 22:16332046-16332068 AATCATTGAATGGAATTGGATGG - Intergenic
1180529258 22:16332683-16332705 CATCATCGAATGGAATTGAATGG - Intergenic
1180529463 22:16335405-16335427 CATCATCGAATGGAATTGAATGG - Intergenic
1180529479 22:16335607-16335629 CATCATTGAATGGAATTGAATGG - Intergenic
1180529516 22:16336102-16336124 AATCATGGAATGGAGTAGAATGG - Intergenic
1180529553 22:16336558-16336580 CATCATCGAATGGAATTGAATGG - Intergenic
1180529560 22:16336659-16336681 CATCATCGAATGGAATTGAATGG - Intergenic
1180529595 22:16337054-16337076 CATCATGGAATGGACTCGAATGG - Intergenic
1180529599 22:16337080-16337102 CATCATCGAATGGACTTGAATGG - Intergenic
1180529771 22:16339397-16339419 CATCATCGAATGGAAATGAATGG - Intergenic
1180529796 22:16339723-16339745 CATCATTGAATGGAATTGAATGG - Intergenic
1180529807 22:16339873-16339895 CATCATTGAATGGAGTCGAATGG - Intergenic
1180529831 22:16340195-16340217 AATCATCGAATGGAACTGAATGG - Intergenic
1180529929 22:16341476-16341498 CATCATCGAATGGAATTGAATGG - Intergenic
1180529972 22:16341966-16341988 CATCATCGAATGGAATTGAATGG - Intergenic
1180530019 22:16342627-16342649 CATCATCGAATGGAATTGAATGG - Intergenic
1180532744 22:16362608-16362630 CATCATCGAATGGAATTGAATGG + Intergenic
1180532761 22:16362828-16362850 CATCATCGAATGGAACTGAATGG + Intergenic
1180532796 22:16363266-16363288 CATCATTGAATGGAGTCGAATGG + Intergenic
1180532839 22:16363902-16363924 AATCATAGAATGGAATTGGAAGG + Intergenic
1180532874 22:16364349-16364371 AATCATGGAATGGAATTGAATGG + Intergenic
1180533005 22:16366061-16366083 CATCATCGAATGGAATTGAAAGG + Intergenic
1180533094 22:16367192-16367214 CATCATCGAATGGAGTTGAATGG + Intergenic
1180533564 22:16373064-16373086 CATCATCGAATGGAATTGAATGG + Intergenic
1180533587 22:16373357-16373379 CATCATCAAATGGAACTGAATGG + Intergenic
1180533592 22:16373429-16373451 CATCATTGAATGGATTTGAATGG + Intergenic
1180533639 22:16374075-16374097 CATCATCAAATGGAACTGAATGG + Intergenic
1180533775 22:16375813-16375835 CATCATTGAATGGAATTGAATGG + Intergenic
1180533785 22:16376004-16376026 CATCATTGAATGGAATTGAATGG + Intergenic
1180533808 22:16376399-16376421 CATCATCGAATGGATGTGAATGG + Intergenic
1180533844 22:16376880-16376902 AATCATGGAATGGAATTGAATGG + Intergenic
1180534077 22:16380109-16380131 CATCATCGAATGGAATTGAATGG + Intergenic
1180534106 22:16380513-16380535 CATCATCGAATGGAATTGAATGG + Intergenic
1180534170 22:16381339-16381361 CATCATAGAATGGAATTGAATGG + Intergenic
1180534183 22:16381466-16381488 CATCATGGAATGGAGTGGAATGG + Intergenic
1183697594 22:39432017-39432039 CAGCATGGAATGCAGCCAGAAGG - Intronic
1185022978 22:48391191-48391213 CACCATGGAGCGGAGATGGACGG + Intergenic
1203315460 22_KI270737v1_random:4330-4352 CATCATGGAATGGAGTGGAATGG - Intergenic
1203315473 22_KI270737v1_random:4457-4479 CATCATAGAATGGAATTGAATGG - Intergenic
1203315537 22_KI270737v1_random:5283-5305 CATCATCGAATGGAATTGAATGG - Intergenic
1203315566 22_KI270737v1_random:5687-5709 CATCATCGAATGGAATTGAATGG - Intergenic
1203315799 22_KI270737v1_random:8916-8938 AATCATGGAATGGAATTGAATGG - Intergenic
1203315835 22_KI270737v1_random:9397-9419 CATCATCGAATGGATGTGAATGG - Intergenic
1203315858 22_KI270737v1_random:9792-9814 CATCATTGAATGGAATTGAATGG - Intergenic
1203315868 22_KI270737v1_random:9983-10005 CATCATTGAATGGAATTGAATGG - Intergenic
1203316004 22_KI270737v1_random:11721-11743 CATCATCAAATGGAACTGAATGG - Intergenic
1203316051 22_KI270737v1_random:12367-12389 CATCATTGAATGGATTTGAATGG - Intergenic
1203316056 22_KI270737v1_random:12439-12461 CATCATCAAATGGAACTGAATGG - Intergenic
1203316079 22_KI270737v1_random:12732-12754 CATCATCGAATGGAATTGAATGG - Intergenic
1203316549 22_KI270737v1_random:18604-18626 CATCATCGAATGGAGTTGAATGG - Intergenic
1203316638 22_KI270737v1_random:19735-19757 CATCATCGAATGGAATTGAAAGG - Intergenic
1203316769 22_KI270737v1_random:21447-21469 AATCATGGAATGGAATTGAATGG - Intergenic
1203316804 22_KI270737v1_random:21894-21916 AATCATAGAATGGAATTGGAAGG - Intergenic
1203316847 22_KI270737v1_random:22530-22552 CATCATTGAATGGAGTCGAATGG - Intergenic
1203316882 22_KI270737v1_random:22968-22990 CATCATCGAATGGAACTGAATGG - Intergenic
1203316898 22_KI270737v1_random:23162-23184 CATCATCGAATGGAATTGAATGG - Intergenic
1203316900 22_KI270737v1_random:23188-23210 CATCATCGAATGGAATTGAATGG - Intergenic
1203319629 22_KI270737v1_random:43184-43206 CATCATCGAATGGAATTGAATGG + Intergenic
1203319676 22_KI270737v1_random:43845-43867 CATCATCGAATGGAATTGAATGG + Intergenic
1203319719 22_KI270737v1_random:44335-44357 CATCATCGAATGGAATTGAATGG + Intergenic
1203319817 22_KI270737v1_random:45616-45638 AATCATCGAATGGAACTGAATGG + Intergenic
1203319841 22_KI270737v1_random:45938-45960 CATCATTGAATGGAGTCGAATGG + Intergenic
1203319852 22_KI270737v1_random:46088-46110 CATCATTGAATGGAATTGAATGG + Intergenic
1203319877 22_KI270737v1_random:46414-46436 CATCATCGAATGGAAATGAATGG + Intergenic
1203320049 22_KI270737v1_random:48731-48753 CATCATCGAATGGACTTGAATGG + Intergenic
1203320053 22_KI270737v1_random:48757-48779 CATCATGGAATGGACTCGAATGG + Intergenic
1203320088 22_KI270737v1_random:49152-49174 CATCATCGAATGGAATTGAATGG + Intergenic
1203320095 22_KI270737v1_random:49253-49275 CATCATCGAATGGAATTGAATGG + Intergenic
1203320132 22_KI270737v1_random:49709-49731 AATCATGGAATGGAGTAGAATGG + Intergenic
1203320169 22_KI270737v1_random:50204-50226 CATCATTGAATGGAATTGAATGG + Intergenic
1203320185 22_KI270737v1_random:50406-50428 CATCATCGAATGGAATTGAATGG + Intergenic
1203320390 22_KI270737v1_random:53128-53150 CATCATCGAATGGAATTGAATGG + Intergenic
1203320438 22_KI270737v1_random:53765-53787 AATCATTGAATGGAATTGGATGG + Intergenic
1203320495 22_KI270737v1_random:54475-54497 CATCATCGAATGGAATTGAATGG + Intergenic
1203320579 22_KI270737v1_random:55472-55494 CATCATGGAATGGACTCGAATGG + Intergenic
1203320582 22_KI270737v1_random:55498-55520 CATCATGGAATGGACTCGAATGG + Intergenic
1203320886 22_KI270737v1_random:59490-59512 CATCATCGAATGGAATCGGATGG + Intergenic
1203320921 22_KI270737v1_random:59898-59920 CATCATTGAATGGACTTGAATGG + Intergenic
1203320994 22_KI270737v1_random:60862-60884 CATCATCGAATGGAATTGAATGG + Intergenic
1203321181 22_KI270737v1_random:63205-63227 CATCATCGAATAGAGTTGAATGG + Intergenic
1203321200 22_KI270737v1_random:63450-63472 CATCATCGAATGGAATTGAAGGG + Intergenic
1203321202 22_KI270737v1_random:63476-63498 CATCATAGAATGGAATTGAATGG + Intergenic
1203321370 22_KI270737v1_random:65642-65664 CATCATCAAATGGAACTGAATGG + Intergenic
1203321401 22_KI270737v1_random:66017-66039 CATCATTGAATGGAACTGAATGG + Intergenic
1203321438 22_KI270737v1_random:66557-66579 CATCATCGAATGGAGTGGAAGGG + Intergenic
1203321526 22_KI270737v1_random:67769-67791 CATCATCGAATGGAACCGAATGG + Intergenic
1203321725 22_KI270737v1_random:70293-70315 CATCATCGAATGGAATTGAATGG + Intergenic
1203321761 22_KI270737v1_random:70852-70874 CATCATCGAATGGAATTGAATGG + Intergenic
1203321805 22_KI270737v1_random:71489-71511 CATCATCGAATGGATTTGAATGG + Intergenic
1203321809 22_KI270737v1_random:71538-71560 CATCATTGAATGGAAATGAATGG + Intergenic
1203321850 22_KI270737v1_random:72064-72086 CATCATTGAATGGAATTGAATGG + Intergenic
1203321894 22_KI270737v1_random:72764-72786 CATCATCGAATGGAATTGAAAGG + Intergenic
1203322063 22_KI270737v1_random:74976-74998 CATCATCGAATGGAATTGAATGG + Intergenic
1203322112 22_KI270737v1_random:75704-75726 CATCATTGAATGGAATTGAATGG + Intergenic
1203322199 22_KI270737v1_random:76685-76707 CATCATCGAATGGAATTGTATGG + Intergenic
1203322216 22_KI270737v1_random:76881-76903 CATCATGGAATGGAATAGAATGG + Intergenic
1203322337 22_KI270737v1_random:78471-78493 CATCATCGAATGGAACCGAAAGG + Intergenic
1203322360 22_KI270737v1_random:78773-78795 CATCATCGAATGGAACCGAATGG + Intergenic
1203322363 22_KI270737v1_random:78799-78821 CATCATCGAATGGAACCGAAAGG + Intergenic
1203322478 22_KI270737v1_random:80208-80230 AATCATCGAATGGACTTGGATGG + Intergenic
1203322569 22_KI270737v1_random:81907-81929 CATCATCGAATGGAATTGAATGG + Intergenic
1203326367 22_KI270738v1_random:25315-25337 CATCATCGAATGGAGTAGAAAGG + Intergenic
1203326387 22_KI270738v1_random:25559-25581 CATCATCGAATGGACATGAATGG + Intergenic
1203326466 22_KI270738v1_random:26547-26569 CATCATCGAATGGAACCGAAAGG + Intergenic
1203326699 22_KI270738v1_random:29559-29581 CATCATGGAATGGAATCGAATGG + Intergenic
1203326743 22_KI270738v1_random:30077-30099 CATCATGGAATGGAATTAAATGG + Intergenic
1203326834 22_KI270738v1_random:31376-31398 CATCATCGAATGGAATTGAATGG + Intergenic
1203326881 22_KI270738v1_random:31958-31980 CATCATCGAATGGAATTGAAAGG + Intergenic
1203326889 22_KI270738v1_random:32059-32081 CATCATCGAATGGAATTGAATGG + Intergenic
1203326930 22_KI270738v1_random:32691-32713 CATCATCGAATGGAATTGAATGG + Intergenic
1203326979 22_KI270738v1_random:33369-33391 CATCATTGAATGGAATTGAAAGG + Intergenic
1203327110 22_KI270738v1_random:35352-35374 CATCATCGAATGGAATTGAATGG + Intergenic
1203327195 22_KI270738v1_random:36395-36417 AATCATCGAATGGACCTGAATGG + Intergenic
1203327267 22_KI270738v1_random:37394-37416 CATCATCGAATGGAATTGAAAGG + Intergenic
1203327378 22_KI270738v1_random:38742-38764 CATCATGGAATGGAATTGAAAGG + Intergenic
1203327420 22_KI270738v1_random:39209-39231 CATCATCGAATGGAATTGAATGG + Intergenic
1203327502 22_KI270738v1_random:40302-40324 CATCATCGAATGGAATTGAATGG + Intergenic
1203327587 22_KI270738v1_random:41352-41374 CATCATTGAATGGAGTCGAATGG + Intergenic
1203327710 22_KI270738v1_random:43011-43033 CATCATTGAATGGAATTGAATGG + Intergenic
1203327783 22_KI270738v1_random:44012-44034 CATCATTGAATGGAGTAGAATGG + Intergenic
1203327810 22_KI270738v1_random:44325-44347 CATCATCGAATGGAATTGAATGG + Intergenic
1203327928 22_KI270738v1_random:46002-46024 CATCATTGAATGGAATTGAATGG + Intergenic
1203328041 22_KI270738v1_random:47608-47630 CATCATCGAATGGAATTGAATGG + Intergenic
1203328512 22_KI270738v1_random:53844-53866 CATCATCAAATGGAGCCGAATGG + Intergenic
1203328616 22_KI270738v1_random:55230-55252 CATCATCCAATGGAACTGAAAGG + Intergenic
1203328621 22_KI270738v1_random:55282-55304 CATCATCGAATGGAATTGCATGG + Intergenic
1203328642 22_KI270738v1_random:55507-55529 CATCATAGAATGGAATTGGATGG + Intergenic
1203328653 22_KI270738v1_random:55644-55666 CATCATCGAATGGAAATGAAAGG + Intergenic
1203328784 22_KI270738v1_random:57359-57381 CATCATCGAATGGAATTGAATGG + Intergenic
1203328906 22_KI270738v1_random:58894-58916 CATCATCGAATGGAATTGAACGG + Intergenic
1203328948 22_KI270738v1_random:59425-59447 CATCATAGAATGGAATTGAATGG + Intergenic
1203329010 22_KI270738v1_random:60242-60264 CATCATCGAATGGAACTGAATGG + Intergenic
1203329093 22_KI270738v1_random:61257-61279 CATCATTGAATGGAGTGGAATGG + Intergenic
1203329114 22_KI270738v1_random:61527-61549 CATCATCGAATGGAATTGAATGG + Intergenic
1203329126 22_KI270738v1_random:61674-61696 CATCATAGAATGGGACTGAATGG + Intergenic
1203329150 22_KI270738v1_random:61984-62006 CATCATTCAATGGAACTGAATGG + Intergenic
1203329188 22_KI270738v1_random:62485-62507 CATCATCGAATGGAGTGGAATGG + Intergenic
1203329296 22_KI270738v1_random:63871-63893 CATCATCGAATGGAACCGAATGG + Intergenic
1203329321 22_KI270738v1_random:64173-64195 CATCATTGAATGGACATGAATGG + Intergenic
1203329503 22_KI270738v1_random:66412-66434 CATCATCGAATGGAATTGAATGG + Intergenic
1203329579 22_KI270738v1_random:67447-67469 CATCATAGAATGGAATTGAATGG + Intergenic
1203329596 22_KI270738v1_random:67640-67662 CATCATTGAATGGAACTGATTGG + Intergenic
1203329803 22_KI270738v1_random:70536-70558 CATCATCGAATGGAATTGAATGG + Intergenic
1203329829 22_KI270738v1_random:70885-70907 CATCATTGAATGGAATTGAATGG + Intergenic
1203329857 22_KI270738v1_random:71296-71318 TATCATCGAATGGAGTTGAATGG + Intergenic
1203329941 22_KI270738v1_random:72234-72256 CATCATCGAATGGAATTGAATGG + Intergenic
1203329965 22_KI270738v1_random:72615-72637 CATCATAGAATGGAATTGAAAGG + Intergenic
1203329988 22_KI270738v1_random:72908-72930 CATCATCGAATGGAATTGAATGG + Intergenic
1203330075 22_KI270738v1_random:74124-74146 CATCATCGAATGGAATTGAATGG + Intergenic
1203330182 22_KI270738v1_random:75504-75526 CATCATGGAATGGAATCGAATGG + Intergenic
1203330189 22_KI270738v1_random:75605-75627 CATCATTGAATGGAATTGAATGG + Intergenic
1203330199 22_KI270738v1_random:75758-75780 CATCATCGAATGGAATTGAAAGG + Intergenic
1203330230 22_KI270738v1_random:76144-76166 CATCATGGAATGGAATCGAATGG + Intergenic
1203330236 22_KI270738v1_random:76196-76218 CATCATGGAATGGAATCGAATGG + Intergenic
1203330241 22_KI270738v1_random:76248-76270 CATCATGGAATGGAATTGAATGG + Intergenic
1203330246 22_KI270738v1_random:76300-76322 CATCATCGAATGGAATTGAATGG + Intergenic
1203330291 22_KI270738v1_random:76890-76912 CATCATCGAATGGAATTGAAAGG + Intergenic
1203330296 22_KI270738v1_random:76968-76990 CATCATCGAATGGAGTCGAATGG + Intergenic
1203330393 22_KI270738v1_random:78204-78226 CATCATCGAATGGAATTGAATGG + Intergenic
1203330417 22_KI270738v1_random:78542-78564 CATCATCGAATGGAATTGAATGG + Intergenic
1203330516 22_KI270738v1_random:79902-79924 CATCATGGAATGGAATTGAATGG + Intergenic
1203330574 22_KI270738v1_random:80627-80649 CATCATCGAATGGAATTGAATGG + Intergenic
1202726300 2_KI270716v1_random:2042-2064 CATCATGAAATGGAATTGAATGG - Intergenic
1202726402 2_KI270716v1_random:3295-3317 CATCATCGAATGGAATTGAATGG - Intergenic
1202726418 2_KI270716v1_random:3552-3574 CATCATTGAATGGAAGTGAATGG - Intergenic
1202726461 2_KI270716v1_random:4019-4041 AATCATGGAATGGACATGAATGG - Intergenic
1202726464 2_KI270716v1_random:4042-4064 CATCATCGAATGGAATTGAATGG - Intergenic
1202726505 2_KI270716v1_random:4472-4494 CATCATCGAATGGATATGAATGG - Intergenic
1202726546 2_KI270716v1_random:5106-5128 CATCATCGAATGGAATTGAATGG - Intergenic
1202726555 2_KI270716v1_random:5259-5281 CATCATTGAATGGAAATGAATGG - Intergenic
1202726647 2_KI270716v1_random:6476-6498 AATCATGGAATGGAATTGAATGG - Intergenic
1202726794 2_KI270716v1_random:8323-8345 CATCATCGAATGGAATTGAATGG - Intergenic
1202726866 2_KI270716v1_random:9207-9229 CATCATGGAATTGAATTGAATGG - Intergenic
1202726899 2_KI270716v1_random:9700-9722 CATCATGGAATGGAATCGAATGG - Intergenic
1202726980 2_KI270716v1_random:10710-10732 CATCGTGGAATGGATTTGAATGG - Intergenic
1202726991 2_KI270716v1_random:10851-10873 CATCATCAAATGGAATTGGATGG - Intergenic
949183198 3:1159370-1159392 CAGACTGGAATGGAGCAGGATGG + Intronic
950624619 3:14235793-14235815 CATCATGACATGGAGCTACAAGG + Intergenic
952199219 3:31108774-31108796 TAAAAAGGAATGGAGCTGGAGGG - Intergenic
952274060 3:31860088-31860110 CTTCATGTAAGGGAGCAGGAAGG - Intronic
959686891 3:109157351-109157373 CTTCATGAGATGGAGGTGGAGGG - Intergenic
959856268 3:111162318-111162340 CATCATGGGAAGGACCTGGTGGG + Intronic
961014774 3:123459073-123459095 CTTCAGGGAATGGAGGTGGTTGG + Intergenic
961123425 3:124394105-124394127 CATGATGTCATGGAGATGGAAGG + Intronic
961269235 3:125676009-125676031 CATCATGGAATGTGGCATGATGG + Intergenic
961860304 3:129911916-129911938 GAGCATGGACTGGAGGTGGATGG + Intergenic
962678751 3:137776936-137776958 CATAATGAAATGGGACTGGAAGG - Intergenic
963345689 3:144094527-144094549 CTTCATGGAATGGAGCTTCGAGG + Intergenic
965782946 3:172307129-172307151 TATCTTGAAATGGAGCTGGGTGG + Intronic
968833589 4:2946737-2946759 CATTATGGACTGGAGGTGGTGGG + Intronic
968940875 4:3636962-3636984 CATCATGGGGTGGTGATGGAAGG + Intergenic
973085046 4:46048357-46048379 CATAATGGAATAGAGAAGGAAGG + Intronic
973355213 4:49127821-49127843 CAGAATGGAATGGAGCGGAATGG - Intergenic
973355816 4:49131394-49131416 CAGAATGGAATGGAGCGGAATGG - Intergenic
973356521 4:49135643-49135665 CAGAATGGAATGGAGCGGAATGG - Intergenic
973357068 4:49138847-49138869 CAGAATGGAATGGAGCGGAATGG - Intergenic
973357490 4:49141286-49141308 CAGAATGGAATGGAGCGGAATGG - Intergenic
974630031 4:64477620-64477642 CATCATGAACTAGAGTTGGATGG - Intergenic
975949175 4:79747348-79747370 CAAAATGGAAAGGAGGTGGAAGG - Intergenic
976315781 4:83657441-83657463 AATCATGGAATGAGGGTGGATGG + Intergenic
977496852 4:97786652-97786674 TACCCTGGAATGGAGCAGGATGG - Intronic
978715219 4:111834091-111834113 TATCATGGAAGGGACCTGGTGGG + Intergenic
983677743 4:170316402-170316424 CATCTTGGAATGGACCAGGCTGG - Intergenic
983952637 4:173660869-173660891 CATCAAGGGAGGGACCTGGAGGG + Intergenic
984896832 4:184548727-184548749 CATCATTCCCTGGAGCTGGAGGG - Intergenic
984947363 4:184980179-184980201 CATCATGTAAGAGACCTGGATGG + Intergenic
986274010 5:6257781-6257803 GCTAATGGACTGGAGCTGGAGGG - Intergenic
987007481 5:13725115-13725137 CATCCTGGCATGGAGGTGGGGGG - Intronic
987596462 5:20006397-20006419 CTTTAGGGAATGGAGCTTGAAGG + Intronic
988523114 5:31963882-31963904 CATCATGGCATTGAGAAGGATGG - Intronic
990768673 5:59217719-59217741 AATCATGCAGTAGAGCTGGAAGG - Intronic
990977578 5:61573016-61573038 CATCATAGCACGGAGCTGCAGGG - Intergenic
992009041 5:72509097-72509119 CATGAGGGAATGGAGCAGGAAGG + Intergenic
992076685 5:73198551-73198573 TATCATGGAAGGGAGCGGGAGGG - Intergenic
994116645 5:96068471-96068493 CATGAATGGATGGAGCTGGAAGG - Intergenic
995572539 5:113495429-113495451 CAAGATGGGATGGAGATGGAGGG + Intergenic
995584996 5:113639513-113639535 TATCATGGGATGGACCTGGTGGG + Intergenic
999239436 5:150118950-150118972 AGCCATGGAAAGGAGCTGGAGGG + Intronic
999274359 5:150319163-150319185 CCTCCTGGAATGCAGCTGGAGGG - Intronic
999293665 5:150444374-150444396 CGTCATTGCCTGGAGCTGGATGG + Intronic
999533237 5:152486044-152486066 CATCATGGAATCAACCTAGATGG + Intergenic
1000275257 5:159728699-159728721 CAACATGGAATGGAGCTGGGTGG - Intergenic
1001194266 5:169657208-169657230 CAGAAGGTAATGGAGCTGGAGGG + Intronic
1002969746 6:2002631-2002653 TATTATGAAATGGAGCTGTATGG - Intronic
1003357471 6:5387095-5387117 CAGCATGGTCTGGGGCTGGAGGG + Intronic
1005927116 6:30453135-30453157 AATCAGGGAATGGAGATGGCAGG + Intergenic
1006133373 6:31881744-31881766 CATGATGGAAAGAAACTGGATGG + Intronic
1007479502 6:42141166-42141188 CACCATGGATAGGAGCAGGACGG - Intronic
1007594400 6:43042702-43042724 CATCATAGAATGGGAATGGAAGG + Intronic
1012813507 6:103990889-103990911 CCTCATTGAAAGGAACTGGAAGG + Intergenic
1013351484 6:109309957-109309979 CATCTAGGACTGGAGTTGGAAGG + Intergenic
1013986981 6:116206170-116206192 CATCATGGAATTGCCCTGCATGG - Intronic
1015118213 6:129672352-129672374 CATAAAGGGATGGAACTGGAAGG - Intronic
1016047589 6:139496592-139496614 CTTCAAGGAATGGATCTGGAAGG + Intergenic
1016202439 6:141429489-141429511 CATTATGGAAGGGACCTAGAGGG - Intergenic
1016384503 6:143517131-143517153 CATCAGAGAATGGAGCTGGGGGG + Intergenic
1016880458 6:148906094-148906116 CATCATGGAATCATGCTGGATGG - Intronic
1017387208 6:153900411-153900433 GATCATGGAATGGAGGAAGATGG + Intergenic
1018447851 6:163874658-163874680 CATCATGGGAGGGAGCTGGTGGG - Intergenic
1018680823 6:166263389-166263411 CTTCCTGGAATGGAGGTGGGAGG + Intergenic
1019894321 7:3971967-3971989 CATCGTGAAATGGAGGGGGAGGG + Intronic
1021721341 7:23507501-23507523 GCAAATGGAATGGAGCTGGATGG - Exonic
1022302681 7:29115791-29115813 TATAATAGAAAGGAGCTGGAGGG + Intronic
1022345753 7:29512738-29512760 CATCAGGGAAATGAGCTGAATGG + Exonic
1023254741 7:38301949-38301971 AATCATAAAATGGAGCTGAATGG - Intergenic
1023384027 7:39636950-39636972 CATCAGGGGATGGACCTGGTAGG - Intronic
1023425223 7:40028999-40029021 CATCATGGGTTTGAGCTGCATGG + Intronic
1024119724 7:46224505-46224527 CATCAAGGAATGCGTCTGGATGG + Intergenic
1025268426 7:57486547-57486569 CATCATGGAATGGACTCGAATGG + Intergenic
1025268442 7:57486704-57486726 AATCATGGAATGGAATTGAACGG + Intergenic
1025268448 7:57486779-57486801 CATCATCGAATGGAATTGAATGG + Intergenic
1025268617 7:57488336-57488358 CATCATTGAATGGACTTGAATGG + Intergenic
1025268625 7:57488434-57488456 CATCATGGAATGGAATCGAATGG + Intergenic
1025268868 7:57490303-57490325 CATCATGGAATGGAGTGGAGTGG + Intergenic
1025269148 7:57492771-57492793 AATCATGGAATGGAATTGAATGG + Intergenic
1025269352 7:57494835-57494857 AATCATCGAATGGAACTGAATGG + Intergenic
1025269459 7:57495723-57495745 CATCATCGAATGGAATTGAAGGG + Intergenic
1025316140 7:58032640-58032662 CATCATTGAATGGAACTGAATGG + Intergenic
1025316145 7:58032692-58032714 CATCATTGAATGGATTTGAATGG + Intergenic
1025316277 7:58034509-58034531 CATCATCGAATGGAATTGAATGG + Intergenic
1025316313 7:58035005-58035027 CATCATCGAATGGAATTGAATGG + Intergenic
1025316435 7:58036718-58036740 CATCATCGAATGGAATTGAATGG + Intergenic
1025316492 7:58037485-58037507 CATCATAGAATGGAATTGAATGG + Intergenic
1025316577 7:58038520-58038542 CATCATCGAATGGAACCGAAAGG + Intergenic
1025316625 7:58039217-58039239 CATCATGGAATGGAATCGAATGG + Intergenic
1025316630 7:58039292-58039314 CATCATCGAATGGAATTGAACGG + Intergenic
1025316798 7:58041449-58041471 CATCATCGAATGGAATTGAATGG + Intergenic
1025316812 7:58041619-58041641 CATCATTGAATGGAATTGAATGG + Intergenic
1025316892 7:58042643-58042665 CATCATCAAATGGAATTGGATGG + Intergenic
1025316933 7:58043123-58043145 CATCATCGAATGGAATTGAATGG + Intergenic
1025316940 7:58043195-58043217 CATCATCGAATGGAATTGAAGGG + Intergenic
1025317020 7:58044280-58044302 CATCATCGACTGGAGTTGAATGG + Intergenic
1025317085 7:58045096-58045118 CATCATGGAATGGAATTGAGTGG + Intergenic
1025317174 7:58046200-58046222 CATCATGGAATGGAATCGAATGG + Intergenic
1025317192 7:58046444-58046466 CATCATTGAATGGAATTGAATGG + Intergenic
1025317217 7:58046699-58046721 CATCATCGAATGGAATTGAATGG + Intergenic
1025317220 7:58046725-58046747 CATCATGGAATGGAATCGAATGG + Intergenic
1025317350 7:58048475-58048497 CATCATCGAATGGAATTGAATGG + Intergenic
1025317622 7:58051968-58051990 CATCATCGAATGGAATTGAATGG + Intergenic
1025317706 7:58052982-58053004 CATCATCGAATGGACTTGAATGG + Intergenic
1025317718 7:58053152-58053174 CATCATCGAATGGAATTGAACGG + Intergenic
1025317726 7:58053224-58053246 AATCATGGAATGGACTTGAATGG + Intergenic
1025317752 7:58053576-58053598 CATCATCGAATGGAATTGAAAGG + Intergenic
1025318023 7:58057314-58057336 CATCATCGAATGGAATTGAATGG - Intergenic
1025318049 7:58057683-58057705 CATCATTGAATGGAGTCGAATGG - Intergenic
1025318053 7:58057735-58057757 CATCATCGAATGGAGTCGAATGG - Intergenic
1025318075 7:58057995-58058017 AATCATGGAATGGAATTGAAAGG - Intergenic
1025318099 7:58058237-58058259 CATCATCGAATGGAATTGAATGG - Intergenic
1025318225 7:58060021-58060043 CATCATCGAATGGAATTGAATGG - Intergenic
1025318274 7:58060647-58060669 CATCATGGAATGGAATCGAATGG - Intergenic
1025318293 7:58060887-58060909 TATCATGGAATGGAATTGAATGG - Intergenic
1025318603 7:58064902-58064924 CATCATCGAATGGAATTGAATGG - Intergenic
1025318753 7:58066960-58066982 CATCATGCAATGGACTTGAATGG - Intergenic
1025318777 7:58067337-58067359 CATCATGCAATGGACTTGAATGG - Intergenic
1025322034 7:58105305-58105327 CATCATCGAATGGAATTGAATGG - Intergenic
1025322102 7:58106207-58106229 CATCATTGAATGGAAATGAATGG - Intergenic
1025322153 7:58106870-58106892 CATCATCGAATGGAATTGAATGG - Intergenic
1025322172 7:58107115-58107137 CATCATAGAATGGAATTGAATGG - Intergenic
1025322230 7:58107997-58108019 CATCATCGAATGGAATTGAATGG - Intergenic
1025322240 7:58108127-58108149 CATCATGGAATGCAAGTGAATGG - Intergenic
1025322248 7:58108225-58108247 CATCATGGAATGGAATGGAATGG - Intergenic
1025322262 7:58108372-58108394 CATCATCGAATGGAATTGAATGG - Intergenic
1025322413 7:58110453-58110475 CATCATCGAATGGAGTCGAATGG - Intergenic
1025322516 7:58111811-58111833 CATCATTGAATGGAATTGAATGG - Intergenic
1025322627 7:58113170-58113192 CATCATTGAATGGAATTGAAGGG - Intergenic
1025322686 7:58113957-58113979 CATCATAGAATGGAATTGAATGG - Intergenic
1025322780 7:58115179-58115201 CATCATTGAATGGAATTGAATGG - Intergenic
1025322927 7:58117381-58117403 CATCATCAAATGGAACTGAATGG - Intergenic
1025322948 7:58117648-58117670 CATCATTGAATGGAATTGAATGG - Intergenic
1025322998 7:58118350-58118372 CATCATTGAATGGAATTGAATGG - Intergenic
1025323016 7:58118615-58118637 CATCATAGAATGGAATTGAATGG - Intergenic
1025323051 7:58119107-58119129 AATCATGGAATGGAATTGAATGG - Intergenic
1025475139 7:60910143-60910165 CATCATAGAATGGAATTGAATGG - Intergenic
1025475270 7:60912033-60912055 AATCATTGAATGGAGTTGAAAGG - Intergenic
1025475377 7:60913468-60913490 CATCATCGAATGGAAATGAATGG - Intergenic
1025475441 7:60914342-60914364 CATCATAGAATGGAATTGAATGG - Intergenic
1025475481 7:60914891-60914913 CATCATCGAATGGAAATGAATGG - Intergenic
1025475561 7:60916051-60916073 CATCATTGAATGGAATTGAATGG - Intergenic
1025475586 7:60916417-60916439 CATCATCGAATGGAATTGAATGG - Intergenic
1025475612 7:60916854-60916876 AATCATCGAATGGAGATGAATGG - Intergenic
1025475871 7:60920323-60920345 CATCATGGAATGGAATCGAATGG - Intergenic
1025475982 7:60921783-60921805 CATCATGGAATAGAATTGGATGG - Intergenic
1025476043 7:60922622-60922644 CATCATTGAATGGAATTGAATGG - Intergenic
1025476082 7:60923161-60923183 CATCATCGAATGGAATTGAATGG - Intergenic
1025476139 7:60923858-60923880 AATCATGGAATGGAGTCGAATGG - Intergenic
1025476153 7:60924021-60924043 CATCATGGAATGCACTTGAATGG - Intergenic
1025476177 7:60924330-60924352 CATCATGGAATAGAATTGGATGG - Intergenic
1025476293 7:60925999-60926021 CATCATCGAATGGAATTGAATGG - Intergenic
1025476414 7:60927685-60927707 CATCTTTGAATGGAGTTGAATGG - Intergenic
1025476416 7:60927711-60927733 CATCATGGAATGGAATCGAATGG - Intergenic
1025476575 7:60929666-60929688 CATCATGGAATGGAATGGAAAGG - Intergenic
1025476581 7:60929718-60929740 CATCATGGAATGGAATCGAATGG - Intergenic
1025476599 7:60929958-60929980 TATCATGGAATGGAACTGAATGG - Intergenic
1025476655 7:60930713-60930735 CATCATCGAATGGAATTGAAAGG - Intergenic
1025476745 7:60931975-60931997 CATCATCGAATGGAAATGAATGG - Intergenic
1025476844 7:60933265-60933287 CATCATCGAATGGAATTGAATGG - Intergenic
1025476870 7:60933642-60933664 CATCATCGAATGGAATTGAATGG - Intergenic
1025476957 7:60934957-60934979 CATCATTGAATGGAATTGAAAGG - Intergenic
1025477010 7:60935649-60935671 CATCATCGAATGGAATTGAATGG - Intergenic
1025477028 7:60935822-60935844 CATCATCGAATGGAGTAGAATGG - Intergenic
1025477059 7:60936246-60936268 CATCATTGAATGGAATTGAAAGG - Intergenic
1025477124 7:60937059-60937081 CATCATCGAATGGAATTGAATGG - Intergenic
1025477178 7:60937775-60937797 CATCATCGAATAGAACTGAAAGG - Intergenic
1025477179 7:60937801-60937823 CATCATTGAATGGAAATGAATGG - Intergenic
1025483711 7:61019655-61019677 CATCATCGAATGGAATTGAATGG - Intergenic
1025483729 7:61019825-61019847 CATCATCGAATGGAATTGAATGG - Intergenic
1025483857 7:61021462-61021484 TATCATGGAATGGAATTGAATGG - Intergenic
1025483878 7:61021686-61021708 CATCATAGAATGGATTTGAATGG - Intergenic
1025484049 7:61023959-61023981 CATCATCGAATGGAATTGGATGG - Intergenic
1025484390 7:61028520-61028542 CATCATCGAATGGAATTGAATGG - Intergenic
1025484397 7:61028621-61028643 CATCATTGAATGGAATTGAATGG - Intergenic
1025484414 7:61028846-61028868 CATCATCGAATGGATTTGAATGG - Intergenic
1025484860 7:61034324-61034346 CATCATTGAATGGAATTGAATGG + Intergenic
1025484865 7:61034396-61034418 CATCATCGAATGGAACCGAAAGG + Intergenic
1025484888 7:61034699-61034721 CATCATCGAATGGAATTGAATGG + Intergenic
1025485118 7:61037527-61037549 AATCATCGAATGGAGTTGAATGG + Intergenic
1025485133 7:61037742-61037764 CATCATCGAATGGAATTGAATGG + Intergenic
1025485311 7:61040024-61040046 CATCATCGAATGGAATTGAAAGG + Intergenic
1025485404 7:61041233-61041255 TATCATGGAATGGAATTGAATGG + Intergenic
1025485471 7:61042077-61042099 CATCATCGAATGGAATTGAATGG + Intergenic
1025485483 7:61042247-61042269 CATCATCGAATGGAATTGAATGG + Intergenic
1025485489 7:61042319-61042341 AATCATGGAATGGAATTGAAAGG + Intergenic
1025485505 7:61042538-61042560 CATCATGGAATGGAATCGAATGG + Intergenic
1025485512 7:61042636-61042658 CATCATCGAATGGAGTCGAATGG + Intergenic
1025485566 7:61043374-61043396 CATCATCGAATGGAACCGAATGG + Intergenic
1025485707 7:61045331-61045353 CATCATGGTATGGAATTGAATGG + Intergenic
1025485761 7:61046006-61046028 CATCATCGAATGGAATTGAATGG + Intergenic
1025485950 7:61048578-61048600 CATCATCGAATGGAATTGAATGG + Intergenic
1025486120 7:61050793-61050815 CATCATGGAATGGAATCGAATGG + Intergenic
1025486157 7:61051265-61051287 CATCATTGAATGGAATTGAATGG + Intergenic
1025486268 7:61052857-61052879 CATCATTGAATGGAATTGAATGG + Intergenic
1025486317 7:61053568-61053590 CATCATCGAATGGACTTGAATGG + Intergenic
1025486354 7:61054120-61054142 CATCATGGAATGGAAACGAATGG + Intergenic
1025486460 7:61055570-61055592 CATCATCGAATGGAATTGAATGG + Intergenic
1025486494 7:61056048-61056070 CATCATCGAATGGAATTGAATGG + Intergenic
1025486536 7:61056626-61056648 CATCATCGAATGGATTTGAATGG + Intergenic
1025486637 7:61057941-61057963 CATCATCGAATGGAATTGAATGG + Intergenic
1025486743 7:61059294-61059316 CATCATCGAATGGAATTGAATGG + Intergenic
1025486751 7:61059392-61059414 CATCATTGAATGGAATTGAAAGG + Intergenic
1025486809 7:61060254-61060276 AATCATCGAATGGAACTGAATGG + Intergenic
1025486822 7:61060425-61060447 CATCATCGAATGGAACCGAATGG + Intergenic
1025486855 7:61060847-61060869 CATCATTGAATGGACTTGAATGG + Intergenic
1025486857 7:61060873-61060895 CATCATCGAATGGAAATGAATGG + Intergenic
1025486885 7:61061253-61061275 AATCATCGAATGGACCTGAATGG + Intergenic
1025486899 7:61061397-61061419 AATCATCGAATGGACCTGAATGG + Intergenic
1025486908 7:61061472-61061494 CATCATTGAATGGAATTGAATGG + Intergenic
1025486926 7:61061700-61061722 CATCATAGAATGGAATTGAATGG + Intergenic
1025486986 7:61062572-61062594 AATCATTGAATGGAGTTGAAAGG + Intergenic
1025487146 7:61064734-61064756 CATCATTGAATGGAATTGAATGG + Intergenic
1025487221 7:61065761-61065783 CATGATGGAATTGAACTGAATGG + Intergenic
1025487317 7:61066993-61067015 CATCATAGAATGGAATTGAATGG + Intergenic
1025487356 7:61067492-61067514 CATCATTGAATGGAATTGAAAGG + Intergenic
1025487579 7:61070374-61070396 CATCATTGAATGGAATTGAATGG + Intergenic
1025487634 7:61071125-61071147 CATCATCGAATGGAATTGAATGG + Intergenic
1025487758 7:61072845-61072867 CATCATAGAATGGAATTGAATGG + Intergenic
1025511860 7:61579750-61579772 CATCATAGAATGGAATTGAATGG + Intergenic
1025554958 7:62295831-62295853 CATCATTGAATGGAGGCGAATGG + Intergenic
1025554980 7:62296143-62296165 CATCATTGAATGGAAGTGAATGG + Intergenic
1025554993 7:62296348-62296370 CATCATCAAATGGAACTGAATGG + Intergenic
1025555087 7:62297447-62297469 CATCATGGAATGGAATCGAATGG + Intergenic
1025555250 7:62299494-62299516 CATCATTGAATGGAACTGAAAGG + Intergenic
1025555335 7:62300388-62300410 CATCATGGAATGGAATGGAATGG + Intergenic
1025555509 7:62302758-62302780 CATCATGGAATGGAATAGAATGG + Intergenic
1025555587 7:62303884-62303906 CATCATCGAATGGAATTGAATGG + Intergenic
1025555619 7:62304299-62304321 CATCACGGAATGGAATTGAATGG + Intergenic
1025555629 7:62304422-62304444 CATCATCGAATGGAATTGAATGG + Intergenic
1025555631 7:62304448-62304470 CATCATTGAATGGAGTCGAATGG + Intergenic
1025555874 7:62307692-62307714 CATCATCGAATGGATATGAATGG + Intergenic
1025555876 7:62307718-62307740 CATCATTGAATGGATATGAATGG + Intergenic
1025555987 7:62309097-62309119 CATCATCGAATGGAATTGAATGG + Intergenic
1025556033 7:62309734-62309756 CATCATCGAATGGAACCGAACGG + Intergenic
1025556126 7:62310817-62310839 CATCATAGAATGGAATTGAATGG + Intergenic
1025556170 7:62311348-62311370 CATCATTGAATGGAATTGAATGG + Intergenic
1025556209 7:62311993-62312015 CATCATCGAATGGAATTGAATGG + Intergenic
1025556248 7:62312479-62312501 AATCATTGAATGGAACTGAACGG + Intergenic
1025556285 7:62312962-62312984 CATCATTGAATGGAATTGAATGG + Intergenic
1025556336 7:62313615-62313637 AATCATGGAATGGACTTGAATGG + Intergenic
1025556422 7:62314871-62314893 CATCATTGAATGGAATTGGATGG + Intergenic
1025558198 7:62336236-62336258 CATCATCAAATGGAACTGAATGG + Intergenic
1025558346 7:62338051-62338073 CATCATCGAATGGACTTGAATGG + Intergenic
1025558348 7:62338077-62338099 CATCATCGAATGGAACCGAAAGG + Intergenic
1025558466 7:62339491-62339513 CATCATCGAATGGAATTGAATGG + Intergenic
1025558620 7:62341690-62341712 CATCATGGAATGGAATCGAATGG + Intergenic
1025558623 7:62341742-62341764 CATCATCGAATGGAATTGAATGG + Intergenic
1025558658 7:62342185-62342207 CATCATTGAATGGAATTGAATGG + Intergenic
1025558674 7:62342407-62342429 AATCATCGAATGGAGTTGAATGG + Intergenic
1025558754 7:62343500-62343522 CATCATTGAATGGAATTGAATGG + Intergenic
1025558758 7:62343549-62343571 CATCATCGAATGGATTTGAATGG + Intergenic
1025558779 7:62343874-62343896 CATCATTGAATGGAATTGAATGG + Intergenic
1025559074 7:62347600-62347622 TATCATGGAATGGAATTGAATGG + Intergenic
1025559217 7:62349557-62349579 CATCATCGAATGGAACTGAATGG + Intergenic
1025559246 7:62349951-62349973 CATCATGGAATGGAATCGAATGG + Intergenic
1025559287 7:62350473-62350495 CATCATGGAATGAAATTGAATGG + Intergenic
1025559367 7:62351450-62351472 CATCATTGAATGGAAATGAATGG + Intergenic
1025559448 7:62352560-62352582 CATCATAGAATGGAATTGAATGG + Intergenic
1025559649 7:62355395-62355417 CATCATAGAATGGAATTGAATGG + Intergenic
1025559690 7:62355872-62355894 CATCATTGAATGGAACAGAATGG + Intergenic
1025559732 7:62356441-62356463 CATAATCGAATGGAACTGAAAGG + Intergenic
1025559785 7:62357210-62357232 CATCATCGAATGGAATTGAATGG + Intergenic
1025563702 7:62403936-62403958 CATCATCGAATGGAAATGAATGG + Intergenic
1025563741 7:62404348-62404370 CATCACGGAATGGAATTGAATGG + Intergenic
1025563789 7:62405014-62405036 CATCATCGAATGGAATCGGATGG + Intergenic
1025563824 7:62405473-62405495 CATCATCGAATGGAATTGAATGG + Intergenic
1025563902 7:62406538-62406560 AATCATCGAATGGAGTTGAATGG + Intergenic
1025563929 7:62406946-62406968 CATCATAGAATGGAATTGAATGG + Intergenic
1025564008 7:62407976-62407998 CATCATCGAATGGACTTGAATGG + Intergenic
1025564032 7:62408230-62408252 CATCATAGAATGGAATTGAATGG + Intergenic
1025566487 7:62441112-62441134 CATCATTGAATGGAATTGAAAGG - Intergenic
1025566493 7:62441190-62441212 CATCATCGAATGGAACCGAAAGG - Intergenic
1025566496 7:62441216-62441238 CATCATCGAATGGAACCGAATGG - Intergenic
1025566584 7:62442406-62442428 CATCATCGAATGGAAATGAAAGG - Intergenic
1025566607 7:62442827-62442849 CATCATCGAATGGAATTGAATGG - Intergenic
1025566683 7:62443779-62443801 CATCATCGAATGGAATTGAATGG - Intergenic
1025566745 7:62444679-62444701 CATCATTGAATGGAATTGAATGG - Intergenic
1025567024 7:62448322-62448344 CATCATAGAATGGAATTGAATGG - Intergenic
1025567099 7:62449292-62449314 CATCATCAAATGGAATTGGATGG - Intergenic
1025567157 7:62450086-62450108 CATCATCGAATGGAATTGAATGG - Intergenic
1025567190 7:62450527-62450549 CATCATCGAATGGAATTGAATGG - Intergenic
1025567213 7:62450922-62450944 AATCATCGAATGGAGATGAATGG - Intergenic
1025567255 7:62451438-62451460 AATCATCGAATGGAGTTGAATGG - Intergenic
1025567370 7:62452980-62453002 CATCATTGAATGGAATTGAATGG - Intergenic
1025567437 7:62453872-62453894 CATCATAGAATGGAATTGAATGG - Intergenic
1025567487 7:62454613-62454635 CATCATCGAATGGAATTGAAAGG - Intergenic
1025567583 7:62455886-62455908 AATCATTGAATGGAACTGAATGG - Intergenic
1025567589 7:62455955-62455977 CATCATTGAATGGAATTGAATGG - Intergenic
1025567605 7:62456157-62456179 CATCTTGGAATGGAGTCGAAAGG - Intergenic
1026503527 7:70963129-70963151 CATCATTGAATCAAGCTGGAGGG + Intergenic
1027290040 7:76697023-76697045 CATCATGGAATCCAGCCTGAAGG + Intergenic
1027516423 7:79147740-79147762 CCCCAGGGAATGGAGCAGGAGGG + Intronic
1030841338 7:114358066-114358088 TATCATGGGATGGACCTGGTGGG + Intronic
1031839094 7:126715678-126715700 CAACATGGATTTGAGCTGCATGG - Intronic
1032368927 7:131327446-131327468 CAACACTGAAGGGAGCTGGAGGG - Intronic
1035001263 7:155614128-155614150 CATCATGGGGAGGCGCTGGATGG - Intronic
1036624992 8:10463051-10463073 CATCATGGAAGGGACCTGGTGGG - Intergenic
1037538376 8:19848852-19848874 GATGATGGAATGCAGCTGAATGG - Intronic
1037756023 8:21710538-21710560 CAGCATGGCATGGAGAAGGACGG - Intronic
1038078900 8:24110000-24110022 CATTATGGAATGATGCAGGAAGG - Intergenic
1039124374 8:34184702-34184724 TTTCAAGGATTGGAGCTGGAAGG + Intergenic
1040565727 8:48565012-48565034 CATCATGCAATGAAGCAGTATGG + Intergenic
1040811010 8:51453650-51453672 GACAATGGATTGGAGCTGGATGG - Exonic
1041006554 8:53502140-53502162 CATCATGGAGGTGAGCAGGACGG + Intergenic
1045665600 8:104481020-104481042 CTGCATGGAATGAAGCTGGATGG + Intergenic
1045805191 8:106150954-106150976 TATCATGGAATATAGTTGGAAGG + Intergenic
1046407835 8:113797922-113797944 TGTCATGGAAGGGAGCTGGTGGG - Intergenic
1047820633 8:128516266-128516288 CATCGTGGAAGGGACCTGGTGGG - Intergenic
1048918511 8:139206683-139206705 CCTCATGGGATGGAGTAGGATGG - Intergenic
1049541055 8:143209178-143209200 CAGCATGGAGGGGAGCTGGGAGG + Intergenic
1052198554 9:25748192-25748214 CATCATGGCATGTAGTTGGGGGG + Intergenic
1053166070 9:35844831-35844853 CGTCATAGAATGCAGATGGATGG - Intronic
1053946925 9:43319745-43319767 CATCATTGAATGGAACCGAATGG - Intergenic
1053946996 9:43320637-43320659 CATCATAGAATGGAATTGAATGG - Intergenic
1053947058 9:43321499-43321521 CATCATCGAATGGAATTGAATGG - Intergenic
1053947088 9:43321903-43321925 CATCATGGAATGGAATGGAATGG - Intergenic
1053947098 9:43322001-43322023 CATCATCGAATGGAATTGAATGG - Intergenic
1053947186 9:43323043-43323065 CATCATCGAATGGAATTGAATGG - Intergenic
1053947554 9:43327856-43327878 CATCATTGAATGGAATTGAAGGG - Intergenic
1053947565 9:43327980-43328002 CATCATCGAATGGAATTGAACGG - Intergenic
1053947625 9:43328772-43328794 AATCATGGAATGGACGTGAAAGG - Intergenic
1053947723 9:43330118-43330140 AATCATTGAATGGAGTTGAATGG - Intergenic
1053947794 9:43331033-43331055 CATCATCGAATGGAATTGAATGG - Intergenic
1053947852 9:43331816-43331838 CATCATCGAATGGACTTGAATGG - Intergenic
1053947922 9:43333800-43333822 CATCATTGAATGGAGTAGAATGG - Intergenic
1053947939 9:43333996-43334018 CATCATGGAATGGAATCGAATGG - Intergenic
1053947961 9:43334223-43334245 CATCATCGAATGGAATTGAATGG - Intergenic
1053948039 9:43335155-43335177 CATCATCGAATGGAATTGAATGG - Intergenic
1053948086 9:43335720-43335742 CATCATTGAATGGAATTGAAAGG - Intergenic
1053948099 9:43335890-43335912 CATCATTGAATGGAATTGAAAGG - Intergenic
1053948105 9:43335968-43335990 CATCATTGAATGGAAATGAAAGG - Intergenic
1053948135 9:43336389-43336411 CATCATAGAATGGAATTGAATGG - Intergenic
1053948273 9:43338097-43338119 CATCATCGAATGGAGTAGAATGG - Intergenic
1053948278 9:43338195-43338217 CATCATTGAATGGAATTGAATGG - Intergenic
1053948313 9:43338695-43338717 CATCATCGAATGGAATTGAATGG - Intergenic
1053948367 9:43339360-43339382 CATCATCGAATGGAACCGAATGG - Intergenic
1053948398 9:43339821-43339843 AATCATTGAATGGAGTTGAAAGG - Intergenic
1053948418 9:43340138-43340160 CATCATCGAATGGAAATGAATGG - Intergenic
1053948468 9:43340729-43340751 CATCATCGAATGGAATTGAATGG - Intergenic
1053948518 9:43341487-43341509 AATCATCGAATGGAGTTGAATGG - Intergenic
1053948573 9:43342137-43342159 CATCATCGAATGGAATTGAATGG - Intergenic
1053948592 9:43342365-43342387 CATCATTGAATGGAATTGAATGG - Intergenic
1053948623 9:43342771-43342793 CATCATCGAATGGAAATGAATGG - Intergenic
1053948692 9:43343664-43343686 CATCATAGAATGGAATTGAATGG - Intergenic
1053948787 9:43344867-43344889 CATCATCGAATGGAATTGAATGG - Intergenic
1053948811 9:43345208-43345230 CATCATCGAATGGAATTGAATGG - Intergenic
1053948823 9:43345384-43345406 CATCATTGAATGGAGTCGAATGG - Intergenic
1053948836 9:43345562-43345584 CATCATCGAATGGACTTGAATGG - Intergenic
1053948894 9:43346325-43346347 CATCATCGAATGGACATGAATGG - Intergenic
1053949001 9:43347608-43347630 CATCATCGAATGGAATTGAATGG - Intergenic
1053949075 9:43348571-43348593 CATCATCGAATGGATATGAATGG - Intergenic
1053949090 9:43348782-43348804 CATCATTGAATGGAATTGAAAGG - Intergenic
1053949276 9:43350956-43350978 AATCATGGAATGGACATGAATGG - Intergenic
1053949279 9:43350979-43351001 CATCATCGAATGGAATTGAATGG - Intergenic
1053949307 9:43351311-43351333 CATCATTGAATGGATATGAATGG - Intergenic
1053949359 9:43352001-43352023 CATCATTGAATGGAAATGAATGG - Intergenic
1053949449 9:43353212-43353234 CATCATCGAATGGAATTGAATGG - Intergenic
1053949563 9:43354745-43354767 CATCATCGAATGGAGTCGAATGG - Intergenic
1056325082 9:85471130-85471152 CACCATGCAATGCAACTGGAGGG + Intergenic
1056328957 9:85505844-85505866 CATGATGGAGAGGAGCTGCACGG - Intergenic
1057500146 9:95590435-95590457 GATCATGGCTTGGAGCAGGATGG - Intergenic
1059466312 9:114470837-114470859 CTTCATGTCCTGGAGCTGGAAGG - Intronic
1060961184 9:127681863-127681885 CATCATTGAATGGGGCAGGTGGG - Intronic
1061657527 9:132104375-132104397 CTTCTTGGGATGGAGCTGGGTGG + Intergenic
1062114223 9:134798984-134799006 CCCCCTGGATTGGAGCTGGAAGG - Intronic
1203387324 Un_KI270438v1:67563-67585 CAGAATGGAATGGAACTGAATGG + Intergenic
1203391892 Un_KI270438v1:104572-104594 CAGAATGGAATGGAACTGAATGG + Intergenic
1203405130 Un_KI270528v1:660-682 AATCATGGAATGGAACTGAATGG - Intergenic
1203405199 Un_KI270528v1:1522-1544 CATCATCGAATGGAATTGAATGG - Intergenic
1203590055 Un_KI270747v1:48303-48325 CATCATTGAATGGAACCGAATGG - Intergenic
1203590126 Un_KI270747v1:49195-49217 CATCATAGAATGGAATTGAATGG - Intergenic
1203590188 Un_KI270747v1:50057-50079 CATCATCGAATGGAATTGAATGG - Intergenic
1203590218 Un_KI270747v1:50461-50483 CATCATGGAATGGAATGGAATGG - Intergenic
1203590228 Un_KI270747v1:50559-50581 CATCATCGAATGGAATTGAATGG - Intergenic
1203590316 Un_KI270747v1:51601-51623 CATCATCGAATGGAATTGAATGG - Intergenic
1203590684 Un_KI270747v1:56414-56436 CATCATTGAATGGAATTGAAGGG - Intergenic
1203590695 Un_KI270747v1:56538-56560 CATCATCGAATGGAATTGAACGG - Intergenic
1203590755 Un_KI270747v1:57330-57352 AATCATGGAATGGACGTGAAAGG - Intergenic
1203590853 Un_KI270747v1:58676-58698 AATCATTGAATGGAGTTGAATGG - Intergenic
1203590924 Un_KI270747v1:59591-59613 CATCATCGAATGGAATTGAATGG - Intergenic
1203590982 Un_KI270747v1:60374-60396 CATCATCGAATGGACTTGAATGG - Intergenic
1203591028 Un_KI270747v1:61056-61078 CATCATTGAATGGAATTGAATGG - Intergenic
1203591103 Un_KI270747v1:61999-62021 CATCATTGAATGGAGTAGAATGG - Intergenic
1203591120 Un_KI270747v1:62195-62217 CATCATGGAATGGAATCGAATGG - Intergenic
1203591142 Un_KI270747v1:62422-62444 CATCATCGAATGGAATTGAATGG - Intergenic
1203591220 Un_KI270747v1:63354-63376 CATCATCGAATGGAATTGAATGG - Intergenic
1203591267 Un_KI270747v1:63919-63941 CATCATTGAATGGAATTGAAAGG - Intergenic
1203591280 Un_KI270747v1:64089-64111 CATCATTGAATGGAATTGAAAGG - Intergenic
1203591286 Un_KI270747v1:64167-64189 CATCATTGAATGGAAATGAAAGG - Intergenic
1203591316 Un_KI270747v1:64588-64610 CATCATAGAATGGAATTGAATGG - Intergenic
1203591454 Un_KI270747v1:66296-66318 CATCATCGAATGGAGTAGAATGG - Intergenic
1203591459 Un_KI270747v1:66394-66416 CATCATTGAATGGAATTGAATGG - Intergenic
1203591494 Un_KI270747v1:66894-66916 CATCATCGAATGGAATTGAATGG - Intergenic
1203591548 Un_KI270747v1:67559-67581 CATCATCGAATGGAACCGAATGG - Intergenic
1203591578 Un_KI270747v1:68020-68042 AATCATTGAATGGAGTTGAAAGG - Intergenic
1203591598 Un_KI270747v1:68337-68359 CATCATCGAATGGAAATGAATGG - Intergenic
1203591648 Un_KI270747v1:68928-68950 CATCATCGAATGGAATTGAATGG - Intergenic
1203591698 Un_KI270747v1:69685-69707 AATCATCGAATGGAGTTGAATGG - Intergenic
1203591753 Un_KI270747v1:70335-70357 CATCATCGAATGGAATTGAATGG - Intergenic
1203591772 Un_KI270747v1:70563-70585 CATCATTGAATGGAATTGAATGG - Intergenic
1203591803 Un_KI270747v1:70969-70991 CATCATCGAATGGAAATGAATGG - Intergenic
1203591872 Un_KI270747v1:71862-71884 CATCATAGAATGGAATTGAATGG - Intergenic
1203591967 Un_KI270747v1:73068-73090 CATCATCGAATGGAATTGAATGG - Intergenic
1203591991 Un_KI270747v1:73409-73431 CATCATCGAATGGAATTGAATGG - Intergenic
1203592003 Un_KI270747v1:73585-73607 CATCATTGAATGGAGTCGAATGG - Intergenic
1203592016 Un_KI270747v1:73763-73785 CATCATCGAATGGACTTGAATGG - Intergenic
1203592074 Un_KI270747v1:74526-74548 CATCATCGAATGGACATGAATGG - Intergenic
1203592181 Un_KI270747v1:75809-75831 CATCATCGAATGGAATTGAATGG - Intergenic
1203592255 Un_KI270747v1:76772-76794 CATCATCGAATGGATATGAATGG - Intergenic
1203592270 Un_KI270747v1:76983-77005 CATCATTGAATGGAATTGAAAGG - Intergenic
1203592456 Un_KI270747v1:79157-79179 AATCATGGAATGGACATGAATGG - Intergenic
1203592459 Un_KI270747v1:79180-79202 CATCATCGAATGGAATTGAATGG - Intergenic
1203592487 Un_KI270747v1:79512-79534 CATCATTGAATGGATATGAATGG - Intergenic
1203592539 Un_KI270747v1:80202-80224 CATCATTGAATGGAAATGAATGG - Intergenic
1203592629 Un_KI270747v1:81413-81435 CATCATCGAATGGAATTGAATGG - Intergenic
1203592744 Un_KI270747v1:82946-82968 CATCATCGAATGGAGTCGAATGG - Intergenic
1203675309 Un_KI270756v1:17050-17072 CAGAATGGAATGGAGTTGAATGG - Intergenic
1203676555 Un_KI270756v1:27555-27577 CATAATGGAATGGAACTGAATGG - Intergenic
1203680290 Un_KI270756v1:58233-58255 TAGAATGGAATGGAGTTGGATGG - Intergenic
1185849824 X:3474924-3474946 AATCATAGAATGGAAATGGAAGG + Intergenic
1187118964 X:16384678-16384700 CAACATGGAATGCAGCTGGAGGG - Intergenic
1189219257 X:39357239-39357261 CCTCTGGGAAGGGAGCTGGAGGG - Intergenic
1189482959 X:41407168-41407190 CATCAGGAAATGGGGCTGGCTGG - Intergenic
1190218398 X:48495255-48495277 CCTCATGGACTGGGACTGGAAGG + Intergenic
1193372958 X:80720765-80720787 TACCATGGAATGGAGCTTAAAGG - Intronic
1195679276 X:107531621-107531643 TTTCATGGTATTGAGCTGGAAGG - Intronic
1197084551 X:122456208-122456230 CAACTTGGAATGGAGATGTATGG - Intergenic
1197241493 X:124127364-124127386 AATCAAGGAATGGAGTGGGAAGG - Intronic
1198112295 X:133512618-133512640 CGACATGGATTGGAGGTGGAGGG - Intergenic
1198389587 X:136160864-136160886 CATCATGAAATGGGACTTGAGGG - Intronic
1198571118 X:137958295-137958317 CATTGGGAAATGGAGCTGGAGGG + Intergenic
1200001775 X:153065789-153065811 CAGGAAGGAAGGGAGCTGGAAGG + Intergenic
1200133811 X:153865050-153865072 CAGCAGGGAAGGGAGGTGGAGGG - Intronic
1201112670 Y:10811785-10811807 CATCATGGAAAGGAGTGGAATGG - Intergenic
1201195228 Y:11487503-11487525 CATCATCGAATGGAATTGAATGG - Intergenic
1201195241 Y:11487692-11487714 CATCATCGAATGGAATTGAATGG - Intergenic
1201195247 Y:11487767-11487789 CATCATCGAATGGAATTGAATGG - Intergenic
1201195303 Y:11488476-11488498 CATCATTGAATGGAATTGAATGG - Intergenic
1201196963 Y:11503734-11503756 TAGCATGGAATGGAATTGGATGG + Intergenic
1201212694 Y:11695087-11695109 CAACATGGAATGGAATTGAATGG + Intergenic
1201731643 Y:17210857-17210879 CAGCAGGCAAAGGAGCTGGAAGG - Intergenic