ID: 1077108444

View in Genome Browser
Species Human (GRCh38)
Location 11:851784-851806
Sequence CAGAATGACTGAAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077108435_1077108444 7 Left 1077108435 11:851754-851776 CCAGAGTGTTTCTGTGACGGGGG 0: 1
1: 0
2: 0
3: 15
4: 232
Right 1077108444 11:851784-851806 CAGAATGACTGAAGGGCAGTGGG 0: 1
1: 0
2: 1
3: 18
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077108444 Original CRISPR CAGAATGACTGAAGGGCAGT GGG Intronic
900146037 1:1158990-1159012 CAGGATGAAAGCAGGGCAGTGGG + Intergenic
900506160 1:3030668-3030690 CAGAAAGAGTGAGGGGCACTTGG + Intergenic
900834572 1:4990485-4990507 GAGAGTGAGTGAAGGGCATTAGG - Intergenic
901904517 1:12396225-12396247 CAGTGTGACTGTAGGGCCGTTGG + Intronic
902074650 1:13774617-13774639 TCGAATTACTGAAGGGGAGTAGG - Intronic
902214624 1:14926554-14926576 CAGAAAGGGTGAAGGGCAGTAGG - Intronic
903486957 1:23696721-23696743 CAGAATCACTGAATAGCAGGGGG - Intergenic
903552584 1:24168283-24168305 CAGACTGATTGCAGGGCAGCAGG - Intronic
903975900 1:27149994-27150016 CAGACTGACTGCAGAACAGTGGG - Intronic
906260121 1:44380621-44380643 CAGAGAGCCTGGAGGGCAGTGGG - Intergenic
906317618 1:44798511-44798533 CAAAATTACTGAGGGGGAGTTGG - Intergenic
907101901 1:51845118-51845140 CAGAATGAAGGAAGAGTAGTGGG - Intronic
908574176 1:65441665-65441687 CAGAATGACGAAGGGGAAGTGGG + Intronic
908647116 1:66290190-66290212 TAGAAGGGGTGAAGGGCAGTGGG + Intronic
909285650 1:73813886-73813908 CAGGATGGATGAAGGGCAGCAGG - Intergenic
911737468 1:101353589-101353611 CACAATGACTGAAGCTCAGGTGG - Intergenic
911787651 1:101970562-101970584 CAGAATGCCTGACAGGAAGTAGG - Intronic
912189998 1:107327005-107327027 CAGAACCACTGAAATGCAGTTGG - Intronic
912246873 1:107968811-107968833 ATGAAGGACTCAAGGGCAGTAGG - Intergenic
916354680 1:163891524-163891546 CAGAATACATGAAGGGGAGTGGG + Intergenic
917122171 1:171654442-171654464 CAGATTCATTCAAGGGCAGTGGG - Intergenic
918007690 1:180557357-180557379 CAAAATGACTGAAGACCAGGAGG + Intergenic
919067811 1:192714865-192714887 CAAACTGACTGAAGAGCACTTGG + Intergenic
921518649 1:216130706-216130728 CACATTGATTGAAGGGCATTTGG + Intronic
923272700 1:232372287-232372309 CACAATGACTGAAGGTGATTTGG + Intergenic
924449560 1:244165300-244165322 CAGTATGACTGTAGTGCAGAGGG + Intergenic
1063284025 10:4663184-4663206 CAAAATAACTCAAGGGTAGTTGG + Intergenic
1064773718 10:18752320-18752342 CAGGAAGACTGAAGGGCAAGTGG + Intergenic
1066294620 10:34043414-34043436 TAGAATGAGTGAAGGGCCATTGG + Intergenic
1066303504 10:34117421-34117443 CACACAGACTGGAGGGCAGTGGG + Intronic
1067377411 10:45740685-45740707 CAGAAGAACTGAAAGGCATTTGG + Intronic
1067885116 10:50081370-50081392 CAGAAGAACTGAAAGGCATTTGG + Intronic
1068393967 10:56437124-56437146 CAGAAGGACAGAAGGGTAGGAGG + Intergenic
1068506431 10:57905796-57905818 CAGTGTGAGTGATGGGCAGTGGG - Intergenic
1070100513 10:73381778-73381800 CAGAGTAACAGGAGGGCAGTAGG - Intronic
1070722924 10:78769135-78769157 GAGAGTGAGTGAAAGGCAGTGGG + Intergenic
1071707353 10:88013587-88013609 CAGAATCTCTGAGGGGCAGTGGG - Intergenic
1074162946 10:110849033-110849055 CAGATTGCCTGAAGGGAAGGAGG + Intergenic
1074444867 10:113513391-113513413 CAGAAAGTCTGAAAGGCAGAAGG - Intergenic
1075113767 10:119608925-119608947 CAGGAGCACTGAAGGGCAGCTGG + Intergenic
1075879698 10:125840265-125840287 TTGTATGCCTGAAGGGCAGTGGG - Intronic
1076525173 10:131108167-131108189 CAGAATGACTGGAATGCACTGGG + Intronic
1077108444 11:851784-851806 CAGAATGACTGAAGGGCAGTGGG + Intronic
1077170164 11:1162535-1162557 CAGACTGGCTGAAGGGCAGCAGG - Exonic
1077676257 11:4195501-4195523 CAGACTGACTGAATGGAAGATGG - Intergenic
1077785577 11:5380157-5380179 CATAATGACTGAAGAGAGGTAGG + Intronic
1078691800 11:13588327-13588349 CAGTATGATTGATGGGCATTTGG - Intergenic
1078723012 11:13901394-13901416 CATAATTACTAAAGGGGAGTTGG - Intergenic
1081182925 11:40006316-40006338 CACATTGACTGATGTGCAGTTGG - Intergenic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1084866418 11:72061810-72061832 CAAAATCATTGAAGGACAGTAGG - Intronic
1086119767 11:83293949-83293971 AGGAATCACTGAAGGGCATTAGG + Intergenic
1086263524 11:84970363-84970385 CTGAATGAATGAATGGCAGATGG - Intronic
1087620666 11:100538053-100538075 CAATATGGCTGCAGGGCAGTGGG + Intergenic
1089744202 11:120605718-120605740 CAGCGTGGCTGAAGGGCAGGGGG - Intronic
1090163205 11:124517390-124517412 CAGGATGGCTAAAGGGCACTTGG - Intergenic
1090529906 11:127579534-127579556 CAAAATGTCTGAAGGACAATAGG + Intergenic
1090875602 11:130786219-130786241 GAGAAGGTTTGAAGGGCAGTGGG - Intergenic
1095963018 12:47847193-47847215 GAGAAGGACTGGAGGACAGTAGG - Intronic
1098330704 12:69349371-69349393 AAGAGTGACTGAAGGGAACTAGG - Intronic
1098550174 12:71754191-71754213 CAGAAAAACTGAAGAGCACTTGG + Intergenic
1100448033 12:94679023-94679045 CAGAATGACTGCAGGGCAGAGGG - Intergenic
1101643088 12:106602563-106602585 CAGAGTGACTGACGGGGAGGTGG - Intronic
1101806208 12:108066174-108066196 GAAAATGACTAAAGGGCACTAGG + Intergenic
1106387072 13:29297656-29297678 CAGAATTACTGTAGGGGAGTTGG - Intronic
1106647262 13:31649930-31649952 CAGATTGACTGAAGAGCAGATGG + Intergenic
1106711766 13:32343451-32343473 CAGAATGACTTAGGGGCAAAAGG - Intronic
1107291629 13:38861070-38861092 AAAAATGACTGAAAGTCAGTAGG - Intronic
1107419799 13:40235482-40235504 TAGAAAGACTGAAGGCCAATAGG - Intergenic
1108276979 13:48820938-48820960 CAGAGTGAGTGAGGGGAAGTGGG + Intergenic
1110915145 13:81012001-81012023 CAAAATGACTGAAGAGCACTTGG - Intergenic
1111678736 13:91418102-91418124 CTAAATGACTGATGGGCAGGCGG - Intronic
1112295320 13:98181222-98181244 CAGAATTACTGAAGTTCATTTGG - Intronic
1114893771 14:26960045-26960067 TAAAAAGACTGAAGAGCAGTAGG - Intergenic
1114968966 14:28001839-28001861 CAAACTGACTGAAGAGCACTTGG + Intergenic
1116157259 14:41221662-41221684 CTGAAGGACTGAAGGGGAGGAGG + Intergenic
1117961006 14:61161455-61161477 AGGAATGACAGAAGGGCATTAGG + Intergenic
1119819678 14:77604244-77604266 GAGAGAGTCTGAAGGGCAGTGGG + Intronic
1121324863 14:93013949-93013971 GAGAATGACTGAGAGGCACTGGG - Intronic
1121946571 14:98128734-98128756 CAAATAGACTGATGGGCAGTGGG - Intergenic
1122430929 14:101642883-101642905 AAGAAATTCTGAAGGGCAGTGGG + Intergenic
1125121232 15:36161143-36161165 GAGAAAGACTGAAGGGAAGAAGG + Intergenic
1125688056 15:41575359-41575381 TAGAAGCTCTGAAGGGCAGTGGG + Intronic
1125887246 15:43238139-43238161 CAGGGTGGCTGAAGGGCGGTGGG - Intronic
1126132851 15:45359882-45359904 CTAAATGACTGAAGGGCGGGTGG - Intergenic
1126704933 15:51397807-51397829 CAGAAGGAGGGAAGGGGAGTGGG - Intronic
1129425227 15:75457696-75457718 GAGAAAGACTCAAGGGGAGTAGG + Intergenic
1130235025 15:82125519-82125541 ATGAATGAATGAAGGGCAGCCGG + Intergenic
1131047674 15:89326476-89326498 CAGTGTGACTGAATGGCAGCAGG + Intronic
1132049705 15:98596836-98596858 CAGGACGACTGGAGGGCAGCAGG - Intergenic
1132265913 15:100470515-100470537 CAGAGTGACTGTAGTGGAGTGGG + Intronic
1132810073 16:1793166-1793188 CATCGTGACAGAAGGGCAGTCGG - Intronic
1133063625 16:3191072-3191094 CAGAATGTCTGAAGCTCACTGGG - Intergenic
1136241018 16:28944046-28944068 AAGAGTGAATGAAGGGCTGTGGG + Intergenic
1137621467 16:49879289-49879311 CAGAATGATTCAGTGGCAGTTGG - Intergenic
1137970295 16:52978013-52978035 CTGAATGAATGAAGAGCAATTGG - Intergenic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1139780447 16:69347112-69347134 GAGAATGACTAATGGGGAGTGGG + Intronic
1140474183 16:75230370-75230392 GAAAATGGCTGAAGGGCACTGGG + Intronic
1141756243 16:85992985-85993007 CAGAAAGACAGAAGGGAAGAAGG - Intergenic
1143336757 17:6177259-6177281 CAGAAAGACTCAAGGGAAGAAGG + Intergenic
1144290773 17:13824135-13824157 CAGCATGTCTGAAGGGAGGTGGG + Intergenic
1147381059 17:40056554-40056576 CAGAATGACAGCAGGGGAGCAGG - Intronic
1148484591 17:47982495-47982517 CAGGACGGCTGAAAGGCAGTGGG - Intergenic
1151429726 17:74054273-74054295 CAAAAAGACTGAACTGCAGTAGG - Intergenic
1151656400 17:75498296-75498318 CAGCATGACGGAGGAGCAGTTGG - Exonic
1152641452 17:81451006-81451028 CGGAAGGACTGATGGGCAGATGG + Intronic
1154158834 18:11965060-11965082 CACACAGACTGGAGGGCAGTGGG - Intergenic
1155441064 18:25863182-25863204 CAGCATGAGAGAAGGACAGTGGG - Intergenic
1156476659 18:37409842-37409864 CAGAATGGCAGAATGGCAGGTGG - Intronic
1157983839 18:52414711-52414733 CTGAATGACTTATGAGCAGTTGG + Intronic
1158396598 18:57083565-57083587 CACACTGCCTGAAGTGCAGTGGG - Intergenic
1159564994 18:70037921-70037943 CAGAATGACAGAAGTGCCCTTGG + Intronic
1165067691 19:33238735-33238757 CAGAATAACTGCTGTGCAGTGGG + Intergenic
1165323871 19:35102797-35102819 CAGAGTGAGTGAGGGGCAGGTGG - Intergenic
1165979445 19:39707247-39707269 CAGGATGACCAAAGTGCAGTCGG - Exonic
1166120469 19:40683333-40683355 CACAATGACTGAAGGGAGTTAGG + Intronic
1166714957 19:44961070-44961092 CAGAATGACAGAAGGGAAGGGGG - Intronic
1166857337 19:45789309-45789331 CAGAATGAGTGAATGGCTGAAGG - Intronic
1167169752 19:47823248-47823270 ATGAATGAATGAAGGGCAGAAGG + Intronic
925456756 2:4022714-4022736 CAGAATGGATGCAGGGCTGTGGG + Intergenic
928624200 2:33122682-33122704 CAGCATTTCTGAAGGGGAGTAGG + Intronic
929598455 2:43190602-43190624 CTGCATCCCTGAAGGGCAGTTGG - Intergenic
929833261 2:45368057-45368079 CAGAATGACAGATAAGCAGTAGG + Intergenic
930100719 2:47600937-47600959 CAGAATGCCTGGGGGCCAGTGGG - Intergenic
930224114 2:48774859-48774881 CAGAATTACAAAAGGGCAGGAGG - Intronic
930328748 2:49955452-49955474 GAGAATGACTGAAGGTTAGAAGG + Intronic
930541065 2:52707253-52707275 TACAAAGACTGAAGGGAAGTTGG - Intergenic
932137779 2:69245576-69245598 TAGAATGTGTGAAGGTCAGTGGG - Exonic
933929780 2:87137632-87137654 CAGAATAACTGTAGGTAAGTTGG + Intergenic
933973348 2:87488168-87488190 AAAAATCACTGAAGGGCATTGGG - Intergenic
934001113 2:87713424-87713446 CAGAATAACTGTAGGTAAGTTGG + Intergenic
935005142 2:99067157-99067179 CAGAATGACTGCCAGGCAGTGGG - Intronic
939003379 2:136760360-136760382 CAGCCTGACTGATGGACAGTAGG - Intergenic
939428323 2:142070257-142070279 CAGACTGGCTGACGTGCAGTAGG - Intronic
939634261 2:144561873-144561895 CAGAATGATTGAAGTGAAGTGGG + Intergenic
941324884 2:164102043-164102065 CTGAATGAATGAATGACAGTAGG - Intergenic
943482016 2:188430637-188430659 CTGAGTGACAGAAGGGCAGAAGG - Intronic
945631070 2:212277157-212277179 CAGAGAGATTTAAGGGCAGTGGG + Intronic
947722576 2:232378786-232378808 CAGCATGTCTGGAGGGCAGCAGG - Exonic
947998422 2:234547755-234547777 ATGAATGGCTGAAGGGCAGAAGG + Intergenic
948495370 2:238345390-238345412 CAGAAAGCCTGCAGGGCAGAAGG + Intronic
1169558679 20:6775453-6775475 CAGATTCACTGAGGTGCAGTGGG + Intronic
1171422136 20:25024500-25024522 CAGAATGACTGAAAGGCCCAAGG - Intronic
1172808623 20:37631604-37631626 CAGATTTACTCAAGGGGAGTGGG - Intergenic
1175322186 20:58096984-58097006 CAGGATGAATGAGGGGCAGAAGG - Intergenic
1176280068 20:64297771-64297793 CAGAAAGCTTGAAGGCCAGTAGG - Intergenic
1176910904 21:14563989-14564011 CAAAATGAATGAATGCCAGTAGG - Intronic
1180928579 22:19573505-19573527 CAGAAGGGCAGAAGGGCAGAAGG + Intergenic
1181436750 22:22915598-22915620 CAGAATGGATGAGGGGCAGGAGG - Intergenic
1182242357 22:28926126-28926148 CAAGATGAAGGAAGGGCAGTAGG - Intronic
1182474548 22:30569554-30569576 TAGAATGCCTGAAGAGCAGTAGG + Intronic
1182815604 22:33160836-33160858 CAGGCTGAGTGAAGGGAAGTTGG + Intergenic
1183043750 22:35203295-35203317 CAGAAGGACTGCTGGGCAGTTGG - Intergenic
952870482 3:37895991-37896013 CAGAATTCCTGAAATGCAGTTGG + Intronic
955953360 3:64263985-64264007 CAGAGTGGCGGCAGGGCAGTGGG + Intronic
955986906 3:64583160-64583182 CAGAATGTCTGTTGGTCAGTTGG + Intronic
956108090 3:65842815-65842837 CAGACTGAATAAAGAGCAGTAGG - Intronic
958900819 3:99884520-99884542 CAGAGTGACTGACAGACAGTAGG - Intronic
958976954 3:100679300-100679322 CAGACTGACTGAAGAGCCTTTGG - Intronic
962731203 3:138285156-138285178 GAGAATCACTGAAGGACACTAGG - Intronic
963100035 3:141592565-141592587 GAGAATGAATGAAGGGCACAAGG + Intronic
964053779 3:152426543-152426565 CAGAATTTCTGAAGGACACTTGG - Intronic
965513733 3:169598180-169598202 CAGATTGATAGCAGGGCAGTTGG - Intronic
967755040 3:193159294-193159316 CAGAAGGACTGAACCTCAGTTGG - Intergenic
969988052 4:11231883-11231905 CAGGGTGTCTGAAGTGCAGTGGG - Intergenic
974991319 4:69093950-69093972 CAGGATGACTGACCGGAAGTAGG - Intronic
976188211 4:82464151-82464173 CAACATGACCGAAGAGCAGTTGG + Intergenic
979483212 4:121241621-121241643 CTCACTGACTGAAGGGCATTTGG + Intergenic
980079960 4:128333795-128333817 GAGAGTGAGTGAATGGCAGTGGG + Intergenic
981404279 4:144349691-144349713 CAGAATAAGAGAAGGGTAGTGGG + Intergenic
982584876 4:157222950-157222972 AAGAATCACCGCAGGGCAGTCGG - Intronic
983386499 4:167069952-167069974 CAGAATAACTGATGAGCAGTAGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
987079642 5:14415085-14415107 CTGAATGACTGAACTGTAGTGGG + Intronic
989113938 5:37933499-37933521 CAAAATGCCTCGAGGGCAGTGGG + Intergenic
989475269 5:41867877-41867899 CATTATTACTGAGGGGCAGTGGG - Intronic
990946814 5:61257796-61257818 CAGAATGAGTGAAAGTCATTTGG + Intergenic
993356474 5:86915135-86915157 CAAAATGAGAAAAGGGCAGTAGG + Intergenic
998382737 5:141737313-141737335 CAGAATGACAGCTGGGCAGATGG - Intergenic
998466848 5:142353464-142353486 CATGATGACTGAAAGGGAGTAGG + Intergenic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1000659238 5:163918132-163918154 CAGAATGAGAGATGGGCTGTGGG - Intergenic
1002835933 6:865346-865368 CAGAATGACTGGAATGCAGGAGG + Intergenic
1003384224 6:5652587-5652609 ATGAAGGCCTGAAGGGCAGTCGG - Intronic
1004009732 6:11671366-11671388 CAGAATGATAGATTGGCAGTTGG - Intergenic
1004534805 6:16490285-16490307 GAAAAAGACTGAAGGGAAGTTGG - Intronic
1005026805 6:21470391-21470413 CAAAATGCCTGACGGGTAGTAGG - Intergenic
1006369803 6:33636911-33636933 CAGAATGACGGGACGGCAGAGGG - Intronic
1006388161 6:33743614-33743636 AAAAATGACTCAAGGGCTGTAGG + Intronic
1008364789 6:50665269-50665291 CTTAATGACTGAAGTGCAATGGG - Intergenic
1009854250 6:69240547-69240569 CAGAATGACTAAAGGTGAGAGGG + Intronic
1009951114 6:70397402-70397424 CAGAATAATTGAAGGGGAGGTGG - Intergenic
1012717756 6:102698777-102698799 CATACTGACTGAAGAGCACTTGG - Intergenic
1016623777 6:146142727-146142749 CAAGCTGACTGAAGGGCTGTAGG - Intronic
1018095860 6:160386578-160386600 CAGAGTGAGGGAAGGGGAGTGGG + Intronic
1020280312 7:6646948-6646970 AAGCATGGCTGAAGGGCAGGTGG - Intronic
1020478243 7:8624712-8624734 CAGAGTGAATGAAAGGCATTTGG + Intronic
1021610495 7:22453065-22453087 GAGAAAGACTGCAGGGGAGTTGG - Intronic
1022798505 7:33752699-33752721 CACCATGGCTGTAGGGCAGTGGG - Intergenic
1024684299 7:51728699-51728721 CAGAGAGACTGATGGGCTGTAGG - Intergenic
1026909349 7:74083575-74083597 AAGAATGAATGAAGGGCGGAAGG + Intronic
1027450566 7:78326626-78326648 CAGAACGACAGAAGGGGAGGTGG + Intronic
1029278912 7:99424465-99424487 CAGAATTCCTGAGGGGCCGTGGG - Intronic
1033194940 7:139319694-139319716 CAGAATAACTGGAGGTCAGAAGG - Intergenic
1035192047 7:157178514-157178536 CTGAATGACTGAATGTTAGTTGG + Intronic
1036147903 8:6271717-6271739 AAAAATGAATGAGGGGCAGTAGG - Intergenic
1036955221 8:13181092-13181114 GAGAATGAGGAAAGGGCAGTTGG - Intronic
1037538591 8:19850967-19850989 CAGAATCTCTGAGGGGCAGAGGG - Intronic
1038061361 8:23917220-23917242 CTTAATGATTGAAGGGCATTTGG + Intergenic
1042091178 8:65161402-65161424 CAGAATGAGGGCAGGGCAGCAGG + Intergenic
1042393652 8:68265496-68265518 GAAAATGACTGAAGGGAATTAGG - Intergenic
1043402029 8:79892927-79892949 CAGAAAGGCAGAAGGGCAGTGGG + Intergenic
1043814657 8:84787413-84787435 CAGTATTACTGAAGGGCATTTGG + Intronic
1045401211 8:101820165-101820187 CAAAATCACTGGAGGTCAGTAGG - Intronic
1045657096 8:104398667-104398689 GACAATGCCTGGAGGGCAGTTGG - Intronic
1047822853 8:128540449-128540471 CAGAATCACTGTGGGGCTGTGGG - Intergenic
1047960871 8:130010790-130010812 CTGAATGAATGAAGGGGAGAGGG + Intronic
1048925443 8:139267080-139267102 TGGAATGACTGAGGGGCTGTTGG - Intergenic
1049190467 8:141284768-141284790 AAGAAGGACTGAAGGGCAGGAGG + Intronic
1050081140 9:1917148-1917170 CAAAATGCCTGACAGGCAGTTGG + Intergenic
1051257004 9:15224170-15224192 CAGCATGGCTAAAGGTCAGTGGG - Intronic
1053417843 9:37957952-37957974 CAGAGTGACTGGAAGGGAGTTGG + Intronic
1056667156 9:88589941-88589963 CAGAATCAATGCAAGGCAGTGGG + Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1057079367 9:92160896-92160918 CAGAATGACTGGAATGCACTGGG + Intergenic
1057546695 9:96024315-96024337 CAGAGTGAATGAAGGGAAGTAGG + Intergenic
1057834347 9:98432273-98432295 CAGAATGAATGAGCGGCAGAGGG + Intronic
1058899564 9:109430518-109430540 ATAAATGAGTGAAGGGCAGTAGG - Intronic
1185990016 X:4883354-4883376 AAGAATGACCAAAGAGCAGTGGG + Intergenic
1186183171 X:6992602-6992624 CAGAATGAGCCAAAGGCAGTGGG + Intergenic
1187800987 X:23062467-23062489 ATGCATGACTGAAGCGCAGTAGG - Intergenic
1188066355 X:25665132-25665154 CAGAATGAATGAAGGGGAATAGG + Intergenic
1188262063 X:28034063-28034085 GAGATTGACTGAAGGCCAGAAGG + Intergenic
1189249952 X:39593110-39593132 GAGAAAGACTGAAGGGAGGTTGG - Intergenic
1189299726 X:39943760-39943782 GGGAGTCACTGAAGGGCAGTGGG + Intergenic
1190126631 X:47711395-47711417 CAGAATGACAGAAATGCTGTGGG + Intergenic
1194398239 X:93412426-93412448 CAAACTGACTGAAGAGCACTTGG + Intergenic
1195846642 X:109236303-109236325 CAGAATGACTCAGGTGGAGTAGG + Intergenic
1196247429 X:113415908-113415930 CAAAATGACTGAAGAGCCCTTGG + Intergenic
1196508384 X:116476424-116476446 CAGGCTGACTGAAGAGCTGTTGG - Intergenic
1198578560 X:138037347-138037369 CAGCATGACTGAAGAGCCCTTGG + Intergenic