ID: 1077111058

View in Genome Browser
Species Human (GRCh38)
Location 11:862420-862442
Sequence ACTCTGGGTGGTTCTGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 1, 2: 8, 3: 87, 4: 413}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1077111047_1077111058 6 Left 1077111047 11:862391-862413 CCCCCCGGGCTGCCGTGGGATCT 0: 1
1: 0
2: 2
3: 7
4: 102
Right 1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG 0: 1
1: 1
2: 8
3: 87
4: 413
1077111049_1077111058 4 Left 1077111049 11:862393-862415 CCCCGGGCTGCCGTGGGATCTAG 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG 0: 1
1: 1
2: 8
3: 87
4: 413
1077111048_1077111058 5 Left 1077111048 11:862392-862414 CCCCCGGGCTGCCGTGGGATCTA 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG 0: 1
1: 1
2: 8
3: 87
4: 413
1077111050_1077111058 3 Left 1077111050 11:862394-862416 CCCGGGCTGCCGTGGGATCTAGC 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG 0: 1
1: 1
2: 8
3: 87
4: 413
1077111053_1077111058 -6 Left 1077111053 11:862403-862425 CCGTGGGATCTAGCAGGACTCTG 0: 1
1: 0
2: 2
3: 11
4: 174
Right 1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG 0: 1
1: 1
2: 8
3: 87
4: 413
1077111046_1077111058 7 Left 1077111046 11:862390-862412 CCCCCCCGGGCTGCCGTGGGATC 0: 1
1: 0
2: 2
3: 24
4: 209
Right 1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG 0: 1
1: 1
2: 8
3: 87
4: 413
1077111040_1077111058 20 Left 1077111040 11:862377-862399 CCTGCCCTGGACACCCCCCCGGG 0: 1
1: 0
2: 5
3: 31
4: 392
Right 1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG 0: 1
1: 1
2: 8
3: 87
4: 413
1077111043_1077111058 15 Left 1077111043 11:862382-862404 CCTGGACACCCCCCCGGGCTGCC 0: 1
1: 0
2: 2
3: 24
4: 278
Right 1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG 0: 1
1: 1
2: 8
3: 87
4: 413
1077111042_1077111058 16 Left 1077111042 11:862381-862403 CCCTGGACACCCCCCCGGGCTGC 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG 0: 1
1: 1
2: 8
3: 87
4: 413
1077111051_1077111058 2 Left 1077111051 11:862395-862417 CCGGGCTGCCGTGGGATCTAGCA 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1077111058 11:862420-862442 ACTCTGGGTGGTTCTGGCTCAGG 0: 1
1: 1
2: 8
3: 87
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1077111058 Original CRISPR ACTCTGGGTGGTTCTGGCTC AGG Intronic