ID: 1077106055

View in Genome Browser
Species Human (GRCh38)
Location 11:843111-843133
Sequence CACTACTCGGCGCGGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 48}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077106055_1077106066 8 Left 1077106055 11:843111-843133 CCTCCTGGCCGCGCCGAGTAGTG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1077106066 11:843142-843164 CGCCTCGGCCTCTGCCCGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 174
1077106055_1077106074 24 Left 1077106055 11:843111-843133 CCTCCTGGCCGCGCCGAGTAGTG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1077106074 11:843158-843180 CGCGGGGTGTCCGGGGCTCTCGG 0: 1
1: 0
2: 2
3: 12
4: 110
1077106055_1077106063 6 Left 1077106055 11:843111-843133 CCTCCTGGCCGCGCCGAGTAGTG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1077106063 11:843140-843162 TCCGCCTCGGCCTCTGCCCGCGG 0: 1
1: 0
2: 2
3: 19
4: 241
1077106055_1077106070 16 Left 1077106055 11:843111-843133 CCTCCTGGCCGCGCCGAGTAGTG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1077106070 11:843150-843172 CCTCTGCCCGCGGGGTGTCCGGG 0: 1
1: 0
2: 1
3: 16
4: 170
1077106055_1077106068 15 Left 1077106055 11:843111-843133 CCTCCTGGCCGCGCCGAGTAGTG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1077106068 11:843149-843171 GCCTCTGCCCGCGGGGTGTCCGG 0: 1
1: 0
2: 1
3: 13
4: 183
1077106055_1077106071 17 Left 1077106055 11:843111-843133 CCTCCTGGCCGCGCCGAGTAGTG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1077106071 11:843151-843173 CTCTGCCCGCGGGGTGTCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 98
1077106055_1077106061 -7 Left 1077106055 11:843111-843133 CCTCCTGGCCGCGCCGAGTAGTG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1077106061 11:843127-843149 AGTAGTGGGTTCCTCCGCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 47
1077106055_1077106065 7 Left 1077106055 11:843111-843133 CCTCCTGGCCGCGCCGAGTAGTG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1077106065 11:843141-843163 CCGCCTCGGCCTCTGCCCGCGGG 0: 1
1: 0
2: 3
3: 34
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077106055 Original CRISPR CACTACTCGGCGCGGCCAGG AGG (reversed) Intronic
903398050 1:23017703-23017725 CACTGCTCGGCGGGGCGCGGTGG + Intergenic
918550209 1:185733973-185733995 CACAACTCGGCCCAGCCAGGAGG - Intergenic
920637004 1:207713640-207713662 CAGTGCTTGGCGCGGCCAGCTGG - Intronic
1069543029 10:69309757-69309779 CACCACTCGGCCAGGCGAGGTGG + Intronic
1074452028 10:113567277-113567299 CAGTACTCAGCGCGCACAGGTGG + Intronic
1076879094 10:133231188-133231210 CAGTCCTCGGGGCGGCCGGGCGG - Exonic
1077106055 11:843111-843133 CACTACTCGGCGCGGCCAGGAGG - Intronic
1079318357 11:19429278-19429300 CACTTCTTGGCACGGCCAAGGGG + Intronic
1083411227 11:62493756-62493778 CACCATTTGGCCCGGCCAGGTGG - Intronic
1101592782 12:106138864-106138886 CACAGCTCGCCGCGGCCGGGGGG - Exonic
1104458560 12:128935148-128935170 CATTTCTGGGCGCAGCCAGGAGG + Intronic
1104980743 12:132572198-132572220 CACTGCCCAGCCCGGCCAGGTGG + Intronic
1129202919 15:74015989-74016011 CACTACTCGGCCAGGCGAGATGG + Intronic
1143633440 17:8151428-8151450 CACTGGTGGGCGCGGCCGGGGGG + Intronic
1145041148 17:19579434-19579456 CACAAATAGCCGCGGCCAGGAGG + Intergenic
1145825286 17:27872310-27872332 AACTACTCGGCCAGGCCGGGTGG + Intronic
1147423067 17:40332117-40332139 CACTACCTGGCTCGGCCAGCCGG - Intronic
1147900296 17:43779093-43779115 CACTCCTGGGCGCGTCCCGGGGG + Intergenic
1148458119 17:47821745-47821767 CACTGCTCAGCGCGGTGAGGAGG - Exonic
1148880260 17:50719899-50719921 CACATCGCGCCGCGGCCAGGAGG - Intronic
1150899929 17:69262385-69262407 CACTACTAGACGGGGGCAGGAGG - Intronic
1151802216 17:76385150-76385172 CACCCCTCGGGGCTGCCAGGGGG - Exonic
1154097338 18:11430441-11430463 CACTACTCCCCGGGGCCCGGGGG + Intergenic
1161359758 19:3841278-3841300 CACTCCTCGGCAGGGCCATGGGG + Intronic
1167594092 19:50418358-50418380 CACTCCTCAGCCCGGCCAAGGGG + Intronic
925918901 2:8625981-8626003 CACTGCTGGACCCGGCCAGGTGG - Intergenic
931309752 2:61066420-61066442 CACTACGCGGCGCGTCCTCGGGG - Intronic
933755376 2:85634122-85634144 CACTACTCGGCCGGGCGTGGTGG - Intronic
1172775078 20:37402570-37402592 GAGTACACGGCGCGGCAAGGTGG + Exonic
1174839397 20:53887409-53887431 CACAACTCGGCGGGGCGCGGTGG + Intergenic
1177057558 21:16326695-16326717 CAGTACTTTGCGAGGCCAGGTGG + Intergenic
1180699565 22:17774147-17774169 CCCTCCTCGGCGCGGCCGGCAGG - Intronic
950075690 3:10185268-10185290 CACTGCTCGGCCCGGCGCGGTGG + Intronic
956642575 3:71428867-71428889 CACAACCTGGCTCGGCCAGGAGG + Intronic
963673518 3:148280796-148280818 CAGCACTCGGAGCGGCCAGCCGG - Intergenic
969633116 4:8349978-8350000 CACTTCTGGGAGGGGCCAGGAGG + Intergenic
976644349 4:87371953-87371975 CACTTCTCGGCTGGGCGAGGTGG + Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
985645822 5:1084316-1084338 CACTACTCGGCACCGCGCGGTGG - Intronic
998152580 5:139765613-139765635 CAGTGCTCGCAGCGGCCAGGAGG + Intergenic
1006259221 6:32854123-32854145 CCCTTCGCGGCGCCGCCAGGAGG - Intronic
1010584241 6:77638611-77638633 CACTAGTCGGCCCGGCGCGGTGG + Intergenic
1015519453 6:134115586-134115608 TGCTGCGCGGCGCGGCCAGGCGG - Intergenic
1019563198 7:1667876-1667898 CGCCAATCGGCGCGGCCACGGGG + Intergenic
1038447576 8:27614684-27614706 CACAACGCGGCGTCGCCAGGAGG - Exonic
1062138657 9:134943596-134943618 CACTCCTGGGCTCTGCCAGGTGG + Intergenic
1062625863 9:137441300-137441322 CACTTCCCGGAGCGGCAAGGAGG + Exonic
1187342461 X:18433262-18433284 CACTTCTCGGCCGGGCCTGGTGG + Intronic
1189486989 X:41442084-41442106 CACTACGCGGCCTGGTCAGGAGG + Intergenic
1200873648 Y:8128794-8128816 CAGCACTCGGAGCGGCCAGCCGG - Intergenic