ID: 1077108726

View in Genome Browser
Species Human (GRCh38)
Location 11:852951-852973
Sequence CTGGTCACTGGCTGCCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 218}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077108726_1077108731 -8 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108731 11:852966-852988 GTGACCAGAGCCGTGGGCAGTGG 0: 1
1: 0
2: 1
3: 25
4: 301
1077108726_1077108741 9 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108741 11:852983-853005 CAGTGGTGGGAGCCGGGGTGGGG 0: 1
1: 0
2: 7
3: 67
4: 759
1077108726_1077108732 -5 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108732 11:852969-852991 ACCAGAGCCGTGGGCAGTGGTGG 0: 1
1: 0
2: 3
3: 35
4: 292
1077108726_1077108736 2 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108736 11:852976-852998 CCGTGGGCAGTGGTGGGAGCCGG 0: 1
1: 0
2: 7
3: 70
4: 511
1077108726_1077108739 7 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108739 11:852981-853003 GGCAGTGGTGGGAGCCGGGGTGG 0: 1
1: 0
2: 13
3: 133
4: 1067
1077108726_1077108738 4 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108738 11:852978-853000 GTGGGCAGTGGTGGGAGCCGGGG 0: 1
1: 1
2: 16
3: 80
4: 671
1077108726_1077108740 8 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108740 11:852982-853004 GCAGTGGTGGGAGCCGGGGTGGG 0: 1
1: 0
2: 3
3: 82
4: 661
1077108726_1077108742 14 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108742 11:852988-853010 GTGGGAGCCGGGGTGGGGTGAGG 0: 1
1: 0
2: 31
3: 271
4: 1982
1077108726_1077108737 3 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108737 11:852977-852999 CGTGGGCAGTGGTGGGAGCCGGG 0: 1
1: 0
2: 11
3: 80
4: 556
1077108726_1077108734 -4 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108734 11:852970-852992 CCAGAGCCGTGGGCAGTGGTGGG 0: 1
1: 0
2: 6
3: 29
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077108726 Original CRISPR CTGGTCACTGGCTGCCCACT GGG (reversed) Intronic