ID: 1077111017

View in Genome Browser
Species Human (GRCh38)
Location 11:862306-862328
Sequence CTCCATGGCCACAGTCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 151}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077111017_1077111028 -5 Left 1077111017 11:862306-862328 CCTCCCCGACTGTGGCCATGGAG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1077111028 11:862324-862346 TGGAGTGTGGGTTTGGGGATGGG 0: 1
1: 0
2: 3
3: 77
4: 683
1077111017_1077111031 9 Left 1077111017 11:862306-862328 CCTCCCCGACTGTGGCCATGGAG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1077111031 11:862338-862360 GGGGATGGGGTGCCAGCCCAGGG 0: 1
1: 0
2: 1
3: 36
4: 416
1077111017_1077111033 16 Left 1077111017 11:862306-862328 CCTCCCCGACTGTGGCCATGGAG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1077111033 11:862345-862367 GGGTGCCAGCCCAGGGTGTCGGG 0: 1
1: 0
2: 1
3: 40
4: 360
1077111017_1077111029 -4 Left 1077111017 11:862306-862328 CCTCCCCGACTGTGGCCATGGAG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1077111029 11:862325-862347 GGAGTGTGGGTTTGGGGATGGGG 0: 1
1: 0
2: 7
3: 144
4: 1003
1077111017_1077111030 8 Left 1077111017 11:862306-862328 CCTCCCCGACTGTGGCCATGGAG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1077111030 11:862337-862359 TGGGGATGGGGTGCCAGCCCAGG 0: 1
1: 1
2: 2
3: 63
4: 466
1077111017_1077111032 15 Left 1077111017 11:862306-862328 CCTCCCCGACTGTGGCCATGGAG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1077111032 11:862344-862366 GGGGTGCCAGCCCAGGGTGTCGG 0: 1
1: 0
2: 2
3: 27
4: 377
1077111017_1077111025 -10 Left 1077111017 11:862306-862328 CCTCCCCGACTGTGGCCATGGAG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1077111025 11:862319-862341 GGCCATGGAGTGTGGGTTTGGGG 0: 1
1: 0
2: 1
3: 33
4: 313
1077111017_1077111027 -6 Left 1077111017 11:862306-862328 CCTCCCCGACTGTGGCCATGGAG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1077111027 11:862323-862345 ATGGAGTGTGGGTTTGGGGATGG 0: 1
1: 1
2: 17
3: 103
4: 814
1077111017_1077111036 25 Left 1077111017 11:862306-862328 CCTCCCCGACTGTGGCCATGGAG 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1077111036 11:862354-862376 CCCAGGGTGTCGGGAAAGACTGG 0: 1
1: 0
2: 0
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077111017 Original CRISPR CTCCATGGCCACAGTCGGGG AGG (reversed) Intronic