ID: 1077108407

View in Genome Browser
Species Human (GRCh38)
Location 11:851661-851683
Sequence CTACCTCCAAGGCGCCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 105}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077108407_1077108416 -5 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108416 11:851679-851701 GGTAGGGGTGGTGGGAGGTGTGG 0: 1
1: 0
2: 20
3: 322
4: 2302
1077108407_1077108421 15 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108421 11:851699-851721 TGGGTGTGGTCTGGAGCTGGTGG 0: 1
1: 1
2: 4
3: 58
4: 537
1077108407_1077108428 28 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108428 11:851712-851734 GAGCTGGTGGGTGTGGGGGGTGG 0: 1
1: 0
2: 20
3: 244
4: 2183
1077108407_1077108424 22 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108424 11:851706-851728 GGTCTGGAGCTGGTGGGTGTGGG 0: 1
1: 0
2: 3
3: 45
4: 475
1077108407_1077108415 -10 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108415 11:851674-851696 TTGGAGGTAGGGGTGGTGGGAGG 0: 1
1: 1
2: 36
3: 285
4: 1933
1077108407_1077108426 24 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108426 11:851708-851730 TCTGGAGCTGGTGGGTGTGGGGG 0: 1
1: 0
2: 8
3: 96
4: 848
1077108407_1077108429 29 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108429 11:851713-851735 AGCTGGTGGGTGTGGGGGGTGGG 0: 1
1: 1
2: 23
3: 165
4: 1324
1077108407_1077108417 -4 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108417 11:851680-851702 GTAGGGGTGGTGGGAGGTGTGGG 0: 1
1: 1
2: 10
3: 129
4: 1096
1077108407_1077108420 12 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108420 11:851696-851718 GTGTGGGTGTGGTCTGGAGCTGG 0: 1
1: 0
2: 6
3: 63
4: 510
1077108407_1077108419 6 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108419 11:851690-851712 TGGGAGGTGTGGGTGTGGTCTGG 0: 1
1: 0
2: 4
3: 69
4: 753
1077108407_1077108427 25 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108427 11:851709-851731 CTGGAGCTGGTGGGTGTGGGGGG 0: 1
1: 1
2: 7
3: 122
4: 1039
1077108407_1077108418 1 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108418 11:851685-851707 GGTGGTGGGAGGTGTGGGTGTGG 0: 1
1: 1
2: 39
3: 331
4: 2357
1077108407_1077108422 16 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108422 11:851700-851722 GGGTGTGGTCTGGAGCTGGTGGG 0: 1
1: 0
2: 5
3: 31
4: 322
1077108407_1077108423 21 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108423 11:851705-851727 TGGTCTGGAGCTGGTGGGTGTGG 0: 1
1: 0
2: 3
3: 46
4: 579
1077108407_1077108425 23 Left 1077108407 11:851661-851683 CCTGAGGGGCGCCTTGGAGGTAG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1077108425 11:851707-851729 GTCTGGAGCTGGTGGGTGTGGGG 0: 1
1: 0
2: 5
3: 65
4: 593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077108407 Original CRISPR CTACCTCCAAGGCGCCCCTC AGG (reversed) Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
900814629 1:4834075-4834097 CCACCTCCAAAGCGCTCCACTGG - Intergenic
903809997 1:26029835-26029857 CTAGCACCAAGTCTCCCCTCTGG + Intronic
904276003 1:29384675-29384697 CTACCTCTGAGGAGCCCCTGTGG - Intergenic
906747961 1:48234793-48234815 TTACCTCCAACCTGCCCCTCAGG - Intronic
910355555 1:86349757-86349779 CTTAATCCAAGGCACCCCTCGGG - Exonic
910581617 1:88833092-88833114 CTAGCCCCAAGGCGCCGTTCAGG - Exonic
923542245 1:234896938-234896960 CTACCACCCAGGAGGCCCTCAGG + Intergenic
1063452924 10:6163610-6163632 CTTCCTCCCAGGTGCACCTCGGG + Intronic
1065852864 10:29805317-29805339 CTAGCTCCAGGGCTCCCCACAGG - Intergenic
1067891960 10:50144942-50144964 CTGCCTCTGAGGAGCCCCTCAGG + Intergenic
1072848628 10:98861463-98861485 CCACCTCCAAGGGACCCCTAGGG + Intronic
1073292167 10:102418819-102418841 CTACCCCCTACGCGCCGCTCAGG + Exonic
1075234288 10:120712391-120712413 CTATCTGCAATGCCCCCCTCAGG + Intergenic
1075381031 10:122018865-122018887 CCACCTCCAAGGAGCTCCTAAGG + Intronic
1075723448 10:124600129-124600151 CCAGCTCCAAGGCCCCCCTGTGG + Intronic
1075747286 10:124736656-124736678 CTCCCTCCCAGGCTGCCCTCTGG - Intronic
1077108407 11:851661-851683 CTACCTCCAAGGCGCCCCTCAGG - Intronic
1083087755 11:60168183-60168205 CTACTTCCATGGCGGCCCTCAGG - Intergenic
1084335918 11:68457797-68457819 CCAGCTCCAAGCTGCCCCTCTGG + Intergenic
1085414500 11:76311163-76311185 CTGCCTCCACGGCTCCCCACGGG + Intergenic
1091624281 12:2110598-2110620 CTACCTTCATGGCACCACTCTGG + Intronic
1102442328 12:112972764-112972786 TTACCACCAAGGAGGCCCTCTGG - Exonic
1102570853 12:113826106-113826128 CTTCCTCCACGGAGCCACTCAGG + Intronic
1103321131 12:120093442-120093464 CCAACACCAAGGGGCCCCTCTGG - Exonic
1113809491 13:113129691-113129713 CTTCCTCCAGGCCGCCCCCCTGG - Intronic
1122346174 14:101061883-101061905 CTACCTCCGAGAAGCCCCCCAGG - Intergenic
1126551197 15:49931678-49931700 CTACCTCAAAGGCTGCCCTGAGG - Intronic
1129198290 15:73983867-73983889 CCTCCTCCAAGAGGCCCCTCAGG + Exonic
1131343855 15:91627938-91627960 CTGCCTCCAAGCAGCCCCTGGGG - Intergenic
1135791705 16:25402436-25402458 CTATCTCCACTGGGCCCCTCTGG - Intergenic
1139449959 16:67021580-67021602 CTACCTCAAAGGCATCCCACAGG - Intergenic
1139489309 16:67278222-67278244 ACAACTCCAAGGCTCCCCTCTGG + Exonic
1143846001 17:9772974-9772996 CTGCCTCCAATGCGCCCACCAGG - Intronic
1144295777 17:13873644-13873666 CTAAAGCCAAGGCACCCCTCAGG + Intergenic
1147522033 17:41182657-41182679 CTAGCTCCAAGGCAGCCATCTGG - Intergenic
1155054265 18:22170848-22170870 CTCCCTCAAAGGCACCGCTCCGG - Intronic
1156012741 18:32513200-32513222 CTACCTCCAAGTCTGCCCCCTGG + Intergenic
1156480353 18:37432347-37432369 CCACCTCCAAGCTCCCCCTCTGG - Intronic
1161329563 19:3679794-3679816 CCACATCCAGGGCGCCCCTTGGG - Intronic
1161402993 19:4077167-4077189 CTGCCTCCCAGGCACCTCTCAGG + Intergenic
1163815095 19:19460314-19460336 CCACCTCCAGAGCGCCCCTGTGG - Intronic
1166707259 19:44914862-44914884 CTGCCTCCAGAGTGCCCCTCCGG + Exonic
1166709363 19:44926946-44926968 CCGCCTCCAGGGTGCCCCTCCGG + Intergenic
1168289907 19:55352593-55352615 CCCCCTCCTAGGAGCCCCTCTGG + Exonic
927342981 2:22003457-22003479 CAAGCTCCACGGAGCCCCTCTGG + Intergenic
927595463 2:24393029-24393051 CTAACTCCATGGCTCCCCTAGGG + Intergenic
929760575 2:44802822-44802844 CTCCCCGCAAGGCGGCCCTCGGG - Intergenic
948852838 2:240716793-240716815 CTAGCCCCAAGGTGCCCCACTGG + Exonic
948891078 2:240907413-240907435 CCACCTCCAACGGACCCCTCGGG + Intergenic
1174434333 20:50494988-50495010 CTGCCTCCAAGGATCTCCTCAGG - Intergenic
1178549119 21:33520163-33520185 CTACCTTCAAAGCCCTCCTCAGG - Intronic
1184114445 22:42414231-42414253 CCCCCTCCAGGGCTCCCCTCTGG + Intronic
1184491316 22:44810793-44810815 CTCCCTCCACGGCTCCCCACGGG - Intronic
1185420657 22:50732514-50732536 CTGCCTCCAAGGGGCCCTTGGGG - Intergenic
952224691 3:31363215-31363237 CTACCACCATGGGGCCTCTCAGG + Intergenic
954362002 3:50126943-50126965 CTGCCTCCAAGGTGCCACCCTGG + Intergenic
955397681 3:58568892-58568914 CCACCTCCCAGATGCCCCTCTGG + Intronic
961091663 3:124118088-124118110 CTACCTCCATGCCAGCCCTCAGG - Intronic
962681831 3:137808396-137808418 CTCCCTCCAAGGTTCCCCACTGG + Intergenic
967836938 3:193972720-193972742 CAACCTCCCAGGCCTCCCTCAGG + Intergenic
974075640 4:57165927-57165949 CTACCTTCAAGGAGATCCTCAGG + Intergenic
974738238 4:65969377-65969399 CTGCCTCCCAGGCAGCCCTCTGG + Intergenic
985542357 5:492829-492851 CAGCCTCCATGGGGCCCCTCCGG - Intronic
992385520 5:76280686-76280708 CTGCCTCCCAGGCACCCCCCGGG - Intronic
993715813 5:91274831-91274853 CTACCTTGAAGCTGCCCCTCTGG + Intergenic
994180960 5:96765530-96765552 CTACCTCCCAGAATCCCCTCAGG - Intronic
1000133979 5:158326469-158326491 CTACCTCCAAGGCTGCCACCAGG + Intergenic
1002192199 5:177484116-177484138 CTGCCTGCAAGACGCCCATCCGG - Exonic
1006154722 6:32007975-32007997 GAACCTCCAAGGCGCCCACCTGG + Intergenic
1006161034 6:32040710-32040732 GAACCTCCAAGGCGCCCACCTGG + Exonic
1007409717 6:41654648-41654670 CCCCCTCCCAGGCACCCCTCTGG - Intergenic
1007636938 6:43305371-43305393 CTACCTCCGAGGCACCCTGCAGG + Exonic
1011664815 6:89623567-89623589 CTGCCTCCCAGCCACCCCTCTGG - Intronic
1023637231 7:42224776-42224798 CTACCTGCATGGCGCCCCCTGGG + Intronic
1029367630 7:100126939-100126961 CTACCTCCGCGGCGCCGCTTCGG + Exonic
1035763149 8:2084836-2084858 CCACCTCTAAGGATCCCCTCTGG - Intronic
1040283937 8:46089958-46089980 AAGCCCCCAAGGCGCCCCTCTGG + Intergenic
1042282151 8:67065845-67065867 CTCCCTCCCAGGCGGCCATCTGG - Intronic
1045482046 8:102600646-102600668 CATCCTCCAAGGTCCCCCTCTGG + Intergenic
1047137034 8:122091035-122091057 CTAGCTCCAAAGCTCCCCACTGG - Intergenic
1049190080 8:141282476-141282498 CTCCCTCCAGGCCGCCGCTCAGG + Intronic
1049687378 8:143944347-143944369 CTGCCTCCAAGGCTGCCCTCTGG + Intronic
1049966931 9:788340-788362 CACCCTCCAAGGAGCCCCTCTGG - Intergenic
1050085935 9:1965706-1965728 CTATCTCCAGGGCTCCCCACTGG + Intergenic
1052798507 9:32946253-32946275 CTACCTCCTGGGCACCTCTCTGG + Intergenic
1052815999 9:33102948-33102970 CTTCCTCCAAGGCGGGCCTGTGG - Intergenic
1056869715 9:90266236-90266258 TTACCTCCAAGTCGTTCCTCAGG - Intergenic
1059042642 9:110830762-110830784 CTTCCTCCAATGTGCTCCTCAGG + Intergenic
1060031905 9:120221945-120221967 ATGCCTCCCAGGTGCCCCTCTGG + Intergenic
1061129893 9:128702903-128702925 CCTCCTCCATGGCGCCGCTCCGG - Exonic
1062173691 9:135149161-135149183 CTACCTCCCCAGGGCCCCTCAGG - Intergenic
1062727388 9:138083336-138083358 CCACCTCCACGTGGCCCCTCAGG - Intronic
1185838470 X:3367406-3367428 CTACCTCCTGGGCACCTCTCTGG + Intergenic
1187191483 X:17039279-17039301 CTGCCTCCAATTCTCCCCTCAGG - Intronic
1190702627 X:52999815-52999837 CTACCTCAGAGGACCCCCTCAGG + Intergenic
1194971650 X:100350862-100350884 CTGCCTCCACGGAGCCCCTAGGG - Intronic
1199499452 X:148493958-148493980 CTACCCCAATGGCCCCCCTCAGG - Intergenic
1200316378 X:155137109-155137131 CTGCGTCCAAGGCTGCCCTCGGG + Intronic
1200686591 Y:6264636-6264658 CTAACTACAAGGCTTCCCTCAGG - Intergenic
1200989466 Y:9335552-9335574 CTAACTACAAGGCTTCCCTCAGG - Intergenic
1200992139 Y:9355885-9355907 CTAACTACAAGGCTTCCCTCAGG - Intergenic
1200994789 Y:9376163-9376185 CTAACTACAAGGCTTCCCTCAGG - Intronic
1200997453 Y:9396509-9396531 CTAACTACAAGGCTTCCCTCAGG - Intergenic
1200999965 Y:9465045-9465067 CTAACTACAAGGCTTCCCTCAGG - Intergenic
1201002626 Y:9485355-9485377 CTAACTACAAGGCTTCCCTCAGG - Intronic
1201005281 Y:9505639-9505661 CTAACTACAAGGCTTCCCTCAGG - Intergenic
1201007944 Y:9525968-9525990 CTAACTACAAGGCTTCCCTCAGG - Intergenic
1201237290 Y:11923490-11923512 CTACCTCCTGGGCACCTCTCTGG - Intergenic