ID: 1077108726

View in Genome Browser
Species Human (GRCh38)
Location 11:852951-852973
Sequence CTGGTCACTGGCTGCCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 218}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077108726_1077108734 -4 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108734 11:852970-852992 CCAGAGCCGTGGGCAGTGGTGGG 0: 1
1: 0
2: 6
3: 29
4: 307
1077108726_1077108737 3 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108737 11:852977-852999 CGTGGGCAGTGGTGGGAGCCGGG 0: 1
1: 0
2: 11
3: 80
4: 556
1077108726_1077108739 7 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108739 11:852981-853003 GGCAGTGGTGGGAGCCGGGGTGG 0: 1
1: 0
2: 13
3: 133
4: 1067
1077108726_1077108736 2 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108736 11:852976-852998 CCGTGGGCAGTGGTGGGAGCCGG 0: 1
1: 0
2: 7
3: 70
4: 511
1077108726_1077108731 -8 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108731 11:852966-852988 GTGACCAGAGCCGTGGGCAGTGG 0: 1
1: 0
2: 1
3: 25
4: 301
1077108726_1077108741 9 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108741 11:852983-853005 CAGTGGTGGGAGCCGGGGTGGGG 0: 1
1: 0
2: 7
3: 67
4: 759
1077108726_1077108738 4 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108738 11:852978-853000 GTGGGCAGTGGTGGGAGCCGGGG 0: 1
1: 1
2: 16
3: 80
4: 671
1077108726_1077108742 14 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108742 11:852988-853010 GTGGGAGCCGGGGTGGGGTGAGG 0: 1
1: 0
2: 31
3: 271
4: 1982
1077108726_1077108732 -5 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108732 11:852969-852991 ACCAGAGCCGTGGGCAGTGGTGG 0: 1
1: 0
2: 3
3: 35
4: 292
1077108726_1077108740 8 Left 1077108726 11:852951-852973 CCCAGTGGGCAGCCAGTGACCAG 0: 1
1: 0
2: 0
3: 30
4: 218
Right 1077108740 11:852982-853004 GCAGTGGTGGGAGCCGGGGTGGG 0: 1
1: 0
2: 3
3: 82
4: 661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077108726 Original CRISPR CTGGTCACTGGCTGCCCACT GGG (reversed) Intronic
900893036 1:5463427-5463449 CTGGGCAATGGCAGCTCACTGGG + Intergenic
901233182 1:7652469-7652491 CGAGTCCCTGGCTCCCCACTTGG - Intronic
902748489 1:18489784-18489806 CTGGTAACTGGCTGTTGACTAGG - Intergenic
902876074 1:19341657-19341679 CAGTTCCCTGGCCGCCCACTGGG - Intronic
903567384 1:24278519-24278541 ATGTTTACTGGCTGCCCACTTGG + Intergenic
904407892 1:30305588-30305610 ATGGTCACTTGCTGTCTACTTGG - Intergenic
904480941 1:30793087-30793109 CTGGTCACAGGATGGCCACGGGG + Intergenic
905238069 1:36563926-36563948 CTGGCCATAGTCTGCCCACTGGG - Intergenic
905546257 1:38802485-38802507 CTGGGCTCTTTCTGCCCACTTGG - Intergenic
905584297 1:39105203-39105225 CTGGGCCCGGGCTGCCCACACGG - Intronic
905934257 1:41811162-41811184 CTATTCACTAGCTGCCCACTGGG - Intronic
906381013 1:45332195-45332217 CAGGGCACTGGCTGCACAGTGGG + Exonic
906675167 1:47688195-47688217 CTGGGCACGGGCTGCTCCCTGGG + Intergenic
907445760 1:54506797-54506819 CTGAGCACTTGCTGCACACTAGG + Intergenic
908939042 1:69410041-69410063 CTGGTCTCATTCTGCCCACTTGG - Intergenic
909941479 1:81616409-81616431 CTGGTCACTGGTTGCCTATTGGG + Intronic
910289103 1:85582592-85582614 CTGTACACTGGCTGTCCACAAGG - Exonic
913497314 1:119440212-119440234 GTGGGCTCTGGCTGCCCAGTGGG + Intergenic
916316292 1:163451881-163451903 CTGCTCACTGAATACCCACTAGG - Intergenic
919933251 1:202235295-202235317 CTGCTCACTAGCTGTCCTCTGGG - Intronic
920174756 1:204093583-204093605 CTTGTCACTGGCTGTCCCCTTGG + Intronic
920270843 1:204762588-204762610 ATGGTCACTGGCTTCCCCCAGGG + Intergenic
923524386 1:234760733-234760755 CTGGGCATTTGCTGCCAACTCGG + Intergenic
1062833969 10:624109-624131 CTGGTCAGGGGCTGCGCCCTTGG - Intronic
1063134168 10:3201920-3201942 CGGGTCAGTGGCTGCAGACTTGG + Intergenic
1064136310 10:12753827-12753849 CTGGGCCTTGGCTGCCCACTGGG + Intronic
1064137769 10:12765509-12765531 CTGCTCTCTGGCTGTCCAGTAGG + Intronic
1064284628 10:13981851-13981873 CAGGTCACTGGATCCCCACTGGG - Intronic
1064336485 10:14448074-14448096 ATGGTCCCTGGGTGCCGACTGGG - Intronic
1065662465 10:28020068-28020090 CTGCTCTCTGGCTGCCCTATGGG + Intergenic
1067375915 10:45727515-45727537 CTGGTCGCTGGCGGCCGACGCGG + Exonic
1067749348 10:48959888-48959910 CTGGTCACTGGCCCTCCACTTGG - Intronic
1067883617 10:50068203-50068225 CTGGTCGCTGGCGGCCGACGCGG + Exonic
1068055266 10:52005382-52005404 ATGGGCACTGGCTGGTCACTGGG - Intronic
1068270390 10:54716076-54716098 GTTCTCACAGGCTGCCCACTGGG + Intronic
1069863685 10:71486968-71486990 TTGGGCACAGACTGCCCACTGGG + Intronic
1069943952 10:71973343-71973365 CTGGTGGCTGGCTGCACTCTGGG + Intronic
1070516581 10:77213867-77213889 CTGTTCACGTGCTCCCCACTGGG + Intronic
1071885908 10:89950850-89950872 CTGGTCTCATTCTGCCCACTTGG + Intergenic
1072620294 10:97075028-97075050 CTGGGTTCTTGCTGCCCACTCGG + Intronic
1073460023 10:103660951-103660973 CTGGCCAATGGCCGTCCACTGGG - Intronic
1074941622 10:118241526-118241548 ATGTTCACTGGCTGCCCGATAGG - Intergenic
1075686659 10:124369145-124369167 GTGGTCACTGGCTGCCAATGAGG - Intergenic
1076111463 10:127862797-127862819 CTGTTGACTGTCTGCCTACTGGG + Intergenic
1076526408 10:131115173-131115195 CTAGTCACTGGCTGGACACTTGG + Intronic
1076791621 10:132779699-132779721 CTGCACACCCGCTGCCCACTGGG - Intronic
1077108726 11:852951-852973 CTGGTCACTGGCTGCCCACTGGG - Intronic
1077295198 11:1823297-1823319 CAGGTCACTGAAGGCCCACTGGG + Intergenic
1077414831 11:2420162-2420184 CGGGTCCCTGGATCCCCACTGGG + Intronic
1077599858 11:3566771-3566793 CTGATGACTGCCTGCCCATTAGG + Intergenic
1079080828 11:17412619-17412641 CTGGTCTCTGGCTGCCTCCCAGG - Intronic
1080728426 11:34920469-34920491 CAGTTCCCTGGCTGCCAACTTGG - Intronic
1081567603 11:44269684-44269706 CCAGGCCCTGGCTGCCCACTGGG + Intronic
1083629784 11:64089555-64089577 CTGGTCCGTGGCTGCCGACCCGG - Intronic
1084255767 11:67941392-67941414 CTGATGACTGCCTGCCCATTAGG + Intergenic
1084625533 11:70303672-70303694 CTGGTGACTGGCTACCCCCTAGG + Intronic
1085534790 11:77211401-77211423 CTGGCCAGTGTCTGCCCCCTTGG - Intronic
1085688109 11:78644063-78644085 CTGGTCCCAGACTGCCCATTGGG - Intergenic
1087212340 11:95456910-95456932 CTGTTGACTGGCTGCCAGCTAGG - Intergenic
1089142803 11:116300924-116300946 ATGTTCCCTGTCTGCCCACTGGG - Intergenic
1090338997 11:125998654-125998676 GTTGTAACTGGCTTCCCACTTGG + Intronic
1090568509 11:128021839-128021861 GTGGCCCCTTGCTGCCCACTAGG - Intergenic
1091372457 11:135072441-135072463 CTGGTCACAGGCTGCCTTCCAGG - Intergenic
1093036195 12:14334569-14334591 CAAGTCAATGGCTGCACACTAGG - Intergenic
1093254577 12:16850840-16850862 CTGGTGGCTGGCAGCCCCCTAGG - Intergenic
1094807221 12:34105999-34106021 CAGGACACTGCCTGACCACTGGG - Intergenic
1095967329 12:47877835-47877857 CCTGGCACTGGCTGCCCGCTTGG - Intronic
1096195425 12:49646383-49646405 CTGGTGACTCCCTACCCACTTGG + Intronic
1096200164 12:49675640-49675662 CTGTTCACTTGCCGCCCTCTGGG + Intronic
1096497395 12:52046255-52046277 GTGGACATTGGCTGCTCACTTGG + Intronic
1096570936 12:52522771-52522793 CTGGTGCCTGGCTCCCCACCAGG - Intergenic
1100751084 12:97698700-97698722 CTATTCACTGGGTGCCTACTAGG - Intergenic
1100802112 12:98242943-98242965 CTGGTAGATGGCTGCCTACTTGG + Intergenic
1101576278 12:105999959-105999981 GTTGTCACTGGCTCCACACTGGG + Intergenic
1102478086 12:113201786-113201808 CTGCTCACTTCCTGCACACTGGG + Intronic
1102522669 12:113488421-113488443 CCTTTCACTGGCTTCCCACTGGG + Intergenic
1102571523 12:113829846-113829868 CTGGGCACTGCCTGTCCTCTGGG - Intronic
1104684571 12:130776359-130776381 CTGGGCACTGGCTTCCCAGCTGG + Intergenic
1105533513 13:21242580-21242602 CTTGTCACTGGCTGTCGGCTGGG - Intergenic
1105846798 13:24300543-24300565 CTGGTCACAGGCTGACAACTTGG - Intronic
1106099098 13:26679198-26679220 CTGGTTTCTGCCTCCCCACTGGG + Intronic
1107069875 13:36257788-36257810 CTGGGCACTGGCTAGCTACTGGG - Intronic
1109362722 13:61316940-61316962 TTTGTCACTGGCTGCCCTCAGGG + Intergenic
1109788756 13:67219306-67219328 CTGGTGACTGACAGCCCAATAGG + Intronic
1112617388 13:101019300-101019322 CTGGTCACAAGCTGCCCACAGGG - Intergenic
1113518382 13:110920330-110920352 CCGGTCAGTGGCTGGGCACTCGG - Intergenic
1115388002 14:32820463-32820485 CTGCTCTCTGCCTGCCCACTTGG - Intronic
1116752528 14:48904432-48904454 CTGGTCTCTTGCTTCCCACATGG - Intergenic
1116929743 14:50678342-50678364 CTGGAGACTGGCTGCCTGCTTGG - Intergenic
1117081417 14:52155966-52155988 CTGGTCCCTGGACGCCCACCAGG + Intergenic
1120405873 14:84092308-84092330 CTGGGCACGTTCTGCCCACTAGG - Intergenic
1120500229 14:85288209-85288231 GTGGTCACTGGCTGGCCACAGGG - Intergenic
1120644024 14:87050661-87050683 CTGCTCTAGGGCTGCCCACTGGG + Intergenic
1202896479 14_GL000194v1_random:13426-13448 CTGGTGCCTAGGTGCCCACTGGG + Intergenic
1124080704 15:26492211-26492233 CAGGTCACTGTGTGCCCACATGG - Intergenic
1125028365 15:35052836-35052858 CTGGTCACTGCAGGCCAACTGGG - Intergenic
1128089172 15:64907300-64907322 CTGTTCAGGAGCTGCCCACTGGG + Intronic
1128447501 15:67776904-67776926 TTGGTCAAGGGCTGCCCCCTCGG - Intronic
1128714809 15:69900453-69900475 CTGTGCACTGGCAGCCCACCTGG + Intergenic
1130553366 15:84905794-84905816 CTGGTCCCCAGCTGCCCACCTGG - Intronic
1130681101 15:85997474-85997496 CAGGTCTCTGGCTGCTCAGTAGG - Intergenic
1132698159 16:1211058-1211080 CTGTTCGCAGGCCGCCCACTCGG + Intronic
1133312984 16:4862931-4862953 CTGGTCACCAGCTCCCCACTGGG - Intronic
1133372333 16:5254773-5254795 CTAATGACTGCCTGCCCACTGGG - Intergenic
1138163198 16:54775525-54775547 GTGTTTACTGGCTGCCCAGTTGG - Intergenic
1140124946 16:72111119-72111141 CTGGTCTCTGGCAGCCTCCTGGG - Intronic
1141574546 16:84955587-84955609 CTGGTCCCTGCCTGGGCACTGGG + Intergenic
1142127888 16:88419284-88419306 CCGGCCTCTGGCTGCCCACCAGG - Intergenic
1142230072 16:88895935-88895957 CTGGTCCCTGGAGCCCCACTTGG - Intronic
1142262720 16:89050348-89050370 CGGGGTCCTGGCTGCCCACTGGG - Intergenic
1142334920 16:89482089-89482111 ATGTTCATTGGCTGCTCACTGGG - Intronic
1143584164 17:7843154-7843176 CTGGTAACTGGCGGCGCTCTCGG + Intronic
1145900147 17:28485306-28485328 CTGGCCACTGGCTGCTCCCCAGG - Intronic
1147340340 17:39750117-39750139 CTGGGGCCAGGCTGCCCACTGGG - Intergenic
1148549473 17:48542043-48542065 ATGGTAACTGGCTTCCCAGTGGG - Intronic
1148697553 17:49570296-49570318 CAGGTCAGTGGCTGCCCCCTCGG - Intergenic
1148902637 17:50889922-50889944 CTGGACTCTGGCTGCCTACCTGG + Intergenic
1152420164 17:80188450-80188472 CTGGTCGCTGGCTGTCCTCAGGG - Exonic
1152762351 17:82115437-82115459 CTGTTAACTGGCTGCTAACTCGG - Intronic
1153676137 18:7457325-7457347 CAGGTGACTGGAGGCCCACTCGG - Intergenic
1154000177 18:10475997-10476019 CTGGGCACTGTGTGCCCACGCGG + Intronic
1154027524 18:10722925-10722947 CTGGACACATGCTGTCCACTTGG - Intronic
1155013043 18:21801841-21801863 CTCTGCACTGGATGCCCACTTGG + Intronic
1157570968 18:48711950-48711972 CTGGTCACTGCCTGACCCCCAGG - Intronic
1158308840 18:56137392-56137414 CTGGTCACTTCTTGCCCCCTTGG + Intergenic
1160707286 19:535545-535567 GTGGGCACTGGCTGCCCGCGTGG - Intronic
1160863601 19:1248037-1248059 CTGGTGACTGGCTGGGCACAAGG + Intergenic
1160939569 19:1614045-1614067 CTGTTCCCTGGCTTCCTACTTGG + Intronic
1161031068 19:2057986-2058008 CGGGTCACTGGGTGCTCACTGGG - Intergenic
925407047 2:3612786-3612808 CTGGTCACAGGCAGCCCCCGTGG + Intronic
925515761 2:4679176-4679198 CTGGTCTCCTGCTGCCCCCTAGG + Intergenic
931223031 2:60305516-60305538 CTGCACACTGTCTGTCCACTTGG + Intergenic
933596494 2:84288537-84288559 CTGGTCAATGGCTGCCCTGGGGG - Intergenic
941780446 2:169438672-169438694 CTGATCCCTGGCTGCCCACGGGG - Intergenic
942248239 2:174026345-174026367 CTAGGCCCTGGCTGCCCACAGGG - Intergenic
943713699 2:191126616-191126638 CTGGCCACAGACTGCCCTCTGGG + Intronic
944647134 2:201791323-201791345 CCTGTGATTGGCTGCCCACTGGG + Intronic
948332065 2:237177573-237177595 CTGGTCTCTTGCCACCCACTGGG - Intergenic
948444598 2:238022667-238022689 TGGGTCACTGGCTACCCATTTGG - Intronic
948653617 2:239463938-239463960 CTGGTCATTGCCTGCCCTTTTGG + Intergenic
948994509 2:241571639-241571661 CTGGGCACTGTGTGCCCAGTGGG + Intronic
1170431864 20:16283455-16283477 CTGGTCACCGCCTACACACTGGG - Intronic
1171008981 20:21496754-21496776 CTCTCCACTGGCTGCCCTCTTGG - Intergenic
1172751373 20:37253506-37253528 CTGGCCTCTGGCTCCGCACTGGG + Intronic
1173182051 20:40813145-40813167 ATTCTCACTGGCTCCCCACTGGG - Intergenic
1173751461 20:45480009-45480031 CAGGACACTGGCTGTCCACCTGG - Exonic
1174289095 20:49494760-49494782 CCACTCACTGGCTGACCACTGGG - Intergenic
1174682445 20:52421761-52421783 TTGGTCACTGAGTGCCCACTAGG + Intergenic
1175748799 20:61480574-61480596 CTGGTGGCTGGCTGCCTGCTAGG + Intronic
1176064557 20:63187889-63187911 CTGGTCACTGGCTGCCTTCAAGG - Intergenic
1176118049 20:63441736-63441758 CTGGACACTGTCTTCCCAGTCGG - Intronic
1176150118 20:63586436-63586458 CGGGTCACTGGGTGCCCTCCGGG - Intergenic
1176616165 21:9029422-9029444 CTGGTGCCTAGGTGCCCACTGGG + Intergenic
1177875035 21:26621770-26621792 TTGGTTAGTGGCTGCCCATTTGG + Intergenic
1178428493 21:32498678-32498700 CTGCACACTAGCTGCACACTAGG + Intronic
1178874278 21:36400863-36400885 CTGGTTACTGGCTTCACACGGGG + Intronic
1181951233 22:26555307-26555329 CTATTCACTGGCTGCCCACCTGG + Intronic
1183585953 22:38753042-38753064 CTGGTCACTGCCTGCACGCCCGG + Intronic
1183953291 22:41364466-41364488 CTGGACACTGAGTGCCGACTGGG + Intergenic
1184487051 22:44786067-44786089 CTGGACACTGGATGGGCACTTGG + Intronic
1184666948 22:45994356-45994378 CTGGACACCAGCTGCCCTCTTGG + Intergenic
950750770 3:15126382-15126404 CTGATGACTGCCTGCCCATTAGG - Intergenic
954412154 3:50375528-50375550 CTGGCCACTGGTGCCCCACTGGG + Intronic
954421617 3:50421890-50421912 CAGTTCACTGGCTGCCTCCTGGG + Intronic
954429108 3:50459796-50459818 CAGCTCACTGGCTGCCTCCTGGG + Intronic
954637868 3:52081239-52081261 ATGGTCTCTGGCTGCCTTCTGGG + Intronic
954807466 3:53228911-53228933 CTGGTCACTTGCTGCCCCAGGGG - Intronic
957049274 3:75398815-75398837 CTGGTCAGTGTCTTCCCACCTGG + Intergenic
957070679 3:75565430-75565452 CTGATGACTGCCTGCCCATTAGG + Intergenic
960144870 3:114190297-114190319 TTGCTGGCTGGCTGCCCACTGGG + Intronic
960800067 3:121529525-121529547 ATTGTCACTGCCTGCCCACTAGG - Intronic
961569407 3:127787167-127787189 ATGGTCACTGCCAGCCCCCTGGG + Intronic
961642206 3:128371729-128371751 CTGGCCAGAGGCTGCCCACGAGG - Intronic
963046200 3:141104432-141104454 CTGGTCAGTGGCAGCCACCTGGG - Intronic
964861321 3:161205189-161205211 CAGGACACTGGATGCCCCCTTGG - Intronic
966565960 3:181381681-181381703 CATGTCAGTGGCAGCCCACTTGG - Intergenic
967976796 3:195040033-195040055 CAGGTCACTGTCTCCCCACGGGG - Intergenic
968833157 4:2943523-2943545 CTGCACACTGGCTGCCCTCCTGG - Intronic
968982597 4:3858487-3858509 CTGGCCACTGGCTGCACAGCTGG - Intergenic
969014292 4:4093096-4093118 CTGATGACTGCCTGCCCATTAGG + Intergenic
969739675 4:9015316-9015338 CTGATGACTGCCTGCCCATTAGG - Intergenic
969798847 4:9546859-9546881 CTGATGACTGCCTGCCCATTAGG - Intergenic
971489974 4:27201752-27201774 TTGGCCACTGGCTGGCCACATGG + Intergenic
971643560 4:29166569-29166591 CTGCTCAATGGCTTCCCACTGGG - Intergenic
972459371 4:39286501-39286523 CTGTTCTCTGGCCGGCCACTGGG - Intergenic
972791311 4:42373877-42373899 TGGGTCACTGGCTGCTGACTGGG + Intergenic
974879388 4:67735295-67735317 CTTCTTACTGGCTGTCCACTGGG + Intergenic
975921802 4:79399546-79399568 TTGGGCATTTGCTGCCCACTGGG - Intergenic
977529547 4:98183834-98183856 CTGGTCCCTGACTGACCACATGG + Intergenic
980027092 4:127780787-127780809 CTGCTCACGAGCTGCCCGCTGGG + Intergenic
980214309 4:129832025-129832047 GTGGATACTGGCTGTCCACTGGG - Intergenic
980985763 4:139692645-139692667 CTGGTCTCTGGTTTCCCATTAGG + Intronic
981638723 4:146911336-146911358 CTGCTCATGGGCTGCCCACTGGG + Intronic
984140872 4:176002340-176002362 CTGGTCACTCGCTCTCCTCTGGG - Intronic
985177743 4:187220502-187220524 CTTGTCACTGGCTCCTCATTTGG + Intergenic
985578437 5:684395-684417 CTGGCCCCAAGCTGCCCACTGGG + Intronic
985893738 5:2737206-2737228 CTTGTCACTTGCTACCCACGTGG - Intergenic
986818936 5:11444779-11444801 CTGGGCACTTGCTGGCCCCTGGG + Intronic
987166424 5:15202922-15202944 CTGGTCACTGCCTGTTCACTGGG + Intergenic
988630871 5:32930130-32930152 CTAGTTACTGTCTGCCCACAGGG + Intergenic
992269193 5:75048810-75048832 GTGGTCACTAGCTTCTCACTGGG - Intergenic
992490525 5:77239329-77239351 CAGGTCACAGACTGGCCACTGGG - Intronic
992827890 5:80568531-80568553 CTGGCCTTCGGCTGCCCACTAGG - Intronic
997851721 5:137339102-137339124 CTGGTCACTGGCTGTATGCTGGG - Intronic
998515329 5:142748751-142748773 CTGCCCTCTGGCTGCCCCCTGGG - Intergenic
999373352 5:151069519-151069541 TTGGTCACTGGCTGCATCCTGGG + Intronic
999718435 5:154380657-154380679 GTGGTCACTGGGTAGCCACTGGG - Intronic
1001239148 5:170055156-170055178 CAGGTTGCTGGCTGCCCACTAGG - Intronic
1002781347 6:368993-369015 CTTTTCCCTGGCTGCGCACTAGG - Intergenic
1006448637 6:34093240-34093262 CTGGCAAGTGGTTGCCCACTTGG + Intronic
1008086756 6:47253471-47253493 CTTTCCACTGGCTTCCCACTTGG + Exonic
1016341159 6:143062421-143062443 CTTGTCACGGGCTCCTCACTTGG - Intronic
1016829373 6:148418295-148418317 CTTTTCCCTGGCTGCCTACTCGG + Intronic
1018582232 6:165317251-165317273 CTGGTTACTGGCCACCCTCTGGG + Intergenic
1018607878 6:165617623-165617645 CTGATCCCAGTCTGCCCACTCGG + Intronic
1018727514 6:166625454-166625476 CTAGACACTGGCTGACCAGTGGG - Intronic
1019289339 7:242744-242766 GTGGCCACTGGCTGCCGAGTTGG + Intronic
1020925009 7:14313913-14313935 CAGATCTCTGGCTGCGCACTGGG - Intronic
1024760052 7:52584924-52584946 CTGCAGCCTGGCTGCCCACTGGG - Intergenic
1026562856 7:71464686-71464708 CTAGTCTCAGGCTCCCCACTTGG + Intronic
1028024733 7:85822260-85822282 CTGGGCTCTTTCTGCCCACTTGG - Intergenic
1029297928 7:99556202-99556224 CTTGTCACTTGCTGCTCACTGGG + Intronic
1033639624 7:143249004-143249026 GAGGTCACTGCTTGCCCACTTGG - Intronic
1035255354 7:157622465-157622487 ATGGTCCCTCCCTGCCCACTGGG + Intronic
1035692072 8:1566739-1566761 ATGGTCACTGGCTCATCACTGGG - Intronic
1040948627 8:52912842-52912864 TTGCTCTCTGGCTTCCCACTAGG + Intergenic
1041230096 8:55741600-55741622 CTGCTCACTGCCTACCCAGTGGG - Intronic
1042229748 8:66543858-66543880 CGGTTCTCTGGCTGCCCTCTTGG - Intergenic
1043255606 8:78133185-78133207 GTGGACACTAGCTGACCACTGGG + Intergenic
1046023687 8:108697192-108697214 ATGGTCAGTGGATGTCCACTTGG + Intronic
1048461102 8:134622694-134622716 CTGCTCTCTGGCTTCCAACTGGG + Intronic
1052580479 9:30348987-30349009 CTGGGCTCTTTCTGCCCACTCGG + Intergenic
1053645966 9:40119834-40119856 CTGGTGCCTAGGTGCCCACTGGG - Intergenic
1053759750 9:41343706-41343728 CTGGTGCCTAGGTGCCCACTGGG + Intergenic
1054326977 9:63717731-63717753 CTGGTGCCTAGGTGCCCACTGGG - Intergenic
1054538604 9:66256142-66256164 CTGGTGCCTAGGTGCCCACTGGG + Intergenic
1056801396 9:89694588-89694610 GTGGTCACTGAGTGCCTACTTGG + Intergenic
1057075560 9:92136491-92136513 ATTGGCACTGGCTGCCCTCTTGG - Intergenic
1057542602 9:95989349-95989371 CTGGTGGCTGGCAGCCCCCTAGG - Intronic
1060768026 9:126309515-126309537 CAGGCCACTGGCTGCTCATTGGG + Intergenic
1061448945 9:130658570-130658592 CTGGTCACTTGGTGCCCCCAGGG + Intergenic
1062061885 9:134501458-134501480 CGGGGCTCTGGCTGCCCACTTGG + Intergenic
1062125410 9:134858090-134858112 CTGCTCACTGCCACCCCACTTGG + Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1062702725 9:137916465-137916487 CTGGTCCCTGGCTGCCTGCTCGG + Intronic
1192544759 X:72004387-72004409 CTGGTCACTGCCTGTCCCCTAGG - Intergenic
1195997006 X:110741579-110741601 GTGGCCACTGGCTGCCCTCTGGG + Intronic
1199316444 X:146384082-146384104 ATGGGCACTGGCTGAGCACTCGG + Intergenic
1200048065 X:153413056-153413078 CTAGTCACCTGCTGCCCACCTGG - Intergenic